ID: 904638615

View in Genome Browser
Species Human (GRCh38)
Location 1:31904189-31904211
Sequence GGGCCCTTTGAACAGGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904638615 Original CRISPR GGGCCCTTTGAACAGGTTAA GGG Intergenic
900754724 1:4425728-4425750 GGGCCCTTTGCACAGGCTCCTGG - Intergenic
900819661 1:4876854-4876876 GGGCCTTTGGAACAGGTGCATGG - Intergenic
904638615 1:31904189-31904211 GGGCCCTTTGAACAGGTTAAGGG + Intergenic
907954083 1:59212081-59212103 GTGCACTTTGAAATGGTTAATGG + Intergenic
911033703 1:93516347-93516369 GGGAGCTTTTAACAGGTAAAGGG - Intronic
911405714 1:97436054-97436076 GGGCCCTTTGCACATTTTAAAGG + Intronic
913084223 1:115420614-115420636 GATACCTTTCAACAGGTTAATGG - Intergenic
915330971 1:155112189-155112211 GGGCCCCTTGCACAGGTTAGGGG - Intergenic
1063510380 10:6638830-6638852 GGGCCCTTTTAAGAGAGTAAAGG - Intergenic
1064909331 10:20383338-20383360 GTGGCTTTGGAACAGGTTAATGG + Intergenic
1065577060 10:27131860-27131882 GTCACCTTTGAACATGTTAAAGG - Exonic
1067661018 10:48236291-48236313 GGGCCCCTTTAACAGGCTGAAGG + Intronic
1067661241 10:48237633-48237655 GGGCCTTCTGCACAGGTGAAAGG - Intronic
1068955415 10:62815872-62815894 GGCCCCTTTGACCAGATGAACGG - Exonic
1081141999 11:39513014-39513036 GTGGCTTTGGAACAGGTTAATGG - Intergenic
1085785544 11:79445330-79445352 AGGCCCTTTGAAAAGGTGAAAGG - Intergenic
1091335770 11:134764683-134764705 GGTCCCTTTGGGCAGGTTCAAGG + Intergenic
1093753059 12:22822375-22822397 GTGTCCTGTGAATAGGTTAATGG + Intergenic
1096291883 12:50350723-50350745 GGGCCCTTTCATCAGTGTAAGGG + Exonic
1099100031 12:78427804-78427826 GAGCTCTTCGAACATGTTAAAGG + Intergenic
1102466261 12:113132526-113132548 GGGCCATTTGAATAGGTAGAGGG - Intronic
1103988840 12:124784949-124784971 AGGCCCTTTGCACAGGTCAGGGG - Intronic
1104226862 12:126843482-126843504 GGCTCCTTTGAACAAGTTAAAGG - Intergenic
1108251457 13:48572073-48572095 AGGCCTTTTGAACACTTTAAAGG + Intergenic
1112006227 13:95255905-95255927 GGGCCCTGTGAAGAAGTGAAAGG - Intronic
1118168262 14:63359305-63359327 GGGCTCTTTCAACACATTAAAGG + Intergenic
1121691732 14:95882967-95882989 AAGCCCTCTGAACAAGTTAAAGG - Intergenic
1126701526 15:51372236-51372258 GGGGCCTTTTAAGAGGTTATTGG - Intronic
1127051471 15:55088598-55088620 GGGCCCTCTGGAGAGGGTAAGGG - Intergenic
1129463852 15:75712951-75712973 GGGCCCTTTAAGAAGGTTGAGGG - Intergenic
1139486970 16:67263288-67263310 GGGCTCTTAGAACTGGTTCAGGG + Intronic
1141094316 16:81152169-81152191 GTGCCATGTGTACAGGTTAATGG - Intergenic
1156216381 18:35002331-35002353 GGTATCTTTCAACAGGTTAATGG - Intronic
1157117916 18:44879782-44879804 GGGCCATTTGACCAGGAGAAGGG + Intronic
1160381575 18:78461011-78461033 GCGCTCTTTGAAGAGATTAAGGG - Intergenic
927401983 2:22722088-22722110 GAGACATTGGAACAGGTTAAAGG - Intergenic
927454490 2:23237877-23237899 GAGCCCTTTGAGGAGGTTATGGG - Intergenic
929063661 2:37949944-37949966 GGGCCATTTGCACAGATTACGGG - Intronic
932866282 2:75346488-75346510 GGGCCTTGTGAACAGGTCAGAGG - Intergenic
936134482 2:109877653-109877675 GGTCCCTTTAAAGAGATTAAGGG - Intergenic
936210215 2:110493832-110493854 GGTCCCTTTAAAGAGATTAAGGG + Intergenic
936429409 2:112449308-112449330 GGTCCCTTTAAAGAGATTAAAGG + Intergenic
937845372 2:126573460-126573482 GGGCCCTTTGAAATGGTTCAAGG - Intergenic
937912449 2:127082110-127082132 GGGCCCCTAGAACAGGACAAAGG + Intronic
943324238 2:186478947-186478969 GGGCTCTTTAAACTGGTTATTGG - Intergenic
1169811171 20:9610854-9610876 GTGCCCTTATAAAAGGTTAAGGG + Intronic
1170786939 20:19475392-19475414 GGGCCCTTTAAAACGGTAAATGG - Intronic
1171253910 20:23671739-23671761 GGGCTATTTGTACAGGTAAATGG + Intergenic
1171260408 20:23727020-23727042 GGGCTATTTGTACAGGTAAATGG + Intergenic
1171269521 20:23802834-23802856 GGGCTATTTGTACAGGTAAATGG + Intergenic
1174529492 20:51199633-51199655 GGGCCCTGCGGGCAGGTTAATGG - Intergenic
1175550898 20:59816796-59816818 GGGATGATTGAACAGGTTAATGG + Intronic
1181163434 22:20971025-20971047 GGGCCCTTTGGAAAGGTAGAGGG - Intronic
950690873 3:14656389-14656411 GGACCCTTTAAAAACGTTAATGG - Intronic
952856243 3:37772909-37772931 GTGGCCTGTGAACAGGGTAATGG - Intronic
955516525 3:59731544-59731566 GGGCCCTGAAAACAGGTGAATGG + Intergenic
956174532 3:66460476-66460498 GGGGCCTTTGAAGAGGTGATGGG + Intronic
960935109 3:122894512-122894534 GGGCCCTTGGATCAGGGCAAGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
969961969 4:10953877-10953899 GTGCCCTGTGAGAAGGTTAAAGG + Intergenic
974504710 4:62754254-62754276 GGTTACTTTGAACAGGGTAATGG + Intergenic
984051179 4:174867325-174867347 AGACCCTTTGAAGAGTTTAAAGG + Intronic
985062975 4:186096558-186096580 AGGCCCTTCGCACAGGGTAAAGG - Intergenic
988196203 5:28009246-28009268 AGGCCCTTTGAACAGAGGAAAGG + Intergenic
990969080 5:61483340-61483362 GGGGCCTTTTAAGAGGTGAATGG - Intronic
994521516 5:100843799-100843821 GGGCCCTATGAACATGTTTTGGG - Intronic
997720037 5:136070801-136070823 GGGCCCAGAGAACAGGTAAATGG + Intergenic
997868317 5:137484263-137484285 GAGCCCTTTGAACTGGTTGTGGG - Intronic
997976577 5:138444899-138444921 GGGCCCTTTGTACAAGGTAGGGG - Intronic
1001451575 5:171829103-171829125 GGGCCATTTGAACTAGTTCAGGG + Intergenic
1011806369 6:91077311-91077333 TGGTCCTTTCAACAGATTAAGGG + Intergenic
1017510651 6:155111958-155111980 GGTCCCTGTGAACAGGACAAGGG - Intronic
1023690639 7:42782923-42782945 GGGGTCTTTGCACAGTTTAAAGG + Intergenic
1034460235 7:151194046-151194068 GGGCTCTTTCAGCAGGTCAAGGG + Intronic
1036720960 8:11174844-11174866 GGGGCATTTGAAAAGGTGAAGGG - Intronic
1046504106 8:115115036-115115058 GGGCCCATTGAAGAGGCAAAGGG - Intergenic
1053392665 9:37746759-37746781 CGGCCCTGTAAACAGGTCAACGG + Exonic
1061592490 9:131606948-131606970 TAGCTCTTTGTACAGGTTAAAGG - Intronic
1186396199 X:9211509-9211531 GGGCCCTTGGAAAATGGTAATGG - Intergenic
1189789300 X:44588172-44588194 GGGCCCTTTTAAGACATTAAAGG + Intergenic
1189908071 X:45782391-45782413 GGGCCCTTTGACAAGGTTTAGGG - Intergenic
1190408175 X:50108497-50108519 GGGCCCTTTCAAGAGATTAAAGG - Intergenic
1192212369 X:69136277-69136299 GGCCAGTTTGAACAGATTAATGG + Intergenic
1196681324 X:118472931-118472953 GGCCCCTGTGAAGAGGTGAAAGG - Intergenic
1199529417 X:148830220-148830242 GGGCCCTTTGCTCAGGGTCAGGG - Intronic
1200375794 X:155778707-155778729 GGGTCCTTTGGCCAAGTTAAAGG - Exonic
1202016764 Y:20416167-20416189 AGACCATTTGAACAGATTAAAGG - Intergenic