ID: 904642085

View in Genome Browser
Species Human (GRCh38)
Location 1:31938440-31938462
Sequence GCGTTCGCTGACTGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904642077_904642085 -9 Left 904642077 1:31938426-31938448 CCGGCCCGCCCTCCGCGTTCGCT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 339
904642076_904642085 -6 Left 904642076 1:31938423-31938445 CCACCGGCCCGCCCTCCGCGTTC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 339
904642070_904642085 29 Left 904642070 1:31938388-31938410 CCCTCAGGGGGCGCTGCGGGGCG 0: 1
1: 0
2: 3
3: 24
4: 180
Right 904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 339
904642069_904642085 30 Left 904642069 1:31938387-31938409 CCCCTCAGGGGGCGCTGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 339
904642071_904642085 28 Left 904642071 1:31938389-31938411 CCTCAGGGGGCGCTGCGGGGCGC 0: 1
1: 0
2: 2
3: 31
4: 219
Right 904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904642085 Original CRISPR GCGTTCGCTGACTGGCTGGC TGG Intronic
900361059 1:2289362-2289384 GCCCTCGAAGACTGGCTGGCAGG - Intronic
900535672 1:3175995-3176017 GGGATGGCTGGCTGGCTGGCTGG - Intronic
900678822 1:3904734-3904756 ACATTGGCTGGCTGGCTGGCTGG + Intergenic
900840440 1:5045053-5045075 GGGTTTGCTGTCTGGCGGGCAGG - Intergenic
901377138 1:8847631-8847653 AGGTTGGCTGGCTGGCTGGCTGG + Intergenic
901660734 1:10796380-10796402 CCGATCGCAGGCTGGCTGGCTGG + Intronic
901881833 1:12198658-12198680 GTGCTGGCTGGCTGGCTGGCTGG + Intronic
901954434 1:12773860-12773882 ACCATCCCTGACTGGCTGGCTGG - Intergenic
902243154 1:15101962-15101984 TGGCTGGCTGACTGGCTGGCTGG - Intronic
903349190 1:22707914-22707936 GCGTTCCCTGGCTGCCGGGCTGG + Intergenic
904642085 1:31938440-31938462 GCGTTCGCTGACTGGCTGGCTGG + Intronic
905258995 1:36704436-36704458 GCGTCCTCTGACTGGCAGCCAGG + Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
905995948 1:42380722-42380744 CCGCGCGCTGATTGGCTGGCGGG + Intergenic
906101947 1:43269691-43269713 GCCTTCCCTGACTTGCAGGCTGG - Intronic
907412048 1:54289885-54289907 GCCTTCTCTGACTAGGTGGCTGG - Intronic
908517954 1:64912858-64912880 GGCTTTGCTGATTGGCTGGCTGG + Intronic
913521374 1:119648199-119648221 TGGTTGGCTGGCTGGCTGGCTGG + Intergenic
914047148 1:144102405-144102427 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
914047165 1:144102478-144102500 GGCTTCGCTGGCTGGCTTGCTGG + Intergenic
914047212 1:144102664-144102686 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
914047640 1:144104556-144104578 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
914047845 1:144105443-144105465 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
914047981 1:144106086-144106108 GGGTTGGCTGTCTGGCTGGTTGG + Intergenic
920315253 1:205072094-205072116 GCGTTGGCAGAAGGGCTGGCAGG - Exonic
921894131 1:220381226-220381248 GCTTTCTCTGACTGGGTGGCTGG - Intergenic
923989263 1:239416783-239416805 GAGGTAGCTTACTGGCTGGCAGG - Intronic
1066129504 10:32378790-32378812 GCGAGCGCTGATTGGCTGGGAGG + Intronic
1067475356 10:46561469-46561491 ATGTTTGCTGGCTGGCTGGCTGG + Intergenic
1067619379 10:47780294-47780316 ATGTTTGCTGGCTGGCTGGCTGG - Intergenic
1069846130 10:71372961-71372983 GCGTGCGATGACAGGCTGGAAGG + Intergenic
1069992418 10:72323645-72323667 GCGATGGCTAACTGGCAGGCTGG + Intergenic
1071361168 10:84847279-84847301 ACCTACGCTGACTGGCTGGTAGG + Intergenic
1072983956 10:100122980-100123002 GGGTTGGCTGGCTGGCTGGTTGG + Intergenic
1073325921 10:102643998-102644020 GCGTCCCCCGGCTGGCTGGCCGG - Intergenic
1073639773 10:105240044-105240066 GAGTGCCCTGACTGGCTGGCAGG + Intronic
1075901918 10:126049985-126050007 GAGGTGGCTGGCTGGCTGGCTGG + Intronic
1076462954 10:130658918-130658940 GCGGTCGCTGACTGGCCTGGGGG + Intergenic
1077533237 11:3107044-3107066 CCGCTGGCTGGCTGGCTGGCTGG - Intronic
1080343540 11:31296097-31296119 GGGCTGGCTGGCTGGCTGGCTGG - Intronic
1081814154 11:45929233-45929255 GCCCTCCCTGACTGGCTGTCTGG - Intergenic
1084764936 11:71302091-71302113 GCGCTGGCTGGCTGGCTAGCTGG + Intergenic
1087702301 11:101449073-101449095 TCGTTAGGGGACTGGCTGGCAGG + Intergenic
1089505215 11:118957962-118957984 TGGTTGGCTGGCTGGCTGGCTGG + Intronic
1090285572 11:125496224-125496246 TCGCTGGCTGGCTGGCTGGCTGG - Exonic
1090285573 11:125496228-125496250 GCGCTCGCTGGCTGGCTGGCTGG - Exonic
1090839429 11:130475570-130475592 GGCTTGGCTGGCTGGCTGGCTGG - Exonic
1091832387 12:3559057-3559079 ACGCTGGCTGTCTGGCTGGCTGG - Intronic
1094200454 12:27789815-27789837 GGGCTGGCTGGCTGGCTGGCTGG + Intronic
1097166478 12:57089000-57089022 GCGCTGGCTGCCGGGCTGGCGGG - Exonic
1097169623 12:57105496-57105518 GGCATCGCTGACTGGCCGGCTGG - Exonic
1102645807 12:114403204-114403226 GCGGTCGGGGCCTGGCTGGCTGG - Intronic
1105405271 13:20128006-20128028 GCGGTCGCACACTGGCGGGCAGG - Intergenic
1112090009 13:96073102-96073124 GCCTTCTCTGACTTCCTGGCTGG + Intergenic
1112724908 13:102292071-102292093 GCGCTTGCAGAATGGCTGGCTGG + Intronic
1118222450 14:63867766-63867788 ACCTTGGCTGGCTGGCTGGCTGG - Intronic
1122040554 14:98984820-98984842 TCGTGGGCTGATTGGCTGGCGGG - Intergenic
1122190682 14:100040529-100040551 GCGTTTGCTGACTAGCAGTCAGG - Intronic
1122905177 14:104798271-104798293 GCCTGCCCTGCCTGGCTGGCGGG - Intergenic
1123416627 15:20100306-20100328 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123416639 15:20100353-20100375 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123416707 15:20100645-20100667 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123417235 15:20102813-20102835 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417246 15:20102873-20102895 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417305 15:20103124-20103146 GGCTTTGCTGGCTGGCTGGCTGG + Intergenic
1123417439 15:20103692-20103714 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417450 15:20103752-20103774 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417511 15:20104003-20104025 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123417527 15:20104073-20104095 GGCTTTGCTGGCTGGCTGGCTGG + Intergenic
1123417606 15:20104410-20104432 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
1123417710 15:20104836-20104858 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
1123417958 15:20105862-20105884 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
1123447242 15:20340326-20340348 GGGTTGGCTGTCTGGCTGGCTGG - Intergenic
1123447309 15:20340605-20340627 GGGTTGGCTTTCTGGCTGGCTGG - Intergenic
1123447369 15:20340878-20340900 GCCTTGGCTGGCTGGCTGGCTGG - Intergenic
1123447537 15:20341597-20341619 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1123447549 15:20341640-20341662 GGCTTGGCTGTCTGGCTGGCTGG - Intergenic
1123447607 15:20341917-20341939 GGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1123447684 15:20342253-20342275 GGCTTGGCTGGCTGGCTGGCCGG - Intergenic
1123447755 15:20342591-20342613 GGATTGGCTGGCTGGCTGGCTGG - Intergenic
1123447769 15:20342642-20342664 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1123447866 15:20343119-20343141 GGCTTCGCTGGCTGGCTGGCTGG - Intergenic
1123447885 15:20343209-20343231 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1123447971 15:20343580-20343602 TGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1123447987 15:20343640-20343662 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1123448074 15:20344001-20344023 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1123525965 15:21107412-21107434 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123525977 15:21107459-21107481 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123526046 15:21107751-21107773 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123526511 15:21109667-21109689 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123526522 15:21109727-21109749 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123526580 15:21109978-21110000 GGCTTTGCTGGCTGGCTGGCTGG + Intergenic
1123526704 15:21110502-21110524 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
1123526742 15:21110666-21110688 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123526815 15:21110970-21110992 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123526825 15:21111030-21111052 GCCTGTGCTGTCTGGCTGGCTGG + Intergenic
1123526886 15:21111281-21111303 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1123526902 15:21111351-21111373 GGCTTTGCTGGCTGGCTGGCTGG + Intergenic
1123526980 15:21111688-21111710 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
1128748085 15:70129057-70129079 CAGTGCCCTGACTGGCTGGCTGG + Intergenic
1132606313 16:795210-795232 GCCTTCGATGACCTGCTGGCGGG + Exonic
1133118360 16:3590993-3591015 GAGGACGCTGACTGGCTGGAGGG - Exonic
1136716097 16:32285568-32285590 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136716116 16:32285637-32285659 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136716147 16:32285757-32285779 GGCTTCGCTGGCTGGGTGGCTGG + Intergenic
1136822771 16:33336172-33336194 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136822818 16:33336375-33336397 GGCTTGGCTGCCTGGCTGGCTGG + Intergenic
1136822841 16:33336478-33336500 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136822880 16:33336639-33336661 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136822944 16:33336917-33336939 GTCTTGGCTGCCTGGCTGGCCGG + Intergenic
1136823025 16:33337247-33337269 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136823063 16:33337424-33337446 GGCTTGGCTGCCTGGCTGGCTGG + Intergenic
1136823086 16:33337531-33337553 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
1136823118 16:33337671-33337693 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136823193 16:33338007-33338029 GTCTTGGCTGCCTGGCTGGCCGG + Intergenic
1136823272 16:33338328-33338350 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136823362 16:33338719-33338741 GGCTTGGCTGCCTGGCTGGCTGG + Intergenic
1136823418 16:33338966-33338988 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136823471 16:33339184-33339206 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136823490 16:33339270-33339292 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1136834535 16:33492048-33492070 GGCTTCGCTGGCTGGTTGGCTGG + Intergenic
1136834595 16:33492309-33492331 GGCTTGGCTGCCTGGCTGGCTGG + Intergenic
1138099015 16:54236677-54236699 AAGTTGGCTGGCTGGCTGGCTGG - Intergenic
1139490652 16:67284304-67284326 GCAGCCGCTGACTGGCTGGGAGG + Exonic
1203010267 16_KI270728v1_random:231984-232006 GGCTTCGCTGGCTGGTTGGCTGG - Intergenic
1203010516 16_KI270728v1_random:233043-233065 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203138540 16_KI270728v1_random:1745761-1745783 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203138581 16_KI270728v1_random:1745951-1745973 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203138734 16_KI270728v1_random:1746616-1746638 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203138783 16_KI270728v1_random:1746819-1746841 GGCTTCGCTGGCTGGCTGACTGG - Intergenic
1203138927 16_KI270728v1_random:1747474-1747496 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203139028 16_KI270728v1_random:1747932-1747954 GGCTTGGCTGGCTGGCTGGCCGG - Intergenic
1203139121 16_KI270728v1_random:1748323-1748345 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203139133 16_KI270728v1_random:1748379-1748401 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203139161 16_KI270728v1_random:1748503-1748525 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1203144433 16_KI270728v1_random:1791196-1791218 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1148079028 17:44957365-44957387 GTGCAGGCTGACTGGCTGGCTGG - Intergenic
1148346076 17:46904371-46904393 TGGGTGGCTGACTGGCTGGCTGG + Intergenic
1148989093 17:51649973-51649995 TGGCTGGCTGACTGGCTGGCTGG - Intronic
1149985688 17:61345254-61345276 GCTATGCCTGACTGGCTGGCTGG + Intronic
1152421520 17:80195820-80195842 GCTTACGCTGGCTGGCAGGCGGG - Intronic
1156587133 18:38443876-38443898 GTGTACTCTGACTGGCTGGCTGG + Intergenic
1157429680 18:47614374-47614396 TCATTGGCTGGCTGGCTGGCTGG + Intergenic
1158350398 18:56559286-56559308 GCATTGGCTAGCTGGCTGGCTGG + Intergenic
1159006900 18:63021419-63021441 TGGTTGACTGACTGGCTGGCTGG - Intergenic
1159729059 18:72002265-72002287 GTGTTCTCTGACAGGCTTGCTGG - Intergenic
1160441106 18:78893418-78893440 GCCTTCGGTGACTGGCTGCTGGG - Intergenic
1160946769 19:1647400-1647422 GCCTTCGCCTCCTGGCTGGCTGG - Intronic
1161933736 19:7358121-7358143 GAGTTGGCTGATTGGCTGGTTGG - Intronic
1162301914 19:9849265-9849287 GGGTTCGGCCACTGGCTGGCGGG - Exonic
1162742616 19:12782298-12782320 GTGTTCGCTGCGAGGCTGGCTGG + Intronic
1163810804 19:19430245-19430267 CCATGCGCTGGCTGGCTGGCTGG - Intronic
1167849237 19:52189587-52189609 GGTTCCGCTGGCTGGCTGGCTGG - Intergenic
1168293895 19:55369703-55369725 GGGAGCGCTGATTGGCTGGCGGG - Intronic
1202686529 1_KI270712v1_random:55032-55054 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1202686665 1_KI270712v1_random:55675-55697 GGGTTGGCTGTCTGGCTGGTTGG + Intergenic
1202686811 1_KI270712v1_random:56326-56348 GGGTTGGCTCGCTGGCTGGCTGG + Intergenic
1202686812 1_KI270712v1_random:56330-56352 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
1202686839 1_KI270712v1_random:56433-56455 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1202687000 1_KI270712v1_random:57153-57175 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
1202687001 1_KI270712v1_random:57157-57179 TCGCTGGCTGGCTGGCTGGCAGG + Intergenic
1202687036 1_KI270712v1_random:57290-57312 GGTTTGGCTGGCTGGCTGGCTGG + Intergenic
1202687144 1_KI270712v1_random:57776-57798 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
1202687179 1_KI270712v1_random:57939-57961 GGCTTGGCTGACTGGCTGGCCGG + Intergenic
1202687327 1_KI270712v1_random:58521-58543 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1202687355 1_KI270712v1_random:58637-58659 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
1202687490 1_KI270712v1_random:59243-59265 TCGCTTGCTGGCTGGCTGGCGGG + Intergenic
932039895 2:68288073-68288095 GAGCTGGCTGGCTGGCTGGCTGG - Intronic
932641495 2:73451702-73451724 GAGTTAGCTCACTGTCTGGCAGG - Exonic
933958951 2:87396734-87396756 TCGCTGGCTGGCTGGCTGGCGGG - Intergenic
933958953 2:87396738-87396760 TGGCTCGCTGGCTGGCTGGCTGG - Intergenic
933959215 2:87397925-87397947 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933959269 2:87398132-87398154 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
933959327 2:87398387-87398409 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933959376 2:87398566-87398588 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
933959431 2:87398808-87398830 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933959568 2:87399404-87399426 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933960527 2:87405736-87405758 GGCTTAGCTGGCTGGCTGGCTGG - Intergenic
933960572 2:87405933-87405955 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933960762 2:87406819-87406841 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933961060 2:87408181-87408203 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933961278 2:87409166-87409188 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933961573 2:87410502-87410524 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933961711 2:87411143-87411165 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933962298 2:87413932-87413954 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933962414 2:87414434-87414456 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933962466 2:87414633-87414655 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933962496 2:87414740-87414762 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
933962540 2:87414941-87414963 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
933962676 2:87415527-87415549 GGCTTGGCTGACTGGGTGGCTGG - Intergenic
933962688 2:87415583-87415605 GGCTTGGCTGACTGGGTGGCTGG - Intergenic
933962725 2:87415746-87415768 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933962843 2:87416314-87416336 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933962966 2:87416907-87416929 GGGATGGCTGGCTGGCTGGCTGG - Intergenic
933963026 2:87417121-87417143 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
933963253 2:87418117-87418139 GGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933963366 2:87418563-87418585 GGCTTGGCTGACTGGGTGGCTGG - Intergenic
933963378 2:87418619-87418641 GGCTTGGCTGACTGGGTGGCTGG - Intergenic
933963414 2:87418778-87418800 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933963827 2:87420630-87420652 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933965283 2:87427379-87427401 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933965568 2:87428654-87428676 GCCTTGGCTGGCTGGGTGGCAGG - Intergenic
933965584 2:87428718-87428740 GGGCTGGCTGAGTGGCTGGCTGG - Intergenic
933965610 2:87428851-87428873 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933965639 2:87428971-87428993 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933965667 2:87429074-87429096 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933965696 2:87429194-87429216 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
933965766 2:87429506-87429528 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933965806 2:87429654-87429676 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
933965856 2:87429879-87429901 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
933965935 2:87430224-87430246 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934243071 2:90288694-90288716 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934243190 2:90289244-90289266 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934243395 2:90290215-90290237 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934243682 2:90291485-90291507 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
934243710 2:90291605-90291627 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934243940 2:90292616-90292638 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
934243980 2:90292764-90292786 GGCTTGGCTGCCTGGCTGGCTGG - Intergenic
934244135 2:90293448-90293470 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934244604 2:90296436-90296458 GGCTTAGCTGGCTGGCTGGCTGG - Intergenic
934244618 2:90296495-90296517 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934244643 2:90296633-90296655 GGCTTTGCTGGCTGGCTGGCTGG - Intergenic
934244654 2:90296692-90296714 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934244857 2:90297606-90297628 GGCTTGGCTGACTGGGTGGCTGG - Intergenic
934244868 2:90297662-90297684 GGCTTGGCTGACTGGGTGGCTGG - Intergenic
934244904 2:90297825-90297847 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
934263834 2:91499178-91499200 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934263859 2:91499285-91499307 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934263871 2:91499341-91499363 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
934263882 2:91499397-91499419 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
934263932 2:91499586-91499608 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934263967 2:91499743-91499765 GGCTTGGCTGACTGGGTGGCTGG + Intergenic
934263991 2:91499848-91499870 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934264008 2:91499906-91499928 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934264193 2:91500750-91500772 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934264237 2:91500977-91500999 TGGTTGGCTGGCTGGCTGGCTGG + Intergenic
934264249 2:91501032-91501054 GGCTTAGCTGGCTGGCTGGCTGG + Intergenic
934264716 2:91503983-91504005 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934264866 2:91504644-91504666 GGCTTAGCTGCCTGGCTGGCTGG + Intergenic
934265038 2:91505392-91505414 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934265039 2:91505396-91505418 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934265081 2:91505576-91505598 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934265083 2:91505580-91505602 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934265326 2:91506669-91506691 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934265327 2:91506673-91506695 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934265564 2:91507721-91507743 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934265565 2:91507725-91507747 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934265721 2:91508406-91508428 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934265723 2:91508410-91508432 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934266076 2:91509992-91510014 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934266078 2:91509996-91510018 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934266255 2:91510841-91510863 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934266257 2:91510845-91510867 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934266503 2:91511942-91511964 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934266505 2:91511946-91511968 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934266749 2:91513035-91513057 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934266750 2:91513039-91513061 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934266987 2:91514086-91514108 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934266988 2:91514090-91514112 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934267338 2:91515645-91515667 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934267340 2:91515649-91515671 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934267572 2:91516713-91516735 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934267574 2:91516717-91516739 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934267755 2:91517553-91517575 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934267757 2:91517557-91517579 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934268220 2:91519564-91519586 GGCTTCGCTGGCTGGGTGGCTGG + Intergenic
934268525 2:91520941-91520963 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934268526 2:91520945-91520967 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934268721 2:91521832-91521854 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934268722 2:91521836-91521858 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934268971 2:91522940-91522962 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934268973 2:91522944-91522966 TCGCTGGCTGGCTGGCTGGCGGG + Intergenic
934269221 2:91524054-91524076 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934269467 2:91525149-91525171 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934269468 2:91525153-91525175 TCGCTGGCTGGCTGGCTGGCTGG + Intergenic
934269722 2:91526265-91526287 TGGCTCGCTGGCTGGCTGGCTGG + Intergenic
934269846 2:91526801-91526823 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
934269873 2:91526921-91526943 GGTTTGGCTGGCTGGCTGGCTGG + Intergenic
934270042 2:91527710-91527732 GGCTTGGCTGGCTGGCTGGCTGG + Intergenic
940770817 2:157837847-157837869 ACGTTCAATGACTGGCTTGCGGG - Intronic
942184181 2:173408544-173408566 GCTGTGGCTGACTGGCTGGGTGG + Intergenic
944760073 2:202806107-202806129 TCCTTGGCTGGCTGGCTGGCTGG - Intronic
944760293 2:202807628-202807650 TCCTTGGCTGGCTGGCTGGCTGG - Intronic
946415367 2:219537441-219537463 GGGTCCCCTGACTGGCTGGCAGG + Intronic
946450410 2:219774568-219774590 GTGTTTGCTGAGTGGCTGGCTGG + Intergenic
1169077109 20:2768108-2768130 GCGCTCGCTCCCAGGCTGGCAGG - Intergenic
1172874707 20:38157090-38157112 ACGTTCTCTGCCTGGCTGGGCGG + Intronic
1174036240 20:47670086-47670108 ACATTTGCTGCCTGGCTGGCTGG + Intronic
1179634502 21:42698905-42698927 GCGCTCGCTGTATGCCTGGCAGG - Intronic
1180553981 22:16561255-16561277 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180553999 22:16561332-16561354 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554027 22:16561443-16561465 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554265 22:16562841-16562863 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554288 22:16562949-16562971 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554309 22:16563044-16563066 GGCTTTGCTGGCTGGCTGGCTGG - Intergenic
1180554321 22:16563103-16563125 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554355 22:16563253-16563275 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554397 22:16563456-16563478 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554449 22:16563662-16563684 GGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554673 22:16564592-16564614 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554710 22:16564764-16564786 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554769 22:16565023-16565045 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180554946 22:16565774-16565796 GGCTTGGCTGGCTGGCTGGCCGG - Intergenic
1180555082 22:16566353-16566375 GGCTTGGCTGCCTGGCTGGCCGG - Intergenic
1180555181 22:16566767-16566789 GGTTTGGCTGGCTGGCTGGCTGG - Intergenic
1180555188 22:16566797-16566819 GGCTTGGCTGGCTGGCTGGCTGG - Intergenic
1180555236 22:16566996-16567018 TGGCTCGCTGGCTGGCTGGCTGG - Intergenic
1180555438 22:16567856-16567878 GGCTTGGCTGGCTGGCTGGCCGG - Intergenic
1180555516 22:16568201-16568223 GGCTTGGCTGGCTGGCTGGCCGG - Intergenic
1181271930 22:21664157-21664179 GCTTTCGGTGACTGGGTGGATGG + Intronic
1182287209 22:29255480-29255502 CCATTTGCTGGCTGGCTGGCTGG - Intronic
1182474528 22:30569410-30569432 CTGTTGGGTGACTGGCTGGCTGG + Intronic
1184697475 22:46148051-46148073 GGCTTCTCTGGCTGGCTGGCAGG + Intergenic
952818159 3:37463408-37463430 GGGTTAGCTGGTTGGCTGGCTGG + Intronic
955810438 3:62782291-62782313 TGGCTCGCTGGCTGGCTGGCTGG - Intronic
960963080 3:123085473-123085495 GGCTTGGCTGACTGGCTGGAAGG + Intronic
962253527 3:133854425-133854447 GGGATCGTGGACTGGCTGGCAGG - Intronic
962952999 3:140237304-140237326 GCTTTCCCTCACTGGCTGGTGGG + Intronic
969353058 4:6609326-6609348 GCGTGCGCTGACTGTGTGCCGGG - Intronic
981723098 4:147821053-147821075 GGGCTGGCTGGCTGGCTGGCTGG + Intronic
983690751 4:170465790-170465812 GCCTTTGCTGACTGCCAGGCTGG - Intergenic
986361214 5:6980026-6980048 GGGCTGGCTGGCTGGCTGGCTGG - Intergenic
987336964 5:16905538-16905560 GCCCTGGCTGGCTGGCTGGCTGG - Intronic
990536544 5:56729026-56729048 TCGTGGGCTGGCTGGCTGGCTGG - Intergenic
999323426 5:150628424-150628446 GGGTTCCCTTCCTGGCTGGCTGG + Intronic
1001386348 5:171342724-171342746 GTGTTCACTGACTGACTGCCAGG + Intergenic
1001722251 5:173866540-173866562 GCCTTCCTTGTCTGGCTGGCTGG - Intergenic
1002808626 6:603648-603670 ACGTTTGCTCAGTGGCTGGCTGG - Intronic
1003556059 6:7141201-7141223 GCGGGCGCCGATTGGCTGGCGGG + Intronic
1004585913 6:17000152-17000174 TGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1007267030 6:40604285-40604307 GAGTTGGCTGGCTGGCAGGCTGG + Intergenic
1019625885 7:2015442-2015464 GGGGCCCCTGACTGGCTGGCAGG - Intronic
1024013771 7:45293187-45293209 GCGTGCCCTCTCTGGCTGGCTGG + Intergenic
1025022030 7:55487856-55487878 GGGCTGGCTGGCTGGCTGGCAGG - Intronic
1026840333 7:73667425-73667447 GTGAGCGCTGACTTGCTGGCCGG - Intergenic
1027222024 7:76220298-76220320 GCCTTCCCTGACTGCCTGGAAGG - Intronic
1031371064 7:120967141-120967163 TAGTTAGATGACTGGCTGGCTGG + Intronic
1031974480 7:128085096-128085118 GCCCTTGCTGGCTGGCTGGCTGG + Intronic
1035318778 7:158014725-158014747 GAGATGGCTGGCTGGCTGGCCGG - Intronic
1039782507 8:40799060-40799082 TGGTTGGCTGGCTGGCTGGCTGG + Intronic
1045278297 8:100726491-100726513 GCGTTTCCTGACACGCTGGCTGG - Intergenic
1047402562 8:124558773-124558795 GCACTCGCTCACTGACTGGCAGG + Intronic
1049567278 8:143347712-143347734 CCGCTGGCTGGCTGGCTGGCTGG - Intronic
1049750416 8:144280482-144280504 GCCTTCGCTGAGACGCTGGCGGG + Intronic
1056213049 9:84382777-84382799 GCCTTCCCTGGCTGGCTGTCAGG - Intergenic
1057600035 9:96450085-96450107 GCGCGCGCTGACTGGCTGTCTGG + Intergenic
1061132322 9:128714960-128714982 GGGTGCGCTGACTGGCTCTCGGG + Intronic
1061275967 9:129569422-129569444 CTGTTGGCGGACTGGCTGGCTGG + Intergenic
1062049313 9:134438841-134438863 GCGCTGGCTGGCTGGCTGGCTGG + Intronic
1185466338 X:356883-356905 GGGCTCGCTGTGTGGCTGGCGGG - Intronic
1185638914 X:1575523-1575545 GGGTTGGCTGGCTGGCTGGCTGG + Intergenic
1185883201 X:3758907-3758929 TGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1189291067 X:39886452-39886474 GTGTTGGCTGGCTGGCTGGCAGG + Intergenic
1193814096 X:86084781-86084803 GTGTTCGCTGAGTGCCTGGGGGG + Intergenic
1200152774 X:153959401-153959423 GCTTTCCCAGCCTGGCTGGCAGG + Exonic
1200216568 X:154370691-154370713 GCGCGGGCTGGCTGGCTGGCCGG - Intronic