ID: 904640010

View in Genome Browser
Species Human (GRCh38)
Location 1:31919038-31919060
Sequence AGATCTCCACAGGGGCTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 2, 2: 2, 3: 16, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904640010 Original CRISPR AGATCTCCACAGGGGCTGGA CGG Exonic
900202163 1:1413571-1413593 AGAACTCCACCGGGACTGGACGG - Intergenic
900265672 1:1755902-1755924 AGCTCTCCCCTGGGGCTGTAGGG - Intronic
901768415 1:11518285-11518307 TGAGCCCCAGAGGGGCTGGAGGG + Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
901945878 1:12703154-12703176 AGCTTTCCATAGGGGCTGGATGG + Intergenic
902538600 1:17136508-17136530 AGATCCCCACAGGTGGTGGAAGG - Intergenic
902987873 1:20166423-20166445 GGATCTTCACAGAGGCAGGAGGG - Intronic
903936281 1:26897350-26897372 GGCTCTCCACAGGGGCTGGCTGG + Exonic
904170422 1:28588394-28588416 AGAATTCCACTGGGACTGGATGG - Intergenic
904640010 1:31919038-31919060 AGATCTCCACAGGGGCTGGACGG + Exonic
904696079 1:32332329-32332351 AGAGCCCCACAGGAGCTGGCAGG - Intronic
905181454 1:36169648-36169670 TGATCTCCTCAGTGCCTGGATGG + Intronic
906227971 1:44137797-44137819 ACATTTCCACATGGGCTGAAGGG + Intergenic
908170254 1:61497405-61497427 AGAACTCCACAGGGCATGAAAGG + Intergenic
912760079 1:112359092-112359114 TCATCTCCACAGGGGCGTGAAGG - Intergenic
913046530 1:115078095-115078117 AGACCTCCACAGGGGCAGGAAGG - Intronic
915093096 1:153440018-153440040 GGCTCTTCCCAGGGGCTGGAAGG + Intergenic
916572339 1:166038773-166038795 TGCCCTCCACAGGGACTGGATGG + Intergenic
916647231 1:166797764-166797786 AGACCTGCACAGGGGCCGGGTGG + Intergenic
918190181 1:182166162-182166184 AAATCTCCAGAGGGACTGGCTGG + Intergenic
920918851 1:210281064-210281086 AGATCTCCACAGGCTCTGCCTGG - Intergenic
920925742 1:210339677-210339699 ACAACTCCACTGGGGCTGGAGGG - Intronic
922550453 1:226490644-226490666 AGAGTTCTACAGTGGCTGGAAGG - Intergenic
922680430 1:227590761-227590783 AGAATTCCACTGGGACTGGACGG - Intronic
923167304 1:231378137-231378159 AGTGCTCCACAGGGCCTGCATGG + Intronic
1063377605 10:5563417-5563439 AGGTCTGGACACGGGCTGGAGGG + Intergenic
1065802100 10:29361777-29361799 AGAATTCCACCGGGACTGGATGG - Intergenic
1066404867 10:35108813-35108835 AGAGGTCCACAGGGACTGCATGG - Intergenic
1067262581 10:44707157-44707179 AGACCTACTCAGGGCCTGGAAGG + Intergenic
1069411786 10:68161564-68161586 TGATCTCAACAGGGACAGGATGG - Intronic
1070106575 10:73438174-73438196 AGATCACCCGAGGAGCTGGAGGG - Exonic
1071165845 10:82805507-82805529 AGATTTAAACAGGGTCTGGAAGG - Intronic
1072652180 10:97304249-97304271 AGAAGGCCACAGGGGCTGGTGGG + Intergenic
1072688869 10:97556796-97556818 AGAATTCCACTGGGACTGGACGG - Intronic
1072894395 10:99353754-99353776 AGATCTCAACAGGCTTTGGAGGG + Intronic
1073147187 10:101288605-101288627 AGATGTCCAGGGGGGCTGCACGG - Intergenic
1073469362 10:103713283-103713305 GGATCTAGAGAGGGGCTGGATGG - Intronic
1074993294 10:118731669-118731691 AGTGGTCGACAGGGGCTGGAAGG + Intronic
1075287950 10:121203355-121203377 AGAATTGCAGAGGGGCTGGAAGG - Intergenic
1075334255 10:121597517-121597539 GGGTCTCCGCAGGGCCTGGATGG + Intronic
1076646307 10:131957387-131957409 CCATCTCCACAGGGGCACGAGGG - Intronic
1076646517 10:131958198-131958220 CTATCTCCACAGGGGCACGAGGG - Intronic
1076838636 10:133033672-133033694 GGAGGTCCACAGGGCCTGGAGGG + Intergenic
1076998305 11:310194-310216 AGAGATGCACAGAGGCTGGAAGG - Intronic
1077672438 11:4168164-4168186 AGAGTTAGACAGGGGCTGGAGGG - Intergenic
1079810184 11:24989011-24989033 AGATCTGCACTGGGGCCTGATGG - Intronic
1080496994 11:32830031-32830053 CGCTCTCCGCAGGGTCTGGATGG - Exonic
1080858197 11:36130369-36130391 ATGTGTCCACGGGGGCTGGAAGG + Intronic
1084655897 11:70518165-70518187 TGATCGCCCCAGGGGCTGGGTGG - Intronic
1084681946 11:70671492-70671514 AGCACTCAGCAGGGGCTGGAAGG + Intronic
1090867612 11:130715577-130715599 AGATCACCAAAGGGGCAGAAAGG - Exonic
1091248826 11:134124300-134124322 AAATCTCCACAGGGGCTGGACGG + Intronic
1092057928 12:5522770-5522792 AGTGCTCCAGAGGGGCTGGGTGG + Intergenic
1092067209 12:5600860-5600882 ATATCTACACAGGGGTTGGGTGG - Intronic
1093514745 12:19972751-19972773 GGTTCTCCACAATGGCTGGATGG + Intergenic
1095376705 12:41537885-41537907 AGATCTCCACATGAGCGGGTTGG - Intronic
1097181328 12:57173698-57173720 AGAAGCCCACAGGGTCTGGAAGG + Intronic
1098925713 12:76348101-76348123 AGAGCTCCACAGAGGCTGCCTGG + Intronic
1102046544 12:109833284-109833306 AGATGTCCCCAGGGGCGCGAGGG + Intronic
1104487988 12:129168437-129168459 AGGGGTCCACAGGGGCTGGCAGG - Intronic
1106411751 13:29515609-29515631 ATCTCACCCCAGGGGCTGGAGGG - Intronic
1110198633 13:72821143-72821165 AGATCTCCATTAGGGTTGGAGGG + Intronic
1112385191 13:98932608-98932630 AGTTCTCCACCTAGGCTGGAGGG - Intronic
1113442677 13:110341326-110341348 ACTGCTCCATAGGGGCTGGACGG - Intronic
1113564229 13:111309006-111309028 AGCTCTCCACAGTGGCTACATGG + Intergenic
1116689018 14:48081072-48081094 AGTTCTCCACTGTGGATGGACGG - Intergenic
1117295137 14:54372156-54372178 AGTTCTCCACAGTGGGTGGCCGG - Intergenic
1118382131 14:65226051-65226073 AGAGCTCCTCAGTGGCCGGAAGG - Intergenic
1118636228 14:67751086-67751108 TGTTCTGCACAGGAGCTGGAGGG - Exonic
1119540559 14:75435402-75435424 GGATCTCCATGGGGGGTGGAGGG + Intronic
1119941314 14:78644376-78644398 AGAGTTCCACAGGGCCAGGACGG - Intronic
1122623492 14:103072786-103072808 AGATGTCCACAGAGGCTTCAAGG + Intergenic
1122859480 14:104576131-104576153 TGCTCTGCACAGGGGCTGGTGGG - Intronic
1123771841 15:23536999-23537021 GGCTGTCCACAGGGGCTGCAGGG - Intergenic
1125587015 15:40828305-40828327 AGACCTTCACAGGAGCTGGAGGG - Intronic
1128113913 15:65093705-65093727 AGCTCTTCACAGAGGCTGAAGGG - Intronic
1128428621 15:67569596-67569618 AGATCACAACAGGGGCTAAAAGG - Intronic
1130960071 15:88653315-88653337 AGATCTGAACAGAGCCTGGAGGG + Intronic
1130990857 15:88874902-88874924 AGGGCTCCAAAGGAGCTGGAAGG + Exonic
1132300058 15:100769611-100769633 AGAGCTGGACAGGAGCTGGATGG + Intergenic
1132335236 15:101044199-101044221 AGATTTTCTGAGGGGCTGGAGGG - Intronic
1132744748 16:1431951-1431973 AGAACCCCACGGGGGCTGCACGG + Intergenic
1132749116 16:1449224-1449246 GGAGCTCCACGGGGTCTGGAGGG - Intronic
1134209772 16:12266443-12266465 CGGTCTCCAGAGGGGCTGGTTGG - Intronic
1134231403 16:12433121-12433143 GGACCTCCACAGGGTCTGAAAGG - Intronic
1135182990 16:20291613-20291635 AGATCTGCAAAGGGGGTGCAAGG - Intergenic
1135488124 16:22883890-22883912 AGATCTCCTCTGTGGCTGGCTGG - Intronic
1135531568 16:23259040-23259062 AGAACTGCACACTGGCTGGAGGG + Intergenic
1136673002 16:31874447-31874469 AGATCCCCAGAGGGGCTTGAAGG + Intronic
1137953543 16:52806458-52806480 AGGTCTCCAAAAGGGATGGAGGG - Intergenic
1139334685 16:66223540-66223562 AGAGCTTCCCAGGGGATGGAGGG - Intergenic
1141125118 16:81395573-81395595 ACCTCTCCACAGGGCCTGGTAGG - Intergenic
1142105575 16:88300689-88300711 GGAGCTCCCCAGGGGCTGGGTGG - Intergenic
1147513423 17:41093796-41093818 AGATCTTCACAGGCACAGGATGG - Intronic
1147550408 17:41437874-41437896 AGGTCTCCACCGGGGCTGCTTGG - Intronic
1147615288 17:41823728-41823750 AGATCTCCACAGTGTCTTGCAGG + Intergenic
1147719989 17:42533542-42533564 AGATCTCCACAGGGGCTAGACGG - Intergenic
1148888516 17:50790825-50790847 AGAAATCCTCAGGGCCTGGATGG + Intergenic
1150218084 17:63481254-63481276 AGATGGGCACAGGGGCGGGAAGG + Intergenic
1150785928 17:68162528-68162550 AGAACTCTACAGGGGCTTCAGGG + Intergenic
1152310604 17:79547703-79547725 TGGTCTCCGCAGGTGCTGGACGG - Intergenic
1152637925 17:81437790-81437812 AGATCTGCACAGGGTGGGGAAGG - Intronic
1152906284 17:82972424-82972446 AGCACACCACAGGGGCTAGAAGG + Intronic
1152906379 17:82972807-82972829 AGCACACCACAGGGGCTAGAAGG + Intronic
1156845705 18:41663185-41663207 AGATGATTACAGGGGCTGGAGGG + Intergenic
1160048362 18:75408398-75408420 AGAATTCCCCAGGGGCTGGAGGG - Intronic
1161126461 19:2560627-2560649 CGATGTCCACAGGGCCTGGGGGG + Intronic
1161808025 19:6456334-6456356 CGATCTCCCCAGGGCTTGGATGG - Intronic
1164645567 19:29856622-29856644 AGAGCTCCTCAGAGCCTGGAGGG + Intergenic
1166049918 19:40252581-40252603 AGATCCCCACAGGGCTTGGCAGG - Intronic
1167475829 19:49700595-49700617 AGATCAGCGCAGGGGCTGGAGGG + Intronic
925918720 2:8625033-8625055 ACTTCTCCCCAGAGGCTGGAGGG + Intergenic
927487829 2:23501215-23501237 AGATCCCAACCTGGGCTGGAAGG - Intronic
928255618 2:29719801-29719823 AGCTCTCCACAGGGCCTGGCAGG + Intronic
929350104 2:40940291-40940313 AGATCCTCACAGAGGCTGGGTGG - Intergenic
933999266 2:87693006-87693028 AGCTCTCCAAAGGGACTTGAGGG + Intergenic
935951690 2:108335527-108335549 AGATTTTCTCATGGGCTGGATGG - Intergenic
936018739 2:108978964-108978986 AGTTCTCAGCAGGGGCAGGAGGG + Intronic
936294583 2:111257885-111257907 AGCTCTCCAAAGGGACTTGAGGG - Intergenic
937040275 2:118815515-118815537 AGATCCCCAGAGGGTCTGGCAGG + Intergenic
938069590 2:128301294-128301316 AGAGATCCCCAGGGGCTGCATGG + Intronic
943947573 2:194087712-194087734 AAATCACAACAGGAGCTGGACGG + Intergenic
945073127 2:206011237-206011259 AGATCAGCACTGGTGCTGGAGGG - Intronic
946203960 2:218089944-218089966 AGGCCTCCACAGAGCCTGGAAGG - Exonic
947853889 2:233310156-233310178 AGCTATCCACAGAGGCTGGACGG - Intronic
948335651 2:237204986-237205008 AGATCTCCTCCGGGGATGGGGGG + Intergenic
948727440 2:239943808-239943830 AGCTCTGCAGAGGGGCTGCAGGG - Intronic
948808083 2:240461503-240461525 AGACCTCCACATGTGCTGCAGGG - Intronic
1168773625 20:431499-431521 AGATCTCAAAAGGGGAAGGAGGG - Intergenic
1169208321 20:3752285-3752307 TTATCTCCCCCGGGGCTGGAGGG - Exonic
1174483899 20:50849445-50849467 AGATGGGCAGAGGGGCTGGAGGG + Intronic
1175175507 20:57109386-57109408 AGACCTCCAGAAGGCCTGGAGGG + Intergenic
1176161965 20:63652835-63652857 AGTGCAGCACAGGGGCTGGAGGG - Intronic
1177077071 21:16589155-16589177 AGATCTGGACAGGGGGTGGGGGG + Intergenic
1178112841 21:29386266-29386288 AACTCTGCACAAGGGCTGGATGG + Intronic
1178598171 21:33973464-33973486 AGCTCTCCCCAGAGGCTGGAGGG - Intergenic
1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG + Intergenic
1180801139 22:18632490-18632512 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1180852369 22:19028049-19028071 AGGGCTCCACAGAGGGTGGAAGG + Intergenic
1181019230 22:20090085-20090107 AGATCGGCTCAGGGGCTTGACGG - Exonic
1181220581 22:21362771-21362793 AGGGCTCCACAGAGGGTGGAAGG - Intergenic
1181309083 22:21933991-21934013 AGCTGTCCCCAGGGTCTGGACGG + Intronic
1181667634 22:24409212-24409234 AGTGCTCCCCAGGAGCTGGACGG + Intronic
1184451904 22:44587487-44587509 AGATGTCCACAAGGGCTGTGAGG - Intergenic
954436697 3:50500069-50500091 AGATGGAGACAGGGGCTGGAAGG + Intronic
955781427 3:62488808-62488830 AGATCTCCACAGACTCTGAAAGG + Intronic
955814565 3:62828177-62828199 AGATCTCCATGGGGAATGGAGGG - Intronic
956462224 3:69484274-69484296 AGATTCCCACAGGGGCTGGATGG + Intronic
960616355 3:119599455-119599477 AGGCCTCCTTAGGGGCTGGAAGG + Intronic
961116778 3:124336532-124336554 AGAGCTGCAGAGGGGCTGCAAGG + Intronic
961365433 3:126396428-126396450 AGAATTCCACATGGGCAGGAAGG - Intronic
966926290 3:184646684-184646706 TGATCTGCTCAGGAGCTGGAAGG + Intronic
971027617 4:22604088-22604110 AGAATTCCACCGGGACTGGATGG + Intergenic
973191463 4:47390586-47390608 AGAAATCCCCAGGGGCTGAAAGG + Intronic
974914353 4:68161374-68161396 AGCACTCCACAGGGGATGGTGGG + Intergenic
974949547 4:68571404-68571426 AGAATTCCACTGGGACTGGACGG - Intronic
977259826 4:94785084-94785106 ATATCTCCACAGAGGCTAAATGG - Intronic
980059755 4:128116479-128116501 AGCTCTCTAAAGGGGATGGAAGG + Intronic
982595773 4:157381419-157381441 AGATCTCCAGAGTGGCCAGAAGG + Intergenic
982897222 4:160947544-160947566 AGACCTCCACAGTGCCTGAATGG - Intergenic
984013807 4:174402713-174402735 AGATCCAAGCAGGGGCTGGAGGG + Intergenic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
985670232 5:1203130-1203152 ACATCCCCACTGGGGATGGAGGG + Intronic
985678070 5:1242548-1242570 CGATCCCAACAGGGGCAGGAGGG + Intronic
985678081 5:1242578-1242600 CGATCCCAACAGGGGCAGGAGGG + Intronic
989557906 5:42818450-42818472 AGAATTCCACCGGGACTGGACGG + Intronic
992812991 5:80408129-80408151 AAAGCTCCGCAGGGGCTGTAGGG + Exonic
995540965 5:113185968-113185990 AGATCTCCTCAGGGTCTTGGTGG - Intronic
997258266 5:132445824-132445846 AATTCCCCACAGGGGCTGGCAGG - Intronic
1001072390 5:168598248-168598270 AGACCTTCACAGGTGGTGGAAGG - Intergenic
1003330749 6:5126341-5126363 CGATCTCCCCAGGGTCTTGAAGG - Intronic
1003508461 6:6759411-6759433 CGCTTTGCACAGGGGCTGGAAGG - Intergenic
1003602106 6:7526990-7527012 AGATCTCCATGGAGGCTGGAGGG - Intergenic
1005516879 6:26563572-26563594 AGATCTTGACAGGGAGTGGAAGG + Intergenic
1008000873 6:46358402-46358424 ATATCTCCAAAGGTGGTGGAAGG + Intronic
1011746899 6:90415105-90415127 AGAGCAACACAGGGGCTGGGGGG + Intergenic
1013082206 6:106822633-106822655 AGTTCTCCAGAGGTGCTGGTGGG + Intergenic
1016353056 6:143188677-143188699 AGAGCTCTAGAGGGGTTGGATGG - Intronic
1016357079 6:143229407-143229429 AGAACTCCAGAGAGGCTAGAAGG - Intronic
1019164930 6:170091744-170091766 AAATCTCCCCAGGGCATGGATGG - Intergenic
1020057732 7:5129823-5129845 AGCTGTGCACAGGGGCAGGAAGG - Intergenic
1020169790 7:5836180-5836202 AGCTGTGCACAGGGGCAGGAAGG + Intergenic
1020865223 7:13551745-13551767 AGATTTCCACAGCTGCTGAAGGG + Intergenic
1023659076 7:42454842-42454864 AGAGAGCCACAGGGGATGGATGG + Intergenic
1027239482 7:76318030-76318052 AAAGCTCCCCAGTGGCTGGAGGG + Intergenic
1030905348 7:115174439-115174461 GGAACTCCACAGGTGGTGGAGGG + Intergenic
1031031657 7:116741809-116741831 ATATCTCCTCAGGGACTAGAGGG - Intronic
1032074977 7:128831935-128831957 AGCTCTCCACAGGGGTGGGCGGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035017645 7:155780726-155780748 AGAACTCCACGTGGGCTGGGTGG + Exonic
1036188568 8:6648250-6648272 AGACCTCCACAGTGGCCAGAAGG + Intergenic
1037418273 8:18674598-18674620 AGATCACAGCAGGGGGTGGATGG + Intronic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1045902070 8:107293947-107293969 AGATTTCCAAAGAGGCTGGAAGG - Exonic
1047330035 8:123878566-123878588 AGTGCTGCACAGGGCCTGGAGGG - Intronic
1048035425 8:130673112-130673134 AGCAATCCACAGGGGTTGGAAGG + Intergenic
1048445671 8:134490968-134490990 AGATCTCTACAAGGGATGGAGGG - Intronic
1048455031 8:134570002-134570024 AGAGCTTCACAGTGGCTGCAGGG + Intronic
1049501828 8:142971280-142971302 AGGTCCCCACAGGGGCTGAGCGG + Intergenic
1049511368 8:143028377-143028399 AGGTCCCCACAGGGGCTGAGTGG - Intergenic
1051351567 9:16202692-16202714 AGTTCTGCACAGAGCCTGGATGG - Intergenic
1054979117 9:71183413-71183435 ACATTTTCAAAGGGGCTGGATGG - Intronic
1056815295 9:89796723-89796745 AGAGCTCCAGAAAGGCTGGATGG - Intergenic
1056969580 9:91191183-91191205 AGAGCTGCCCAGGGGCTGGGAGG - Intergenic
1057488146 9:95502180-95502202 AGCTAGGCACAGGGGCTGGAGGG - Intronic
1059698237 9:116749031-116749053 AGATCTACACAGGGGACGGGGGG - Intronic
1060376114 9:123116334-123116356 AGAGCTCCTCAGGGGTGGGAAGG - Intronic
1060836151 9:126756461-126756483 AGAGCCCCACAGGGACTGGGAGG + Intergenic
1060885027 9:127145365-127145387 AGGTCGTCACAGGGCCTGGAGGG - Intronic
1060896723 9:127223648-127223670 GCATCTCTAGAGGGGCTGGAAGG + Intergenic
1061223025 9:129263245-129263267 GGACATCCACAGGTGCTGGATGG + Intergenic
1061900985 9:133671864-133671886 AGATTTCCAGAGCAGCTGGAGGG - Intronic
1062206550 9:135340854-135340876 ACAGCTGCACAGGGGCTGCACGG + Intergenic
1062404681 9:136389802-136389824 AGCTCTCAAAGGGGGCTGGAGGG + Intronic
1188606809 X:32041326-32041348 TGATCTCCACAAGTGTTGGAAGG + Intronic
1190372533 X:49756594-49756616 ACATCTCCAAAGGGCCAGGAGGG - Intergenic
1190968947 X:55330395-55330417 AGGTGTCCACAGTGGCAGGATGG - Intergenic
1191898751 X:66020190-66020212 AGATCTCCAGAAGAGCGGGAAGG - Intergenic
1198638487 X:138727338-138727360 AGATCTCCCCAGTGCCTGGGGGG - Intronic
1201373261 Y:13288395-13288417 AGAATTCCACCGGGACTGGACGG + Intronic