ID: 904641920

View in Genome Browser
Species Human (GRCh38)
Location 1:31937861-31937883
Sequence CCCGGAAGGAGGGCCGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 594}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904641920_904641931 3 Left 904641920 1:31937861-31937883 CCCGGCCCGGCCCTCCTTCCGGG 0: 1
1: 0
2: 4
3: 48
4: 594
Right 904641931 1:31937887-31937909 GTGTCTCCGGCCTGCACTAATGG 0: 1
1: 0
2: 0
3: 2
4: 59
904641920_904641928 -10 Left 904641920 1:31937861-31937883 CCCGGCCCGGCCCTCCTTCCGGG 0: 1
1: 0
2: 4
3: 48
4: 594
Right 904641928 1:31937874-31937896 TCCTTCCGGGGACGTGTCTCCGG 0: 1
1: 0
2: 1
3: 3
4: 62
904641920_904641933 9 Left 904641920 1:31937861-31937883 CCCGGCCCGGCCCTCCTTCCGGG 0: 1
1: 0
2: 4
3: 48
4: 594
Right 904641933 1:31937893-31937915 CCGGCCTGCACTAATGGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904641920 Original CRISPR CCCGGAAGGAGGGCCGGGCC GGG (reversed) Intronic
900014305 1:137894-137916 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
900044169 1:493096-493118 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
900065578 1:728002-728024 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
900366437 1:2313706-2313728 CCTGCAAGGTGGGCCTGGCCAGG + Intergenic
900466180 1:2826600-2826622 CCCCTCAGGAGGGCCAGGCCTGG - Intergenic
901026842 1:6282846-6282868 CCCGGGAGGAGGGCAGGCCATGG + Intronic
901030639 1:6305219-6305241 CCCGGACGGGGCGGCGGGCCGGG + Intronic
901030692 1:6305346-6305368 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
901060953 1:6471699-6471721 CCAGGAAGGAGGGCGGGACCTGG - Intronic
901100476 1:6715383-6715405 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
901223926 1:7601082-7601104 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
901631470 1:10650107-10650129 CCCTGAGGAGGGGCCGGGCCCGG - Intronic
902955396 1:19921672-19921694 CCTGAAAGAAGGGCAGGGCCTGG - Intronic
903068287 1:20713513-20713535 CCAGGTAGGAGGCCCGGACCAGG + Exonic
903175559 1:21578099-21578121 CCCTGAAGGAGGGCTGGGCCTGG - Exonic
903499838 1:23794882-23794904 CCAGGAAGGAAGGCCCGGCCAGG - Exonic
903525086 1:23987232-23987254 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
903778439 1:25807631-25807653 CCAGGAAGGCGGGCTCGGCCTGG + Intronic
903921409 1:26803583-26803605 CCCGGACGGAGCGGCTGGCCCGG + Intergenic
903970911 1:27118236-27118258 CCTGAGGGGAGGGCCGGGCCGGG + Intronic
904476618 1:30769202-30769224 CCCGGCAGAAGGGCTGGACCAGG + Intergenic
904641920 1:31937861-31937883 CCCGGAAGGAGGGCCGGGCCGGG - Intronic
904753169 1:32753894-32753916 CCCGGAGGAGGGGCGGGGCCTGG - Intronic
904784652 1:32974765-32974787 CCCGGACGGGGAGCCTGGCCGGG + Intergenic
905182274 1:36174859-36174881 CACGGCATTAGGGCCGGGCCCGG - Intronic
905427449 1:37896567-37896589 CCCGGACGGAGCGGCTGGCCGGG - Intronic
905973450 1:42157672-42157694 CCAGGAAGGAAGGTCTGGCCTGG - Intergenic
905990704 1:42335026-42335048 CCCGCCAGGGCGGCCGGGCCTGG - Intronic
906196514 1:43933666-43933688 CCCGAAAGGTGGGGCGGGGCAGG + Exonic
906666738 1:47627411-47627433 CCCAGCAAGAGGGCAGGGCCAGG + Intergenic
906740113 1:48174376-48174398 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
907239598 1:53074231-53074253 ACAGGCAGGGGGGCCGGGCCAGG - Intronic
911039082 1:93578222-93578244 GCTGGGAGGAGGGCTGGGCCGGG - Intronic
911351730 1:96762641-96762663 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
911486505 1:98512432-98512454 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
912789793 1:112640030-112640052 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
913022785 1:114804526-114804548 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
914937501 1:151993689-151993711 CCGGGCAGCAGGTCCGGGCCTGG + Intronic
915249438 1:154577850-154577872 CCCAGAAGGGAGGCAGGGCCAGG - Exonic
915490591 1:156248059-156248081 CCAGGCAGGCGGGCCAGGCCTGG + Intronic
915588633 1:156858643-156858665 ACCGGGAGGAGAGCCGGGACTGG - Exonic
917334938 1:173916888-173916910 CCCGGATGGATGGCAGGCCCTGG + Intronic
918311589 1:183289181-183289203 CCCTGTAGGAGGGCAGTGCCAGG + Intronic
919080237 1:192857730-192857752 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
920032956 1:203048386-203048408 CACGGAGGAAGGGCCTGGCCAGG + Intronic
920377051 1:205514427-205514449 CCCAGAAAGAGGACAGGGCCAGG + Intronic
921163752 1:212491193-212491215 CCCGGAAGCAGGGCAAGGCAGGG - Intergenic
922506997 1:226132427-226132449 CCCAGAAAGAGGGCTGGGCGTGG + Intergenic
922705570 1:227788490-227788512 CGCGGAAGGAGTGTCGGGCCCGG + Intergenic
922739763 1:228008412-228008434 CGCGGTAGGGGCGCCGGGCCAGG + Intronic
923003272 1:230025043-230025065 CCCTGATGGATGGCTGGGCCAGG - Intergenic
923391095 1:233515183-233515205 CCCTGAGGGAGAGCTGGGCCTGG + Intergenic
924343625 1:243055484-243055506 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
924384202 1:243487562-243487584 CCTGGAGGCAGGGCAGGGCCTGG + Intronic
1065240029 10:23695389-23695411 CCCCCCAGGAGGGCCAGGCCGGG + Intronic
1065840516 10:29697111-29697133 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1066115235 10:32233546-32233568 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1067119977 10:43465161-43465183 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
1068520632 10:58073461-58073483 CTCAGAAGGAGGGAGGGGCCAGG - Intergenic
1068786709 10:60983828-60983850 GCCAGAAGGAGGGCGGGGCCGGG - Intronic
1069052549 10:63811296-63811318 CCCGGACGGGGGGGCTGGCCCGG + Intergenic
1069593284 10:69654998-69655020 CCTGGAAGGAGGGCAGAGCTGGG + Intergenic
1069792229 10:71030072-71030094 CCCTGAAGGCAGGCAGGGCCAGG - Intergenic
1069817917 10:71210273-71210295 CCTGGAGGGAGAGCAGGGCCCGG + Intergenic
1069908752 10:71747351-71747373 CCCAGAAGAAGGCCCAGGCCAGG + Intronic
1070079123 10:73168249-73168271 GCCGGCGGGAGGGCCAGGCCCGG + Exonic
1070329970 10:75409625-75409647 TCAGGAGGGAGGGGCGGGCCCGG + Intergenic
1070567537 10:77615170-77615192 CCAGGCAGGAGGGCTGGGTCTGG + Intronic
1070800905 10:79243782-79243804 CCCGGAGGGAGCCCAGGGCCCGG - Intronic
1070906567 10:80078627-80078649 CGCGGAGGCAGGGCCGGGGCCGG - Intronic
1070931767 10:80266009-80266031 CCCTGGAGGAGGCCAGGGCCAGG + Intergenic
1072999818 10:100277573-100277595 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1073000037 10:100278076-100278098 CCCGGACGGAGCGGCTGGCCCGG - Intronic
1073063605 10:100745977-100745999 CCGGGGCGGTGGGCCGGGCCGGG - Exonic
1073336445 10:102714079-102714101 CCTGGAGGGAGGCCTGGGCCTGG - Intronic
1075000709 10:118795143-118795165 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
1075050859 10:119182055-119182077 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1075050933 10:119182231-119182253 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
1075128860 10:119722275-119722297 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1075333665 10:121593739-121593761 AACTGAAGGAGGGCCGGGCCAGG + Exonic
1076362564 10:129899608-129899630 GCCGGAGGGAAGGCCAGGCCGGG + Intronic
1076638598 10:131899538-131899560 ACAGGAAGGAGGGCCATGCCTGG - Intergenic
1076749920 10:132537540-132537562 CCCGAAAGGAGGCCCCGCCCCGG + Intergenic
1076776484 10:132700641-132700663 CACAGAGGGAGGGGCGGGCCCGG - Intronic
1076793674 10:132788870-132788892 CCCGGAAGGAGAGCCGGCCTAGG + Intergenic
1076872110 10:133199287-133199309 CCCCAGAGGAGGCCCGGGCCAGG + Intronic
1076970503 11:129571-129593 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
1077080852 11:724154-724176 CCAGGATGGACGGCCTGGCCAGG + Intronic
1077110963 11:862082-862104 CCCGGAGTGAGGGCAGGGCTGGG + Intronic
1077173886 11:1180143-1180165 CCTGGAAGGTGGGCTGGGGCCGG + Intronic
1077366363 11:2162880-2162902 CCAGGTAGGAGGGCAGAGCCAGG + Intergenic
1077413374 11:2413700-2413722 CCGGGAGGGAGGGCTGGGCTGGG - Intronic
1077484004 11:2830627-2830649 CCAGGAAGGAGGTCCTGGGCTGG - Intronic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1077579079 11:3405226-3405248 TCCTGCAGGAGGGCTGGGCCTGG + Intergenic
1078256585 11:9664032-9664054 GCCGGCAGCAGGGCGGGGCCTGG + Intergenic
1079076276 11:17387176-17387198 CCAGGTAGGAGGTGCGGGCCTGG + Exonic
1081269340 11:41065069-41065091 CCCGGAAAGGGGGCTGAGCCAGG + Intronic
1081610905 11:44562874-44562896 CCCTGTAGGAGTGCAGGGCCTGG - Intergenic
1081705567 11:45180645-45180667 CCCGCAAGGAATGCCGGGCCTGG + Intronic
1081807130 11:45896804-45896826 CCCGGAAGGGTGGGGGGGCCAGG - Intronic
1083091132 11:60201134-60201156 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
1083203057 11:61131859-61131881 CCCATAGGGAGGGGCGGGCCCGG + Exonic
1083292031 11:61695815-61695837 CCTGGAAGGAGGGCAGGGGCAGG + Intronic
1083292954 11:61699912-61699934 CCTGGAAGGAGGGTGGGGCTGGG + Intronic
1083620718 11:64048114-64048136 CCCAGAAGCAGGGCCGGGCAGGG + Intronic
1083744901 11:64729983-64730005 CCAGAAGGGAGGGCGGGGCCGGG + Intronic
1083897294 11:65626278-65626300 ACAGGAAGGAGGGCAGGACCAGG - Intronic
1084165186 11:67372275-67372297 CCCGGGGGGAGGGCCAGGCTGGG + Intronic
1084236101 11:67788745-67788767 TCCTGCAGGAGGGCTGGGCCTGG + Intergenic
1084376754 11:68783156-68783178 GCCTGAAAGAGGGCCAGGCCTGG - Intronic
1084836300 11:71804245-71804267 TCCTGCAGGAGGGCTGGGCCTGG - Intergenic
1084951826 11:72670720-72670742 CCCTGAAGTAGGGCCAGGCTGGG - Intronic
1085116476 11:73936284-73936306 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
1085197516 11:74681526-74681548 GCGGGGAGGAGGGCAGGGCCAGG - Intergenic
1085359954 11:75877628-75877650 CCCGGACGGAGCGGCTGGCCAGG + Intronic
1085360002 11:75877755-75877777 CCCGGACGGAGCGGCTGGCCAGG + Intronic
1086853539 11:91839471-91839493 ACCTGGAGGAGGGCCGGGCATGG - Intergenic
1089257673 11:117202397-117202419 CCCAGAAGCAGGCCCTGGCCTGG - Exonic
1089326983 11:117664056-117664078 CCGGGAGGAGGGGCCGGGCCTGG + Intronic
1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG + Intergenic
1090323352 11:125864013-125864035 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1091195313 11:133725915-133725937 CCCTGAAGGAAGGCCAGACCAGG - Intergenic
1091278733 11:134370121-134370143 CCAGGGAGGAAGGCCAGGCCTGG - Intronic
1091300797 11:134506518-134506540 CCAGGAAGGAGGGCAGGGAAAGG - Intergenic
1091601078 12:1918135-1918157 CCCAGAGGGAGGGCAGGGGCGGG + Intronic
1092401858 12:8184365-8184387 CCCGGAAGGGGCGGCTGGCCAGG - Intronic
1092407009 12:8228109-8228131 TCCTGCAGGAGGGCTGGGCCTGG + Intergenic
1092849284 12:12612133-12612155 CCGGGAGGGAGTGCCTGGCCAGG + Exonic
1094301592 12:28970357-28970379 CCCTAAGGGAGGGCCGGGCGCGG - Intergenic
1095672406 12:44876355-44876377 CGGGGAGGGAGGGGCGGGCCGGG + Intronic
1096148191 12:49293503-49293525 CCCGGAAGGAAGGAGGGGCCTGG + Intronic
1096403135 12:51323936-51323958 CCGGGCAGGAGGGGCGGGCAGGG - Intronic
1096468805 12:51863845-51863867 CGGGGGAGGAGGGCGGGGCCGGG + Intergenic
1096468876 12:51864151-51864173 CCCGGGAGGAGGGCCACGCCTGG + Intergenic
1096817298 12:54209620-54209642 ACAGAAAGGAGGGCCAGGCCGGG + Intergenic
1096839138 12:54370170-54370192 GCCGGGAGGAGGGGCGGGCTGGG + Exonic
1097127002 12:56783610-56783632 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1097173043 12:57128199-57128221 CCAGGGAGGAGGGCCCAGCCAGG + Intronic
1097288723 12:57896698-57896720 CCCGGGCGGCGGGCTGGGCCCGG - Intergenic
1097781317 12:63708314-63708336 CCAGGCAGGAGGGCTGGGCGCGG + Intergenic
1098105999 12:67069400-67069422 CCGGGAGGCCGGGCCGGGCCGGG + Intergenic
1099255436 12:80307939-80307961 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1099667351 12:85649376-85649398 CCCGGGCGGAGGGCGGGGGCGGG - Intergenic
1100260614 12:92929170-92929192 CCGGGAAGGAGGTCGGGGCGAGG + Exonic
1100635458 12:96431161-96431183 CCCAAAAGGAGGGCCAGGCGTGG - Intergenic
1100994951 12:100294177-100294199 CCCGGAAGGGGTGGCTGGCCAGG + Intronic
1103276028 12:119712543-119712565 CCCTGGAGGTGGGCCGGGCTTGG - Intronic
1103856408 12:123973392-123973414 CCCGGAGGGAGGCGGGGGCCGGG + Exonic
1104070122 12:125337386-125337408 CCTGGAAGGAGCCCCGGCCCTGG - Intronic
1104887125 12:132117287-132117309 GCGGGCAGGTGGGCCGGGCCTGG + Intronic
1104954354 12:132457213-132457235 GACGGAGGGAGGGCCTGGCCCGG + Intergenic
1104982927 12:132582147-132582169 CCGGGAAGGAGGGCGGTGCCCGG - Exonic
1105068453 12:133219282-133219304 CCTGGCTGGAGGGCAGGGCCTGG + Exonic
1105476155 13:20729816-20729838 CCTGCAAGGAGGGCAGGGCAGGG - Intronic
1105976755 13:25480188-25480210 CCCGGACGGAGTGGCTGGCCGGG + Intronic
1106104830 13:26724112-26724134 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1107165928 13:37280635-37280657 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1107831115 13:44374219-44374241 CCCCGCAGAAGGGGCGGGCCGGG - Intronic
1112368401 13:98774384-98774406 AATGGATGGAGGGCCGGGCCCGG + Intergenic
1112492849 13:99882944-99882966 CTCGGAAGTAGGGCTGGGCCGGG + Intronic
1113289197 13:108886275-108886297 ACCCAAAGGAGGGCCGGGCGCGG - Intronic
1113693596 13:112329096-112329118 CCCAGCAGGATGGCCCGGCCAGG - Intergenic
1113889758 13:113729869-113729891 TCCGGATGGAGGGACGGGTCTGG - Intronic
1113957192 13:114105183-114105205 CCCAGGAGGAGGGCAGGTCCGGG + Intronic
1114740520 14:25092268-25092290 CCCAGAAGGAGGCCATGGCCTGG + Intergenic
1115688891 14:35824651-35824673 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1115754490 14:36518571-36518593 GCTGGAGAGAGGGCCGGGCCGGG + Intronic
1116005226 14:39285396-39285418 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
1118209281 14:63751158-63751180 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
1118517396 14:66545178-66545200 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1118627856 14:67675126-67675148 CCTGGAAAGATAGCCGGGCCAGG + Intronic
1118830073 14:69422563-69422585 CCGGCAAGGAGAGCCAGGCCCGG - Intronic
1119436250 14:74599717-74599739 GGCGGAAGGAGGGCAGGCCCGGG + Intronic
1120859343 14:89240866-89240888 CCCAGGGGTAGGGCCGGGCCTGG + Intronic
1121121690 14:91379756-91379778 CCCCGCAGGAGGCCCGGGCACGG - Intronic
1121410542 14:93745728-93745750 CCAGGAAGGAGGGGCTGGCAGGG - Intronic
1121846277 14:97175001-97175023 CCCTGAAGGAGAGGTGGGCCAGG - Intergenic
1122217664 14:100214613-100214635 CCGGGGAGGAGGGCGGGGCGGGG - Intergenic
1122231353 14:100307535-100307557 CCTGGGAGCAGGGACGGGCCAGG + Intergenic
1122399248 14:101457730-101457752 CCGGGAGGGAGGCGCGGGCCTGG + Intergenic
1122634411 14:103123388-103123410 CGGGGAAGGAGGGGCGGGCGGGG + Intergenic
1122864654 14:104598089-104598111 CCAGGCAGGAGGGCCGGGTGGGG - Intronic
1122905149 14:104798167-104798189 CCTGGAAGGAGGGCCCAGCTAGG - Intergenic
1123047739 14:105526913-105526935 CCCGGGAGGAGGGGCGGGAGGGG - Intronic
1123066852 14:105623276-105623298 CCAGGATGTAGGGCCCGGCCGGG + Intergenic
1123067441 14:105625709-105625731 CCAGGCAGGAGGGCTGAGCCTGG + Intergenic
1123070873 14:105641987-105642009 CCAGGATGTAGGGCCCGGCCGGG + Intergenic
1123071458 14:105644433-105644455 CCAGGCAGGAGGGCTGAGCCTGG + Intergenic
1123090534 14:105740271-105740293 CCAGGATGTAGGGCCCGGCCGGG + Intergenic
1123096165 14:105768021-105768043 CCAGGATGTAGGGCCCGGCCGGG + Intergenic
1123096887 14:105771049-105771071 CCAGGCAGGAGGGCTGAGCCTGG + Intergenic
1202930290 14_KI270725v1_random:28795-28817 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1126295583 15:47133034-47133056 CCCGGACGGGCGGCCTGGCCGGG - Intergenic
1126829822 15:52590076-52590098 CCCAGAAGAAGGGCCGGGCATGG - Intronic
1126851629 15:52800738-52800760 CCAGGAAAGAGAGCCCGGCCTGG - Intergenic
1127071341 15:55290300-55290322 GCCGGGGGCAGGGCCGGGCCTGG - Intronic
1127753621 15:62068641-62068663 CCCGGGACGAGGGCCGCGGCCGG + Exonic
1127931338 15:63599572-63599594 ACCTGAAGGAGGCCCGGGCTCGG + Intronic
1127961168 15:63891978-63892000 CCCCGAGGGAGGGCAGGGACTGG - Intergenic
1128156150 15:65393256-65393278 CTCTGATGGAGGGCGGGGCCAGG + Intronic
1128454980 15:67827169-67827191 CCCGGGGGCAGGGGCGGGCCCGG + Intronic
1128489764 15:68134688-68134710 CCCGGAAGGGGTGGCTGGCCGGG + Intronic
1128490006 15:68135212-68135234 CCCGGAAGGGGTGGCTGGCCGGG + Intronic
1128795986 15:70467008-70467030 CCCGGGGGGAAGGCCAGGCCTGG - Intergenic
1129270049 15:74414792-74414814 GGCAGAAGGAGGGCTGGGCCTGG + Intronic
1129299155 15:74615625-74615647 GGCGGGAGGCGGGCCGGGCCAGG + Exonic
1129431270 15:75503563-75503585 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1129460904 15:75699697-75699719 CCAGGCGGGAGGGCTGGGCCGGG + Intronic
1129468817 15:75738868-75738890 CGCGGAAGAAGTGCCGGACCAGG - Intergenic
1129483161 15:75843600-75843622 CGCGGAAGGGGAGCCGGGCCCGG - Exonic
1129483168 15:75843618-75843640 CGCGGAAGGGGAGCCGGGCGCGG - Exonic
1130428260 15:83822097-83822119 CCCGGACGGGGCGCCTGGCCGGG + Intronic
1130991613 15:88879130-88879152 CCTGGGAGGAGGGCCTGGACTGG - Exonic
1132055325 15:98647720-98647742 CCCGGAAGGGGGGCCCAGACAGG - Intergenic
1132592319 16:731402-731424 CCCGCCAGGAGGGCCCTGCCTGG + Intronic
1132626182 16:892697-892719 CCAGGAAGGAGGGGCCGGCCCGG + Intronic
1132670826 16:1101721-1101743 CCCGGTGTGTGGGCCGGGCCAGG + Intergenic
1132699719 16:1217144-1217166 TCCGGAAGCAGGGCCGGGTGAGG - Intronic
1132743472 16:1427368-1427390 CCCGGCAGTGGGGCTGGGCCCGG - Intergenic
1132803320 16:1764563-1764585 CCCGGAAGCAGGGCAGCGCAGGG + Intronic
1132915206 16:2340383-2340405 CGCGGCAGGAGGGGCGGGCGCGG + Intronic
1133347681 16:5081306-5081328 TCCTGCAGGAGGGCTGGGCCTGG + Intronic
1133450177 16:5897323-5897345 AGCGGATGGAGGGCCGGGCGCGG - Intergenic
1135639541 16:24108952-24108974 CCCGGATGGGGGGGCTGGCCGGG + Intronic
1136370653 16:29834022-29834044 CCCGCAAGGAGTGCTGGGACCGG + Exonic
1136564438 16:31061571-31061593 CCCGGCAGCAGGGGCGGGGCTGG - Exonic
1136990433 16:35148360-35148382 CCTGGATGGAGGGTCAGGCCTGG - Intergenic
1137277710 16:46947491-46947513 ACCACAAGGAGGGCCGGGCGCGG - Intergenic
1137426382 16:48384856-48384878 CCCGGGAGGCGGGCCCGGCCGGG - Intronic
1138534801 16:57654123-57654145 CCCGGCAGGAGGTCAGGGGCAGG + Exonic
1138551431 16:57750981-57751003 CCAGCACTGAGGGCCGGGCCGGG - Intronic
1139761359 16:69187113-69187135 CCCGCCCGGAGGGGCGGGCCCGG - Exonic
1140377411 16:74455669-74455691 CCAGGAAGGAGGGGTGGTCCTGG + Intronic
1140994467 16:80244203-80244225 CCCGGATGGGGGGGCTGGCCGGG - Intergenic
1142136229 16:88453184-88453206 CCCGGCAGGAGGCACGGGGCGGG + Intergenic
1142204607 16:88776887-88776909 CCCGGCAGGAGATCTGGGCCCGG + Intronic
1142268233 16:89075218-89075240 CCTGGGAGGAGGGGCTGGCCTGG - Intergenic
1142295394 16:89218122-89218144 CCCGCCCCGAGGGCCGGGCCTGG - Intronic
1142449749 16:90167911-90167933 CCAGGAAGAAGAGCTGGGCCCGG - Intergenic
1142457340 17:63935-63957 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
1142553010 17:752418-752440 CCCGGAAGAGGGGCCGGGCAGGG - Intronic
1142634234 17:1247123-1247145 CCCGGATGGGGGGGCTGGCCGGG + Intergenic
1142704961 17:1689175-1689197 CCCGGATGGGGGGGCTGGCCGGG + Intergenic
1142811643 17:2398254-2398276 CCCAGACGGAAGGCCTGGCCTGG - Intronic
1142949299 17:3464987-3465009 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1143205211 17:5136323-5136345 CCTGGAAGTGGGGTCGGGCCAGG - Intronic
1143719439 17:8799334-8799356 CCCGGAGGGAGAGGCGGGGCGGG + Exonic
1143749989 17:9021255-9021277 CCCGGAGAGGGGGCTGGGCCGGG - Intergenic
1145001561 17:19308644-19308666 CCCGGGAGGAGGACAGGGCAAGG + Intronic
1145760898 17:27425155-27425177 CCTGGAAGTGGGGCCGGGCCAGG - Intergenic
1145862992 17:28224298-28224320 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1147200758 17:38799734-38799756 CCGGGGAGGAGGGGCGGGCGGGG - Exonic
1147339547 17:39745513-39745535 CCCTGGAGGAGGCCCAGGCCTGG + Exonic
1147536392 17:41325379-41325401 CCTGGAAGTGGGGTCGGGCCAGG - Intergenic
1147852385 17:43452439-43452461 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
1148016363 17:44524916-44524938 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1148046799 17:44749462-44749484 GCTAGAAGGAGGCCCGGGCCTGG + Intronic
1148104634 17:45112757-45112779 CCCTGAAGCAGGCCCGGGCTGGG - Intronic
1148404355 17:47398032-47398054 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1150394687 17:64812068-64812090 CCCTGAAGCTGGGCCGGGCACGG + Intergenic
1151314307 17:73312212-73312234 CCCGGAAGCCGGGCGGGCCCAGG - Intergenic
1151556175 17:74847813-74847835 CCCGGCAGGAGGGGTGGGCCTGG - Intronic
1151705100 17:75763278-75763300 CAGGGAAGGAGGGCTGGGTCAGG + Intronic
1151714713 17:75825396-75825418 CCGGGTAGGAGGGCAGGGCCTGG - Exonic
1151797055 17:76353504-76353526 GGCGGTGGGAGGGCCGGGCCGGG - Intronic
1152580551 17:81163842-81163864 CCCGGCAGCGGGGCAGGGCCTGG + Intronic
1152586632 17:81192306-81192328 CCAGGAAGGAGGTGGGGGCCTGG - Exonic
1152632127 17:81415063-81415085 CCTGGAAGAGGGGCCGGGGCGGG - Intronic
1152830898 17:82496575-82496597 CACGGAAGGAGGGCACGCCCAGG + Intergenic
1153713179 18:7820271-7820293 GCTGCAAGGAGGGCCTGGCCGGG + Intronic
1154131459 18:11740009-11740031 TGCGGAAGGAGGGCTGGGACAGG - Intronic
1157761366 18:50268141-50268163 CCCGGACCGACGGGCGGGCCCGG - Intronic
1158578537 18:58661207-58661229 ACCGGTAGGAAGGCCGGGCGCGG + Intergenic
1160505379 18:79423675-79423697 GCGGGCAGGAGGGCCGGGCTGGG + Intronic
1160622685 18:80181698-80181720 CCAGGAAGGAGGGAAGGGCCAGG - Intronic
1160647699 19:201040-201062 CCAGGAAGAAGAGCTGGGCCCGG + Intergenic
1160845342 19:1163803-1163825 CCCGGCAGGAGGGCAGGAGCCGG + Intronic
1160872982 19:1285595-1285617 CCGGGACCCAGGGCCGGGCCGGG + Intergenic
1160897602 19:1409946-1409968 CCCGCTTGGAGGGCTGGGCCTGG + Intronic
1160943375 19:1630247-1630269 CCCGGCAGGGGGGCGGGGCCAGG + Intronic
1160979990 19:1812342-1812364 CCCGGAAGGGGGCCGGGGGCGGG + Intergenic
1160989122 19:1853419-1853441 CAGGGAAGCAGGGCCGGGCCAGG + Exonic
1160993133 19:1869080-1869102 CCCTGGATGGGGGCCGGGCCAGG + Intergenic
1161037793 19:2095392-2095414 CCCGGAAGGAGGCGCCCGCCAGG - Intronic
1161124221 19:2546845-2546867 CCGGGAACCGGGGCCGGGCCAGG + Intronic
1161320345 19:3638081-3638103 CTGGGAAGGAGGGCTGGGCACGG - Intronic
1161400624 19:4065290-4065312 CCCGGGTGGGGGGCCTGGCCTGG - Intronic
1161461431 19:4400132-4400154 CCCGCATGGCGGGCAGGGCCTGG + Intronic
1161468256 19:4444011-4444033 CCCAGCAGGAAGGCCTGGCCCGG - Intronic
1161672932 19:5624091-5624113 CCCGGGAGGCGGGCAGAGCCTGG + Intronic
1161779017 19:6279375-6279397 CCTGGAAGGAGCTCTGGGCCAGG + Intronic
1161790326 19:6355816-6355838 CCCGGATGGAGCGGCTGGCCGGG - Intergenic
1162023412 19:7879270-7879292 CCAGGAAGGAAAGCCCGGCCAGG + Intergenic
1162027481 19:7902907-7902929 CCCGGGAGGTGGCCAGGGCCAGG - Intergenic
1162426870 19:10602414-10602436 CCCGGCGGGAGGGGCGGGGCCGG + Intergenic
1163023969 19:14498841-14498863 TCGGGAAGGAGGGCTGGGCATGG - Intergenic
1163143109 19:15363323-15363345 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1163209363 19:15829249-15829271 CACGGAATGAGGGCCAGGACAGG - Intergenic
1163365087 19:16871391-16871413 CGCGGCAGGTGAGCCGGGCCGGG + Exonic
1163513089 19:17747729-17747751 CGCGGAGGGAGGGGCGGGGCGGG + Exonic
1163542342 19:17918661-17918683 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1163700122 19:18782706-18782728 CTCTGAGGGAGGGTCGGGCCAGG - Intergenic
1164046954 19:21551350-21551372 CCCGGAAGGGGTGGCTGGCCGGG + Intronic
1164105292 19:22105251-22105273 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1164179758 19:22807829-22807851 CCCGCTAGGAGGGCCCGTCCTGG - Intergenic
1164634990 19:29785555-29785577 GCAGGAGGGAGGGCAGGGCCTGG + Intergenic
1165305575 19:35000685-35000707 CGCGGACGCAGGGCAGGGCCCGG + Intronic
1165481847 19:36069093-36069115 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1165540963 19:36491538-36491560 CCCGGACGGAGAGGCTGGCCGGG - Intergenic
1166873898 19:45885911-45885933 CGGGGAAGGGGGGCCGGGCCTGG - Exonic
1167004150 19:46764747-46764769 CCAGGAAGGAGGGCCCAGGCTGG - Intronic
1167018851 19:46860155-46860177 CCCGGAAGAAGAGGCGGGGCTGG - Intergenic
1167149120 19:47698887-47698909 GCAGGAAGGAGGGCGGGGCAGGG - Intronic
1167216819 19:48170643-48170665 CCGGGAGCAAGGGCCGGGCCAGG + Intergenic
1167377506 19:49119730-49119752 GCTGCCAGGAGGGCCGGGCCGGG - Intronic
1167414387 19:49362462-49362484 ACCGGAGGGGGGGGCGGGCCCGG + Intronic
1167441845 19:49513329-49513351 CCGGGAGGAAGGGGCGGGCCGGG + Intronic
1167537027 19:50060264-50060286 CCCGGAAGTGGGGCAGGCCCTGG - Intergenic
1167551393 19:50163225-50163247 CCTGGGAGGCGGGGCGGGCCGGG - Intergenic
1167643767 19:50695215-50695237 GCGGGAGGGAGGGCAGGGCCGGG + Intronic
1167741722 19:51327910-51327932 CCGGGAAGGTGGGCGGGGCCGGG + Intronic
1167897462 19:52593428-52593450 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
1167903364 19:52638400-52638422 CCCGCGAGGTGGGCGGGGCCTGG + Intronic
1167943056 19:52962922-52962944 CCCGAGAGGTGGGCGGGGCCTGG + Intergenic
1168269129 19:55240171-55240193 CCTGGATGGGGGGCCGGGCTGGG - Intronic
1168689500 19:58368318-58368340 GCCGGAAGGCGCGCCGCGCCAGG + Exonic
1168696142 19:58405287-58405309 CCCGGACGGAGCGGCTGGCCGGG + Intronic
925158772 2:1667039-1667061 CCCTGCAGGTGGGCTGGGCCAGG - Intronic
925466425 2:4110728-4110750 CACGGAAGGAGGGCAGGGAATGG - Intergenic
925746623 2:7049088-7049110 CCTGGAGGGAAGGCAGGGCCTGG + Intronic
925959652 2:9003442-9003464 CCCGGGAGGAGGGTGGGGGCTGG - Intronic
926149164 2:10415200-10415222 GCCGCATGGAGGGCCGGCCCTGG + Intronic
926168293 2:10535153-10535175 GCTGGGAGGAGGGCAGGGCCTGG - Intergenic
926215320 2:10902598-10902620 CCCGGATGGGGGGGCTGGCCGGG + Intergenic
926675750 2:15618774-15618796 CACGGAAGGAGGGCCAAGGCAGG - Intronic
927250555 2:20991867-20991889 CCAGGAAGGAGGGCCTGAGCAGG + Intergenic
927495175 2:23547091-23547113 AGCGGAAGGAGGGCCGGCACCGG + Intronic
927638942 2:24834750-24834772 CCCGGGAGGAGTGGTGGGCCTGG + Intronic
927714037 2:25341410-25341432 CCCGGAAGGCGGGGGCGGCCCGG + Intronic
928167531 2:28981792-28981814 CAAGGAAGGAGGGGCTGGCCTGG + Intronic
928541962 2:32293690-32293712 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
929614606 2:43297615-43297637 CCCGGACGGGGGGGCTGGCCGGG - Intronic
929966745 2:46542607-46542629 CCCCGGAGGAGGGCGGGCCCAGG - Intronic
930727896 2:54699165-54699187 CCCGGACGGAGCGGCCGGCCGGG - Intergenic
931462004 2:62457414-62457436 CCCGGAGGGAGAGCTGAGCCTGG + Intergenic
931752099 2:65339066-65339088 CCCGGACGGAGCGGCTGGCCCGG - Intronic
932334559 2:70922645-70922667 GCCGGGAGGAGGGGCAGGCCGGG + Intronic
934933201 2:98445082-98445104 CCAGGTAGGTGGGCCGGGCCGGG + Exonic
935062323 2:99619608-99619630 CCCCTAAGGAGGGGCGTGCCCGG + Intronic
935593523 2:104862540-104862562 CCGGGAGGGAGGGCAGGGCTGGG + Intergenic
936063511 2:109313476-109313498 CCAGCAAGGAGGGCAGGGCCTGG - Intronic
938343363 2:130549656-130549678 CCCGCCAGGAGGGCCCAGCCAGG - Intronic
938346470 2:130571066-130571088 CCCGCCAGGAGGGCCCAGCCAGG + Intronic
940640841 2:156342694-156342716 CCCGCAGGGCGGGCCGGGGCGGG - Intergenic
941384923 2:164841346-164841368 CCCGGGAGGCGGGCCGGCCGGGG - Exonic
941602873 2:167563327-167563349 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
941603022 2:167563676-167563698 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
941603071 2:167563799-167563821 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
941905181 2:170713058-170713080 CCAGGGAGGCGGGCAGGGCCGGG - Exonic
942355730 2:175108479-175108501 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
943297143 2:186154078-186154100 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
943773413 2:191742063-191742085 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
943773481 2:191742206-191742228 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
944715890 2:202376110-202376132 CCCCGAACGAGGGGCGGGGCCGG + Intergenic
945081004 2:206085862-206085884 CCGGGGATGTGGGCCGGGCCTGG + Intronic
945977141 2:216279868-216279890 CCAGGCAGGAGGGCAGGCCCTGG - Intronic
946248395 2:218399731-218399753 ACTGGGAGGCGGGCCGGGCCGGG - Intronic
946334175 2:219026385-219026407 CCCGGGAGGAGGGTGGGGCTGGG + Intronic
946397272 2:219449243-219449265 CAGGGGAGGTGGGCCGGGCCCGG - Exonic
946921292 2:224584755-224584777 CCCGGGAGGGCGGCCGCGCCGGG + Intronic
948174948 2:235935970-235935992 CCAGCGGGGAGGGCCGGGCCAGG - Intronic
948190532 2:236054864-236054886 CCGGGGAGGGGGCCCGGGCCCGG - Intronic
948205208 2:236159786-236159808 GCCTGAGGCAGGGCCGGGCCCGG - Intergenic
948454174 2:238097110-238097132 GGCGGAGGGAGGGCAGGGCCTGG + Intronic
948632676 2:239312161-239312183 CCTGGAAGGAGGGGCGGGCAGGG + Intronic
949023438 2:241753910-241753932 CCGGGGAGGAGGGCAGGGCCAGG + Intronic
949051749 2:241901300-241901322 GCCGGCAGCAGGGCCGGCCCAGG + Intronic
1168891195 20:1296276-1296298 CCCGCAGAAAGGGCCGGGCCAGG - Intronic
1169077909 20:2773188-2773210 TCCGGAAGGAGAGCAGGGCTGGG + Intergenic
1169885561 20:10394868-10394890 CCCGGACGGGGCGCCTGGCCGGG + Intergenic
1170622937 20:18010238-18010260 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1171203081 20:23257285-23257307 CCAGGATGGAGGGCAGGGTCTGG - Intergenic
1171511061 20:25685424-25685446 ACTGGAAGGAAGGCAGGGCCAGG + Intronic
1171956842 20:31470097-31470119 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1172349553 20:34229937-34229959 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
1172349876 20:34230691-34230713 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
1173516221 20:43667216-43667238 CCCGGAGCGGGAGCCGGGCCGGG - Exonic
1173660088 20:44727255-44727277 CCTGGAGGGTGGGCAGGGCCTGG - Exonic
1174226068 20:49001328-49001350 CCCAGAGTGAGGGCCGGGCACGG - Intronic
1174295191 20:49540571-49540593 CCGAGAAGGAGGTCAGGGCCTGG + Intronic
1174444443 20:50581092-50581114 CTTGGAGGGAGGGCCAGGCCAGG - Intronic
1175988684 20:62776965-62776987 ACAGGAAGGAGGGGCGGGACAGG + Intergenic
1175988711 20:62777039-62777061 ACAGGAAGGAGGGGCGGGACAGG + Intergenic
1176080971 20:63272899-63272921 CCTGGAGGGAGGGGCGGGCAGGG - Exonic
1176099222 20:63357365-63357387 CTGGGCAGGAGGGCCAGGCCTGG - Intronic
1176113808 20:63422464-63422486 CCCAGGAGGAGGGCCGGGGCGGG + Intronic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1176263397 20:64195142-64195164 CCCAGAAACAGGGCCGGGCATGG - Intronic
1176546806 21:8205780-8205802 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1176554711 21:8249989-8250011 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1176565757 21:8388827-8388849 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1176573632 21:8433014-8433036 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1176592302 21:8657377-8657399 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1178075555 21:29011557-29011579 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
1178534976 21:33403609-33403631 CCCGCCAGGTGAGCCGGGCCTGG + Exonic
1179195300 21:39157621-39157643 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1179368262 21:40779728-40779750 CCTGGAGGGACAGCCGGGCCTGG + Intronic
1179810201 21:43865234-43865256 CCCCGACGCAGGGCCGGGCCGGG + Intronic
1179810315 21:43865536-43865558 GCCGGGAGGAGGTCTGGGCCCGG + Intronic
1179969234 21:44825044-44825066 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1180061741 21:45388756-45388778 CCCAGCAGGAAGGCAGGGCCAGG + Intergenic
1180275153 22:10634506-10634528 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1180593736 22:16960790-16960812 CAGGGAAGGAGGGCAGGGCCAGG - Intergenic
1180674783 22:17579780-17579802 CCGGGAAGGTGGCTCGGGCCAGG + Exonic
1181963042 22:26636855-26636877 CCCAGAATGAGGGCTGGGCCTGG + Intergenic
1182222918 22:28772931-28772953 CCCGGCGGGAAGGCCCGGCCGGG - Exonic
1182377343 22:29858074-29858096 CCCGGAAGGGGTGGCTGGCCGGG + Intergenic
1183651057 22:39153299-39153321 CCGCGAACGAGGGCCCGGCCCGG - Intergenic
1184017833 22:41799562-41799584 CAGGGAAGGAGGGACGGGACAGG + Intergenic
1184017926 22:41800035-41800057 CCCGGCAGGGGCCCCGGGCCCGG + Intergenic
1184096385 22:42318558-42318580 CCAGGGAGCAGGCCCGGGCCAGG + Intronic
1184468680 22:44683563-44683585 CCCCGAAGGAGGGCAGGGGCTGG + Intronic
1184520462 22:44991028-44991050 CCTGGAAGGTGGGCAGGGCGGGG - Intronic
1184927337 22:47652480-47652502 CCTGGAAGGACGGCAGGGCAGGG + Intergenic
1185037827 22:48489159-48489181 ACGGGGAGGACGGCCGGGCCAGG - Intergenic
1185046667 22:48531853-48531875 CCCGGAAGGACGGACGGGCCTGG + Intronic
1185182912 22:49373285-49373307 TCCGGAAGGAAAGCAGGGCCCGG + Intergenic
1203251681 22_KI270733v1_random:122065-122087 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1203259731 22_KI270733v1_random:167147-167169 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
949872793 3:8603482-8603504 CCCGGAAGCAAGGCAAGGCCTGG + Intergenic
951611325 3:24495099-24495121 CCCGGGAAGCGGGCCGGGGCGGG - Intronic
953191431 3:40691329-40691351 TCAGAAAGGAGGGCTGGGCCTGG + Intergenic
954355978 3:50084374-50084396 CCCGGAAGGGGCGGCTGGCCAGG + Intronic
954356182 3:50084830-50084852 CCCGGAGGGAGCGGCTGGCCGGG + Intronic
954424039 3:50434029-50434051 CCCGGAAGGAGGGAGGGGTAGGG + Intronic
955060734 3:55489543-55489565 CCAGGAAGGAGGCCAGGGCTGGG - Intronic
955363016 3:58290362-58290384 CCCGGATGGAGCGGCTGGCCGGG + Intronic
963091515 3:141487324-141487346 CCCGGGAGGGGGCCTGGGCCGGG + Intronic
966015074 3:175131791-175131813 CCCGGACGGGGGGCCTGGCCGGG + Intronic
966874658 3:184315134-184315156 CCCGGAGGGCGGGCGGGGCCGGG - Intronic
967062225 3:185882367-185882389 CACGGAAGGAGGGCCTGCCAGGG - Intergenic
968370148 3:198219075-198219097 CCAGGAAGAAGAGCTGGGCCCGG - Intergenic
968411735 4:395968-395990 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
968478907 4:825485-825507 CGGGGAAGGAGGGCACGGCCGGG + Intronic
968514292 4:1009861-1009883 CCGGGACGGGGGGCGGGGCCAGG - Intergenic
968514809 4:1011603-1011625 CCCGGAGCGAGCGCCGAGCCCGG - Intronic
968516773 4:1018829-1018851 CCCCGCAGGAGGGCCTGCCCAGG - Intronic
968551411 4:1225596-1225618 CCCGGAGGCTGGGCCCGGCCCGG - Intronic
968582895 4:1403149-1403171 CCGGGACCGGGGGCCGGGCCTGG - Exonic
968879813 4:3293096-3293118 CCCGGTAGGTGTGCGGGGCCGGG + Intronic
968935424 4:3607747-3607769 CCTGGGCGGAGGGCAGGGCCAGG + Intergenic
968994869 4:3938919-3938941 TCCTGCAGGAGGGCTGGGCCTGG + Intergenic
969463368 4:7340562-7340584 CCCGCAGTGAGGGACGGGCCTGG - Intronic
969632607 4:8347164-8347186 CCTGGTAGGTGGGCCAGGCCTGG + Intergenic
969759134 4:9169875-9169897 TCCTGCAGGAGGGCTGGGCCTGG - Intergenic
969819097 4:9707355-9707377 TCCTGCAGGAGGGCTGGGCCTGG - Intergenic
971324504 4:25633147-25633169 CCCGGAGGCAAGGCCGGGCGCGG - Intergenic
971351974 4:25863079-25863101 GCCGGGAGGAGGGCTGGGCAGGG - Intronic
972288425 4:37669329-37669351 CCCGGAGGGAGCGGCTGGCCAGG - Intronic
973606636 4:52593602-52593624 CCCAGAAGGAGGGCAGGCACAGG - Exonic
973672687 4:53237440-53237462 CCCGGATGGGGGGTCTGGCCGGG + Intronic
980056368 4:128083466-128083488 CCCGGACGGAGAGGCTGGCCAGG + Intronic
982022177 4:151214655-151214677 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
982022226 4:151214782-151214804 CCCGGACGGAGCGCCTGGCCTGG + Intronic
982068547 4:151675200-151675222 CCGAGAAGGAGGGCCAGGCGGGG + Intronic
982182842 4:152765316-152765338 CCCGGAAGGGGCGGCTGGCCGGG + Intronic
982274730 4:153627640-153627662 CCCGGCAGGAAGGCTGGGACAGG - Exonic
982421837 4:155208253-155208275 GGCGGGAGGAGGGCCGGGGCTGG - Intergenic
982784369 4:159523676-159523698 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
982784540 4:159524076-159524098 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
982784735 4:159524523-159524545 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
984004732 4:174294692-174294714 CCCGGAAGGGGTGGCTGGCCGGG + Intronic
984877329 4:184380896-184380918 CCAGGCATGAGGGCAGGGCCAGG - Intergenic
984992579 4:185396073-185396095 CCCGGGAGGAGAGCCCGGCGTGG + Intronic
986330595 5:6713875-6713897 CACGGACGGACGGACGGGCCTGG - Intergenic
989633539 5:43511381-43511403 CCCGGACGGAGCGGCTGGCCGGG - Intronic
990910020 5:60843819-60843841 CCCGAAGGGAAGGTCGGGCCCGG - Intronic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
992443088 5:76812667-76812689 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
992914372 5:81433002-81433024 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
995853990 5:116574147-116574169 CCCGGGAGGTGGGGCGCGCCCGG + Intronic
997273061 5:132557636-132557658 CTCGGAAGGATGTCCGGACCTGG + Intronic
997874921 5:137538175-137538197 CCCGGACGGAGCGGCTGGCCGGG + Intronic
999137594 5:149332819-149332841 CCTGGCAGGAGGGCCAGCCCTGG + Exonic
1001077790 5:168643353-168643375 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1001242868 5:170083442-170083464 CCTGGAAGGAAGGCAGGCCCAGG + Intergenic
1002014098 5:176306053-176306075 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1002031608 5:176434084-176434106 CCCGGAAGGGGCGGCTGGCCTGG - Intergenic
1002196893 5:177506026-177506048 CCCGGGAGGCGGGCTGGGCGCGG - Intronic
1002640249 5:180627303-180627325 CCCGGGGGGAGTGCCTGGCCTGG + Intronic
1002662779 5:180802850-180802872 CCCGGCAGGCGGGGCGGGGCGGG + Intronic
1002729674 5:181325833-181325855 CCAGGAAGAAGAGCTGGGCCCGG - Intergenic
1003188097 6:3850035-3850057 CCCGGCAGGAGGCCCTGGTCAGG + Exonic
1004722151 6:18277245-18277267 CGCGGAGGGAGGGCCGGCCGCGG + Intergenic
1005063497 6:21797314-21797336 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
1005865466 6:29933086-29933108 CCCGGATGGAGCGGCTGGCCAGG - Intergenic
1006091848 6:31632928-31632950 CCTGGAGGAAGGACCGGGCCAGG + Exonic
1006153473 6:32001615-32001637 CCCCGAGGGAGGGTCAGGCCAGG - Intronic
1006159781 6:32034352-32034374 CCCCGAGGGAGGGTCAGGCCAGG - Intronic
1006180428 6:32150641-32150663 CCCGGCAGCAGGGCCGGGAGGGG + Exonic
1006327523 6:33365376-33365398 CCAGGAAGGAAGGCCCAGCCAGG + Intergenic
1007111220 6:39314365-39314387 CCCGGTGGGAGGGAAGGGCCAGG + Exonic
1007390253 6:41546538-41546560 GCCGGAACCAGGGCTGGGCCGGG + Exonic
1007523055 6:42466678-42466700 CCCGGAAGGGGCGGCTGGCCTGG - Intergenic
1007595903 6:43051144-43051166 TCCTGAAGGAGGGCTGAGCCTGG + Exonic
1007622840 6:43225455-43225477 CTTGGGAGGAGGGCCGGGCGCGG - Intergenic
1007663951 6:43503558-43503580 CAAGGAAGCAGGGCCGAGCCAGG - Intronic
1007702005 6:43771120-43771142 CCCGGCCCGAGGCCCGGGCCAGG - Exonic
1010239442 6:73601784-73601806 CCCGGACGGAGCGGCTGGCCGGG - Intronic
1010428253 6:75749476-75749498 CCCGGGAGCAAGGCCGGGCCAGG - Intronic
1012338756 6:98092069-98092091 GACAGAGGGAGGGCCGGGCCTGG + Intergenic
1015402132 6:132798643-132798665 CCCGGGAGGAGGCCGGGGGCGGG + Intergenic
1015730206 6:136339529-136339551 GCCGGCATGAGGGCCGGGCGTGG + Intergenic
1017671905 6:156777527-156777549 CCCCGCCGGAGCGCCGGGCCGGG - Intergenic
1018628777 6:165804967-165804989 CACGGAGGGACGGCGGGGCCTGG + Intronic
1018848284 6:167570329-167570351 TGAGGAAGGAGGGCAGGGCCAGG + Intergenic
1018897157 6:168027656-168027678 CCGGGGAGGAGGGGCGGTCCCGG - Intronic
1019135882 6:169907524-169907546 CCAGGAAGGATGGCCCGGTCTGG + Intergenic
1019292425 7:257257-257279 CCAGGAGGGAGGGCCGCCCCGGG + Intronic
1019524174 7:1473306-1473328 CTCAGAGGGAGGGCCGGGCGGGG + Intronic
1019611643 7:1939819-1939841 CCCCGAAGGACGGCGAGGCCTGG + Intronic
1019701525 7:2476798-2476820 CCCGGAGGAAGAGCCGGGCCAGG - Intronic
1020319131 7:6927242-6927264 TCCTGCAGGAGGGCTGGGCCTGG + Intergenic
1020616428 7:10465803-10465825 CCCGGACGGAGGGGCTGGCCGGG + Intergenic
1021672384 7:23046349-23046371 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
1021735595 7:23637322-23637344 CCCGGAAGGGGCGGCTGGCCAGG - Intronic
1021735695 7:23637547-23637569 CCCGGAAGGGGCGGCTGGCCAGG - Intronic
1022083491 7:27045366-27045388 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1022094403 7:27130073-27130095 CGCGGGAGGTGGGCCGGGGCTGG - Intronic
1022393286 7:29961796-29961818 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1024556209 7:50605293-50605315 CCCTGGAGGAGGGCCACGCCTGG - Exonic
1024582718 7:50813004-50813026 CCTGGAATGTGGGCAGGGCCTGG - Intergenic
1025103310 7:56151598-56151620 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1025711724 7:63917206-63917228 CCCAGGAAGAGGGCCGGGCATGG - Intergenic
1026045256 7:66902419-66902441 CCGGGAGGGAGAGCTGGGCCTGG - Intergenic
1026794574 7:73358473-73358495 GCCGGAAGCAGGGCTGGGACTGG - Exonic
1026868453 7:73836549-73836571 CCCGGATGGGGGGGCTGGCCGGG - Intronic
1026868511 7:73836677-73836699 CCCGGATGGGGGGGCTGGCCGGG - Intronic
1027182915 7:75952433-75952455 CCCGGACGGAGCGGCTGGCCGGG + Intronic
1027202245 7:76071638-76071660 CCGGCAAGGAGAGCTGGGCCTGG + Intergenic
1027202543 7:76072786-76072808 CCGGGAGGGAGAGCTGGGCCTGG + Intergenic
1027202852 7:76073957-76073979 CCCGGATGGAGAGCCGGGCCTGG + Intergenic
1029176705 7:98669809-98669831 CCTGGGAGGAGGGCCAGGCATGG + Intergenic
1029270521 7:99374598-99374620 CCCGAAGGGAGGGCGGGACCTGG + Intronic
1029525758 7:101092640-101092662 CCCGGAAGGCGCGGCTGGCCGGG - Intergenic
1030070651 7:105694769-105694791 GAAGCAAGGAGGGCCGGGCCAGG - Intronic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1032051396 7:128652954-128652976 CCAGGAAGAAGAGCTGGGCCCGG - Intergenic
1032274263 7:130440818-130440840 CCCGGAAGGCGGGAAGGGGCCGG - Intronic
1032291180 7:130591237-130591259 CCCGGACGGAGCGGCTGGCCAGG - Intronic
1032328247 7:130952081-130952103 GCGGGAAGGAGAGCCGAGCCTGG - Intergenic
1033361242 7:140640488-140640510 CGGGGAGGTAGGGCCGGGCCGGG - Exonic
1034361850 7:150506358-150506380 CCCGGACGGGGCGGCGGGCCGGG + Intergenic
1034383660 7:150720459-150720481 CCAGGAAGGAGGACCTGGCCGGG + Exonic
1034638784 7:152586265-152586287 CCCGGATGGGGCGCCTGGCCAGG + Intergenic
1035168017 7:157003013-157003035 CCCGCAAGGCGGGCAGAGCCGGG + Intronic
1035205799 7:157293101-157293123 CTGGGAAGGAAGGCAGGGCCGGG - Intergenic
1035224917 7:157427806-157427828 CCCGGACGGAGATCCGGGACAGG - Intergenic
1035233345 7:157479911-157479933 CCCAGAAGTATGGCCGGGCATGG - Intergenic
1035307562 7:157943021-157943043 CACAGCAGGAGGGCCGGGCCTGG + Intronic
1035580961 8:738720-738742 CGCTGAGGGAGGGCCGGGCGGGG - Intergenic
1036847381 8:12179086-12179108 TCCTGCAGGAGGGCTGGGCCTGG + Intergenic
1037505459 8:19525145-19525167 CCTGGAAGGAGAGCCAGGCCTGG - Intronic
1037819952 8:22130732-22130754 GCCGCGGGGAGGGCCGGGCCGGG + Exonic
1037921434 8:22809013-22809035 CCAAGAAGTAGGGCAGGGCCTGG - Intronic
1039531822 8:38269242-38269264 TCCGCGGGGAGGGCCGGGCCGGG + Intronic
1039793984 8:40896888-40896910 CCCAGAAGGGGTGCCTGGCCCGG - Intronic
1041677215 8:60548661-60548683 CCCGGACGGAGTGGCTGGCCGGG + Intronic
1042049046 8:64685942-64685964 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
1042319700 8:67461710-67461732 CCCGGATGGAGCGGCTGGCCGGG + Intronic
1045305370 8:100952581-100952603 CACGGAGGGTGGGGCGGGCCGGG - Intronic
1046636872 8:116680171-116680193 CCCGGAAGGGGCGGCTGGCCAGG - Intronic
1047267085 8:123315978-123316000 CCCGGATGGGGGGGCTGGCCGGG - Intergenic
1047459765 8:125051595-125051617 AAAGGAAGGAGGGCCGGGCGTGG + Intronic
1047760365 8:127949853-127949875 CCCTGAATGGGGGCCAGGCCAGG + Intergenic
1048173588 8:132131428-132131450 GCCGGAAGGAGGGCAGGCACAGG - Intronic
1048855950 8:138686636-138686658 CCCAGGCTGAGGGCCGGGCCCGG - Intronic
1049465835 8:142750935-142750957 CACGGAAGGCGGGCAGGGCTGGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049583463 8:143422797-143422819 CCGGGGAGGAGCGCCGGGCAGGG - Intronic
1049594785 8:143478280-143478302 CCCGGATGGAGGGCGAGGCCCGG + Intronic
1049651000 8:143769664-143769686 CCAGGCAGGTGGGCCTGGCCTGG - Intergenic
1049741936 8:144245048-144245070 CCAGGAAGGATGGCCTGGCAGGG + Intronic
1049772839 8:144391704-144391726 CCAGCAAGGTGGGCTGGGCCAGG + Exonic
1049987988 9:970173-970195 CCCAGCGGGAGGGCGGGGCCCGG + Intergenic
1052942081 9:34138007-34138029 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1053129243 9:35605703-35605725 CACGGGCGGAGGCCCGGGCCGGG + Exonic
1053457478 9:38242736-38242758 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1054454762 9:65424156-65424178 CCTGGGCGGAGGGCAGGGCCAGG - Intergenic
1055586214 9:77761418-77761440 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
1055586561 9:77762218-77762240 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
1056942244 9:90965518-90965540 CCTGGAAGGAGGGCCTGCCAGGG + Intergenic
1057192119 9:93094155-93094177 CCCTGAAGGTGGGCAGTGCCTGG + Intergenic
1057218553 9:93243297-93243319 CCCTGCAGGAGGGCGGGGGCAGG - Intronic
1057334881 9:94147899-94147921 CCCTGGAGGAAAGCCGGGCCTGG + Intergenic
1057478638 9:95426794-95426816 CGCGCAGGCAGGGCCGGGCCGGG - Intergenic
1058503392 9:105645695-105645717 CCAGGAAGGAGGACAGGGACTGG + Intergenic
1059152630 9:111963248-111963270 CCCGGAAGGAATGCAAGGCCAGG + Intergenic
1059211383 9:112515102-112515124 CCCGGAAGGGGCGGCTGGCCGGG - Intronic
1060058197 9:120434268-120434290 CCCTGAAGGAGGAGCTGGCCTGG + Intronic
1060139838 9:121201066-121201088 CCCTGCAGCCGGGCCGGGCCGGG - Intronic
1060745920 9:126130927-126130949 CGGGGAAGGAGGGCCGGGGCGGG + Intergenic
1060883308 9:127133625-127133647 CCGGGAAGGAGGGCCAAACCTGG - Intronic
1061449593 9:130661040-130661062 CCCGGAGGGGTGGCTGGGCCGGG - Intergenic
1061885761 9:133590342-133590364 ACGGGAGGGAGGGCCAGGCCAGG + Intergenic
1061894982 9:133642495-133642517 CCCGGGAGGAAGGCAGGGCTGGG - Intronic
1061952142 9:133942673-133942695 CCCGAAAGGAAGCCTGGGCCTGG - Intronic
1061959238 9:133979633-133979655 GCCGGAGGCGGGGCCGGGCCCGG - Intronic
1061982933 9:134116136-134116158 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1061983257 9:134116890-134116912 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1061983558 9:134117595-134117617 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1061983882 9:134118349-134118371 CCCGGAAGGGGCGGCTGGCCGGG + Intergenic
1062092037 9:134683360-134683382 CTGGGGAGGAGGGCCAGGCCAGG + Intronic
1062108518 9:134768751-134768773 GCCGTGAGGAGGGCTGGGCCGGG + Intronic
1062289697 9:135788994-135789016 CCCGGAGGCAGGGCCAGGCCTGG + Intronic
1062344956 9:136110356-136110378 GCAGGAAGGACGGCAGGGCCAGG - Intergenic
1062397667 9:136358924-136358946 CCAGGAAAAAGGGCAGGGCCTGG + Exonic
1062532490 9:137008039-137008061 GCCTGCAGGAGGGCCGGGGCGGG - Intronic
1062567198 9:137168555-137168577 CCCGGAGCGAGGGCGGGGGCGGG - Exonic
1062696955 9:137880461-137880483 ACAGGAAGGAGGGCAGGGCCAGG + Intronic
1062754088 9:138278345-138278367 CCAGGAAGAAGAGCTGGGCCCGG - Intergenic
1203468083 Un_GL000220v1:105216-105238 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1203475904 Un_GL000220v1:149188-149210 CGCGGGAGCAGCGCCGGGCCGGG - Intergenic
1203577646 Un_KI270745v1:21102-21124 CCAGGAAGAAGAGCTGGGCCCGG - Intergenic
1203622356 Un_KI270749v1:136224-136246 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1185463140 X:341494-341516 GGCAGGAGGAGGGCCGGGCCCGG - Intronic
1185505536 X:630368-630390 CCCGGGAGGAGCGCAGAGCCCGG - Intronic
1185736565 X:2500685-2500707 CCCGGAAGTGGGGCTGGGCGGGG - Intronic
1187310135 X:18133932-18133954 CCAGGAGTGAGGGCCAGGCCTGG - Intergenic
1187384050 X:18831409-18831431 CCCGGGATGGGGGCCGGGCGCGG + Intergenic
1187901889 X:24033493-24033515 CCGGGCAGGATGGCCGGGCACGG + Intergenic
1188452208 X:30319536-30319558 CCTGGAAGGCGGGCGGGGCGGGG - Intergenic
1189411374 X:40775356-40775378 ACAGGAAAGAGGGCCGGGCGTGG - Intergenic
1190117704 X:47637012-47637034 CCTGGAAGGAGAGCTTGGCCGGG + Exonic
1190171641 X:48115743-48115765 CCCGGACGGGGGGGCTGGCCGGG - Intergenic
1190641644 X:52485977-52485999 CCAGGAAGGAGAGCTGGGTCTGG - Intergenic
1190646028 X:52526888-52526910 CCAGGAAGGAGAGCTGGGTCTGG + Intergenic
1191618041 X:63189490-63189512 CCCGGACGGGGGGGCTGGCCGGG + Intergenic
1192467452 X:71367183-71367205 CTCGGAACGAGGGCCGAGGCAGG - Intronic
1192768933 X:74167474-74167496 CCCGGACGGAGCGGCTGGCCGGG - Intergenic
1195279960 X:103322510-103322532 CCAAGCAGGAGGGCCGGGCGTGG - Intergenic
1196404226 X:115347150-115347172 CCCGGACGGAGCGGCTGGCCGGG + Intergenic
1197736199 X:129851217-129851239 CCCGGAAGGGGCGGCTGGCCGGG - Intergenic
1200239597 X:154486721-154486743 CGGGGCAGGAGGGCGGGGCCGGG - Intergenic
1200259018 X:154602224-154602246 CCCGCAGGGAGGGCCGGCCAGGG + Intergenic
1201730141 Y:17193649-17193671 CCTAGCAGGAGGGCCTGGCCTGG + Intergenic