ID: 904642110

View in Genome Browser
Species Human (GRCh38)
Location 1:31938529-31938551
Sequence TCCCCCGCTCCTCCTCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 321}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904642100_904642110 11 Left 904642100 1:31938495-31938517 CCCCGCGGGGCGCTGACCCACTG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642095_904642110 23 Left 904642095 1:31938483-31938505 CCCGCCCACCTGCCCCGCGGGGC 0: 1
1: 0
2: 4
3: 72
4: 437
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642101_904642110 10 Left 904642101 1:31938496-31938518 CCCGCGGGGCGCTGACCCACTGC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642105_904642110 -5 Left 904642105 1:31938511-31938533 CCCACTGCCCTGGGCGCCTCCCC 0: 1
1: 0
2: 1
3: 63
4: 494
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642099_904642110 15 Left 904642099 1:31938491-31938513 CCTGCCCCGCGGGGCGCTGACCC 0: 1
1: 0
2: 6
3: 113
4: 278
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642097_904642110 19 Left 904642097 1:31938487-31938509 CCCACCTGCCCCGCGGGGCGCTG 0: 1
1: 0
2: 1
3: 18
4: 179
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642098_904642110 18 Left 904642098 1:31938488-31938510 CCACCTGCCCCGCGGGGCGCTGA 0: 1
1: 0
2: 3
3: 24
4: 198
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642102_904642110 9 Left 904642102 1:31938497-31938519 CCGCGGGGCGCTGACCCACTGCC 0: 1
1: 0
2: 3
3: 14
4: 145
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642096_904642110 22 Left 904642096 1:31938484-31938506 CCGCCCACCTGCCCCGCGGGGCG 0: 1
1: 0
2: 3
3: 52
4: 684
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321
904642106_904642110 -6 Left 904642106 1:31938512-31938534 CCACTGCCCTGGGCGCCTCCCCC 0: 1
1: 0
2: 7
3: 102
4: 932
Right 904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG 0: 1
1: 0
2: 4
3: 48
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904642110 Original CRISPR TCCCCCGCTCCTCCTCCTCG TGG Intronic
900029195 1:358740-358762 GCCCCCACTCCTCCTCATCACGG + Intergenic
900049797 1:587512-587534 GCCCCCACTCCTCCTCATCACGG + Intergenic
900182427 1:1317567-1317589 TGCCCCGTTCCTGCTCCTCCAGG - Intronic
900227655 1:1540492-1540514 CCCCCCGCGCCTCCTCCCCCCGG - Intergenic
900364938 1:2307502-2307524 GCCCACGCTCCTCCACCACGAGG + Exonic
900532302 1:3160589-3160611 TCCCCTGCACCTGCACCTCGTGG - Intronic
900786778 1:4654690-4654712 CCCCGCGCGCCTCCTCCGCGCGG + Intergenic
900996676 1:6126728-6126750 TTTCCCGCTCCACCTCCTCCTGG + Exonic
901302303 1:8208757-8208779 TCCCCGGCTCCTCCACCAAGTGG + Intergenic
901443465 1:9293118-9293140 CCCCCCGCGCCTCCCCCTCCCGG - Intronic
901471700 1:9461122-9461144 TCCCCTTCTCCTCCCTCTCGAGG + Intergenic
901641091 1:10693615-10693637 CCCCCAGCTCCTGCTCCTCTCGG + Intronic
902732136 1:18376644-18376666 TCCCAGACTCCTCCTCCTCCTGG + Intronic
903034898 1:20486785-20486807 TCTCCCCCTCCCCCTCCTGGAGG - Intergenic
903738820 1:25546289-25546311 TGACCTGCTCCTCCTCCTCAAGG + Intronic
903860252 1:26360482-26360504 TGCCCAGCTCCTCCTGCTCCTGG - Intergenic
904014578 1:27409829-27409851 CCCCCTCCTCCTCCTCCTCCGGG - Exonic
904466587 1:30711711-30711733 TGACCCTCTCCTCCTCCTTGGGG + Exonic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
905028267 1:34865712-34865734 TCCCCCCCTCCCCCACCCCGCGG - Exonic
908473850 1:64470279-64470301 GCCGCCGCTCCTCTTCCCCGGGG + Intergenic
908714322 1:67053923-67053945 TCCCCAGCTCCTCCTCATCTCGG + Exonic
908902944 1:68977075-68977097 TCCCCCGCTCCTCTTTCTAAGGG + Intergenic
912799839 1:112714025-112714047 TCCCCAGCACCTCATCCTCATGG + Intronic
914463705 1:147908279-147908301 GGCCCAGCTCCTCCGCCTCGCGG - Exonic
915590215 1:156866425-156866447 TCCCCTCCTCCTCCTCCTTCCGG - Intronic
917515538 1:175704611-175704633 TCCCCTGCTCCTCCCCATTGGGG - Intronic
919774742 1:201187211-201187233 TCCCCAGCTTCTCCTCATTGAGG + Intergenic
920501354 1:206487339-206487361 TCCCCAGTTCCTCCGCCTCCGGG + Intronic
922101943 1:222484193-222484215 TCTCCAGCCCCTCCTCCTCCTGG - Intergenic
922263023 1:223959315-223959337 TCTCCAGCCCCTCCTCCTCCTGG - Intergenic
922481954 1:225945266-225945288 TCCCCAGCTCCTCCACCTAAGGG - Intergenic
922531741 1:226350160-226350182 TCCCCTGCTTCCCCTTCTCGTGG + Intergenic
922644713 1:227275596-227275618 TCCCCCTCTCCCCCTCCCCACGG + Intronic
924344861 1:243064316-243064338 TCTCCAGCCCCTCCTCCTCCTGG - Intergenic
924904206 1:248434120-248434142 CCCTCCGCTCCACCTCCGCGCGG - Intergenic
924923690 1:248657931-248657953 CCCTCCGCTCCACCTCCGCGCGG + Intergenic
1062774954 10:136299-136321 TCGCCAGCTCCTCCTCCTCCCGG - Intronic
1064662198 10:17617380-17617402 GCGTCCGCTCCTCCCCCTCGCGG - Intergenic
1067069102 10:43119529-43119551 AGGCCCGCTCCTCCTCATCGTGG + Exonic
1067430015 10:46236672-46236694 TCCCTCGCTCCTCTGCCTTGAGG + Intergenic
1067444124 10:46329939-46329961 TCCCCCTCACCTGCTCCTCCAGG + Exonic
1069654587 10:70078375-70078397 TCACCTTCTCCTCCTCCACGTGG - Intronic
1069659647 10:70115174-70115196 TCGCCCTCTCCTCCTCCTGGTGG - Intronic
1070314259 10:75295297-75295319 TCCCGCCCTCCTCCTCCTGGCGG + Intergenic
1072635415 10:97174539-97174561 TCCCTGCCTCCTCCTCCTTGGGG - Intronic
1072757335 10:98030090-98030112 TCACCCGCTCCGCCCCCTCCAGG + Intronic
1073548915 10:104379171-104379193 TCCCCCGCTCCTCCCACCCCTGG + Intronic
1074801490 10:117005200-117005222 GCTCCCGCTCCTCCTCCTCCTGG + Exonic
1075426213 10:122343715-122343737 TCCCCAGATCCTCCTCCTTCTGG - Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077049860 11:561683-561705 TCCTCCTCTCCTCATCCTCTTGG - Intronic
1077173118 11:1177160-1177182 TCCCCGCCTCATCCTCCTTGCGG + Intronic
1077367250 11:2166208-2166230 TCCACCGGGCCTCCTCCTCCAGG + Intronic
1077482489 11:2822400-2822422 TCCCCACCTCCACCTCCTAGAGG - Intronic
1077635832 11:3840904-3840926 CCCCCAGCTCCCCCGCCTCGGGG - Exonic
1078660201 11:13279169-13279191 TCCACCGCTACTCCTCAGCGAGG + Intronic
1079128692 11:17735487-17735509 TCCTCCCCTCCCCCTCCTGGGGG + Exonic
1079237163 11:18699063-18699085 CCCCCCGCTCCTCAGACTCGCGG + Intronic
1079238385 11:18705772-18705794 TGCGCCTCTCCCCCTCCTCGAGG + Intronic
1080304755 11:30824316-30824338 TTCCCTGCCCCTCCTCCTCCAGG + Intergenic
1080652738 11:34235568-34235590 TCCCCCGCTCCCCTTCCTGTGGG - Intronic
1080873991 11:36260274-36260296 TCCCCAGCTCAGCCTCCCCGGGG + Intergenic
1081794621 11:45810969-45810991 GCCCCTGCTCCTGCTGCTCGGGG + Exonic
1081864240 11:46350962-46350984 TCTCCTCCTCCTCCTCCTCAGGG - Intronic
1083174314 11:60939638-60939660 TCCCCCTCTGCTCCTCCACCAGG - Exonic
1083270333 11:61569098-61569120 TTCCCCACTCCTACTCCCCGGGG + Intronic
1083683289 11:64361067-64361089 TCCCCAGCTCCTCCAGCTCCTGG - Intronic
1084485046 11:69443363-69443385 TCCCCTGCTCCTCCTCCCTCGGG + Intergenic
1085011013 11:73141925-73141947 TCCGGCCCTCCTCCTCCTCCTGG - Exonic
1085310042 11:75510754-75510776 CTCCCCCCTCCTCCTCCTCCGGG + Intronic
1085385009 11:76152573-76152595 CCGCCCGCGCCTCCTCCGCGCGG - Intergenic
1085406684 11:76267354-76267376 TCTCCAGCTCCTCTTCCTTGTGG + Intergenic
1088608825 11:111557581-111557603 TCCCCTTCTCCTCCTCCTTGTGG + Exonic
1089457831 11:118635464-118635486 GCTCGCGCTCCTCCTCCACGCGG - Exonic
1089498419 11:118919217-118919239 TCTGCCTCTCCTCCTCCCCGTGG - Intronic
1089966305 11:122656734-122656756 GCTCCCGCTCCTCCTACTCCAGG - Intronic
1090457094 11:126859514-126859536 TCCCCTCCTCCTCCTCCTATTGG - Intronic
1091777305 12:3192791-3192813 TGCCCTCCTCCTCCTCCTCAGGG - Intronic
1091778852 12:3201283-3201305 TCGCCCTCTTCTCCTCCTCTTGG + Intronic
1092119451 12:6033861-6033883 GCTCCCGCCCCTCCTCCTCCTGG + Intronic
1092256083 12:6927649-6927671 TCCCCCTCTCTCCCCCCTCGCGG + Intronic
1093080324 12:14803239-14803261 TGCCCCGCTCCTCCTCTCCCTGG - Intronic
1096124658 12:49110449-49110471 ACCCCCGCTTCTCCTCGCCGGGG + Intronic
1098190666 12:67945175-67945197 TCCTCAGCCCCTCCTCCTCCAGG - Intergenic
1098288463 12:68933059-68933081 CCTCCCTCTCCTCCTCCTCCTGG + Intronic
1101829528 12:108246535-108246557 TCCCCAGCTCCTCCTTCTGCGGG + Intronic
1102030964 12:109739881-109739903 GCCCATGCGCCTCCTCCTCGTGG - Intronic
1102508277 12:113397652-113397674 TCCCCTGCTCCTTCTCCCAGGGG + Intronic
1103321308 12:120094084-120094106 TCCCCCTCCCCTCCACCCCGTGG - Exonic
1103363612 12:120368160-120368182 TCACCCCCTCCTCCTGCTCCCGG - Intronic
1103433103 12:120904349-120904371 GCCCCCGCCCCTCCTCCCCTCGG - Exonic
1103702812 12:122856473-122856495 TCACCCGCGCCACCTCCTCCTGG - Exonic
1103954335 12:124567867-124567889 TCCCCCCTCCTTCCTCCTCGGGG - Intergenic
1104090728 12:125514877-125514899 TCTCCTCCTCCTCCTCCTCCTGG + Intronic
1104811174 12:131621174-131621196 TCCCCGCCGCCTCCTCCTCCAGG - Intergenic
1105249116 13:18680608-18680630 CCTCCTCCTCCTCCTCCTCGGGG - Intergenic
1105407089 13:20142097-20142119 CGGCCTGCTCCTCCTCCTCGGGG + Exonic
1106683445 13:32031588-32031610 TCGGCCGCTCCTCCTCCTCCGGG - Exonic
1108973159 13:56402404-56402426 TCTCCCTCTCCTCCTCCCCGGGG - Intergenic
1110233382 13:73190663-73190685 TCTCCCTCACCTCCTCCACGAGG - Intergenic
1112325908 13:98442701-98442723 TTCCCTGCTCCTCCGCTTCGGGG - Intronic
1112328883 13:98462140-98462162 GCCCACCCTCCTCCTCCTCCCGG + Intronic
1112494757 13:99895998-99896020 CCCCGCGCTCCTCCTGCCCGCGG - Exonic
1113730405 13:112637377-112637399 GCGCCCACTCCTCCTCCCCGCGG - Intergenic
1114349788 14:21836908-21836930 TTCTCCGCTCCTCCACCTCCCGG + Intergenic
1116950147 14:50872064-50872086 GCCCGCCCTCCTCCTCCGCGCGG - Intronic
1117157079 14:52951401-52951423 TCCCCCGCTCCCCCTCCTCAGGG - Intronic
1117540896 14:56745692-56745714 TCCCCGGCTCTTTCTCCTCCTGG + Intergenic
1119762002 14:77158229-77158251 TCCCCTGCTTCCCCTCCTGGTGG - Intronic
1121380662 14:93463126-93463148 TCCCCTGCTCTTCCTCCCCCTGG - Intronic
1122289830 14:100674592-100674614 TCCCCCACTCCTTCTCCACTGGG - Intergenic
1122812878 14:104297662-104297684 GCCCCCTCTCCTCCTCCTAGAGG - Intergenic
1122871481 14:104640885-104640907 TCCCCTGCCTCCCCTCCTCGTGG - Intergenic
1122974542 14:105165718-105165740 TCCCCCACTCCTCTTCCACAAGG + Intronic
1123813169 15:23949555-23949577 TCCAACGCTCCTCCTCCTGGAGG - Intergenic
1123871701 15:24581544-24581566 TCCAACGATCCTCCTCCTGGAGG - Intergenic
1123892271 15:24793845-24793867 TCCAATGCTCCTCCTCCTGGAGG - Intergenic
1123895857 15:24829320-24829342 TCCAAAGCTCCTCCTCCTGGAGG - Intronic
1124612199 15:31216147-31216169 TGCCCTCCTCCTCCTCCTCGCGG - Intergenic
1125024785 15:35019394-35019416 CCCCCCGCTCCTCCTCCAACTGG + Intergenic
1126666966 15:51083921-51083943 TCCCCAGCTCATCCTCCTGCAGG - Intronic
1127103153 15:55587945-55587967 GCGGCGGCTCCTCCTCCTCGCGG + Intronic
1127260608 15:57323968-57323990 TCTCTCCCTCCTCCTCCTCCAGG - Intergenic
1127670176 15:61187488-61187510 GCCACCCCTCCTCCTCCTCTTGG - Intronic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1129522714 15:76195984-76196006 TGCCTCCCTCCTCCTCCTCCTGG - Intronic
1129919934 15:79311372-79311394 CGCCCTGCTCCACCTCCTCGTGG - Exonic
1129985929 15:79919794-79919816 ACCCCCGCCCCCCCTCCCCGCGG + Intronic
1132055690 15:98649029-98649051 CCCCCTCCTCCTCCTCCTCCTGG - Exonic
1132294894 15:100727624-100727646 TCCCACGCTTCTGCTCCTCCGGG + Intergenic
1132883082 16:2170920-2170942 TCCCCCACTCCCCCTTCTCAGGG + Intronic
1133134466 16:3700240-3700262 TCACCCCATCCTCCTCCTCCCGG + Intronic
1133758234 16:8778340-8778362 TGCCCCTCTCCACCTTCTCGTGG + Intronic
1134537357 16:15036803-15036825 TCCCCAGCTACTGCTCTTCGTGG + Exonic
1136485594 16:30570030-30570052 TCCACCGCTCCTGCTCCGGGGGG - Exonic
1136539545 16:30921804-30921826 ACCCCCGCCCCTCCTCATCGGGG - Intergenic
1139655115 16:68382745-68382767 TCCCCAGCTGCCCCTCCTGGAGG - Intronic
1142353753 16:89591500-89591522 TGCCCCTCTCCTCTTCCTCTGGG + Intronic
1142980058 17:3666496-3666518 TAACCTGCTCCTCCTCCTCCTGG - Intronic
1143059310 17:4186713-4186735 TCCTCTACCCCTCCTCCTCGGGG + Intronic
1143091198 17:4450021-4450043 TCCTTCTCTCCTCCTCCTCCTGG + Intronic
1143374936 17:6461858-6461880 TCCCTCCCTCCTCCTCCTCCAGG + Intronic
1143679635 17:8466946-8466968 GACCCCGCTCCTCCTCCTCCTGG + Exonic
1145895959 17:28458164-28458186 TCCCCCGCTCCCTCTCCCCATGG + Intronic
1146061072 17:29607720-29607742 TCCACTCCTCCTCCTCCTCCAGG + Exonic
1146062255 17:29613528-29613550 GCTCCAGCTCCTCCTCCTCCTGG - Exonic
1146272188 17:31491715-31491737 GTCCCCTCTCCTCCTCCTCCTGG - Intronic
1146594482 17:34157109-34157131 CCCTCCTCTCCTCCTCCTCCAGG + Intronic
1147000656 17:37359510-37359532 CCCTCGGCTCCTCCTCCTGGCGG + Intronic
1147312586 17:39604208-39604230 TCGCCGGCTCCTCCTCCCCGCGG - Intronic
1147659767 17:42111305-42111327 CCACGTGCTCCTCCTCCTCGGGG + Exonic
1147752455 17:42744749-42744771 GCCCCCGCCGCTCCTCCTCCCGG + Intronic
1147968566 17:44207269-44207291 GCTCCAGCTCCTCCTCCTCAGGG - Exonic
1148463523 17:47851277-47851299 TCCCGCCCACCCCCTCCTCGCGG - Intronic
1148471509 17:47896452-47896474 AGCCCCGCTCCTCCTCCGGGCGG - Intronic
1148547829 17:48530656-48530678 TCCCCAGCTCCGCGCCCTCGGGG - Exonic
1149314019 17:55421942-55421964 TCCCCGGCTCCTCCGCCCCGGGG + Exonic
1150131566 17:62671993-62672015 TCCACAGCTCCTCCACCTCTGGG - Exonic
1150229635 17:63543150-63543172 TGCCCCGCCCCTCCACCTTGGGG + Intronic
1150561972 17:66302500-66302522 GCCCCCGCCGCTCGTCCTCGCGG + Intergenic
1151307510 17:73272719-73272741 TCCCTCTCTCCTCCTCCCCATGG - Intergenic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1151401554 17:73858986-73859008 ACCCCCTCCCCTCCTGCTCGTGG + Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152362480 17:79839120-79839142 ACCCCCTCCCCGCCTCCTCGCGG + Intronic
1152701447 17:81821853-81821875 TCCCCTGCTCCTCCTCCCCGGGG + Intergenic
1152929151 17:83101145-83101167 CCCCAGGCTCCTCCTCCTCCCGG + Intergenic
1152950563 17:83227816-83227838 GCCCCCACTCCTCCTCATCACGG - Intergenic
1153054873 18:935948-935970 TCCCAAGCTCCACCTCCTCTTGG - Intergenic
1153874589 18:9357818-9357840 TTCCCTGCTCCTCCTCCTTATGG - Intronic
1154246334 18:12702815-12702837 CCCGCCGCTCCACCTCCCCGCGG + Exonic
1155209199 18:23586433-23586455 TCCTCCGCTCCTCCTGCGCGGGG - Exonic
1155254470 18:23982626-23982648 TCTCCCCCTCCCCCTCCTCTCGG + Intergenic
1155479703 18:26272124-26272146 TCCACCCCTCCTCCTCCCAGTGG + Intronic
1158137694 18:54224505-54224527 TCTCCCCCTCCTCCTGCTCCGGG + Exonic
1158757597 18:60345308-60345330 TACCCTCCTCCTCCTCCTCTTGG - Intergenic
1159279210 18:66262980-66263002 TCCCTTGCTCCTCCTCCTAAAGG - Intergenic
1159923672 18:74247984-74248006 TCCCCAGCTCATCCTCCTGAGGG - Intergenic
1160577374 18:79864273-79864295 TCACCCGCTCCTCCTCGGCGCGG - Exonic
1160760668 19:782535-782557 TCCCTCCCTTGTCCTCCTCGAGG - Intergenic
1160895476 19:1400148-1400170 TGCCCCGCACCCCCTCCTCCAGG - Intronic
1160972298 19:1775046-1775068 TCCCCTCCTCCTCATCCTCCGGG + Intronic
1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG + Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161477439 19:4494325-4494347 TGCCCCGCTCAGCCTCCCCGCGG - Exonic
1161588897 19:5119788-5119810 GCTCCTCCTCCTCCTCCTCGGGG - Exonic
1161620175 19:5293347-5293369 CCCCCCAATCCCCCTCCTCGGGG - Intronic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1162127668 19:8508021-8508043 TCCCCCTCACCTCCTCATCCTGG - Intergenic
1162464449 19:10831667-10831689 TCCTCTCCTCCTCCTCCTCCTGG + Exonic
1162777427 19:12988162-12988184 TCCCTCTCTCCCCCTCCCCGGGG - Intergenic
1163674264 19:18647524-18647546 TCCTCCTCTCTTCCTCCTCCAGG - Intronic
1165079555 19:33299612-33299634 ACTCCCTCTCCTCCTCCCCGGGG + Intergenic
1165138165 19:33683901-33683923 TCCCCTGCTCCTCCTCATCCTGG - Intronic
1165326121 19:35115509-35115531 TCTCCTGCTCCTCCTCCTCCAGG - Intergenic
1165741866 19:38209691-38209713 CTCCGCCCTCCTCCTCCTCGAGG + Intergenic
1166072242 19:40394277-40394299 CCTCCTCCTCCTCCTCCTCGGGG + Exonic
1166695396 19:44848854-44848876 TCCCCCGCTTGGCCTCCTCGGGG + Intronic
1166783640 19:45354967-45354989 TATCCCCCTCCTCCTCCTCCCGG + Intronic
1167078032 19:47260735-47260757 CCCCCAGCTCCTCCTCCTCGAGG - Exonic
1167120837 19:47515391-47515413 TCCCCCACTCGCCCTCCCCGCGG + Intergenic
1167435337 19:49475583-49475605 TTCCCCGCTCCTCCTTCCCTGGG - Intronic
1167573729 19:50307112-50307134 CCCTCCGCTCCTCCTCCACCTGG - Exonic
1167593165 19:50415177-50415199 CCCCCAGCCCCTCCTCCTCTGGG + Intronic
1168071921 19:53958316-53958338 CCCACCGCTCCTCCTCCAAGTGG - Intergenic
1168332987 19:55580494-55580516 TCCCCAGCCCCTCCTCCACCGGG - Intronic
1168340737 19:55621786-55621808 CCCCCCGCCCCTCCTCCGCAGGG + Exonic
1168347146 19:55655405-55655427 TCCCCCGCGCCACCTCCGCCAGG - Intronic
925018996 2:553747-553769 TCCTCCCCACCTCCTCCTGGGGG - Intergenic
926718230 2:15941097-15941119 TCCCCCCCTCTTCTTCCTCCAGG - Intronic
927938236 2:27087143-27087165 GCCCTGGCTCCTCCTCCGCGTGG - Exonic
928085175 2:28341666-28341688 TCCCTTGCCCCTCCTTCTCGGGG - Intergenic
931442393 2:62299446-62299468 TCCCCTCCTCCTCCTCCTCCTGG - Intergenic
932207138 2:69893198-69893220 TCCCCAGCTCCTCCCCCTACAGG - Intergenic
932336698 2:70935801-70935823 CCTCCCTCTCCTCCTCCTCTAGG - Intergenic
932682253 2:73836387-73836409 TCCCCCTCCCCTCCACCCCGTGG + Intronic
935661216 2:105468550-105468572 TCACCCCCTCCTCCTACCCGAGG - Intergenic
937043253 2:118836869-118836891 TCCCCCGCCCCTTCACCTCCAGG - Intergenic
937972139 2:127559107-127559129 CTCCCCGCTCCTCCTCCTGCTGG + Intronic
937993040 2:127674818-127674840 GCCCCCGCGCCTCTTCCTCTGGG - Intronic
942451328 2:176109412-176109434 TCCCCCTCTCCGAGTCCTCGTGG + Exonic
946003054 2:216499023-216499045 GCCCCCGCCCCTCCGCCTTGGGG - Intronic
948205997 2:236163287-236163309 GCCCTCCCTCCTGCTCCTCGGGG - Intergenic
948225455 2:236306179-236306201 GCCAGCGCTCCTCCTCCTCACGG + Intergenic
948612134 2:239176470-239176492 TCTCCAGCTCCTGCTCCTGGCGG + Exonic
948694895 2:239728287-239728309 TCCAGCTCTCCTCCTCCTCGCGG + Intergenic
948772619 2:240259227-240259249 TCCCCGCCTCCTCTTGCTCGTGG - Intergenic
1170597213 20:17815102-17815124 CCCCCGGCTCCTCCTCCTGCAGG - Intergenic
1171484409 20:25476860-25476882 GCTCCAACTCCTCCTCCTCGAGG + Exonic
1172051796 20:32123154-32123176 TCCCCCTCTCCCTCTCCTCATGG - Intronic
1172481478 20:35274381-35274403 TCCGCCGCTCCACCTCCTTCTGG - Exonic
1173162712 20:40664291-40664313 CCCCTCCCTCCTCCTCCTCTGGG + Intergenic
1173258836 20:41415255-41415277 CCTCCCTCTCCGCCTCCTCGTGG + Exonic
1173453856 20:43188877-43188899 GCCCCCGCTCCCCCTACTCTGGG + Intronic
1174518125 20:51108973-51108995 CCCACAGCTGCTCCTCCTCGGGG + Intergenic
1175199452 20:57267474-57267496 TTCCCACCTCCTCCTCTTCGGGG + Intergenic
1179209302 21:39312769-39312791 GCCCCCGCCCCTTCCCCTCGCGG - Intronic
1179568265 21:42262613-42262635 TCCCTCCCTCCTCCTCCGAGTGG - Intronic
1179882765 21:44300345-44300367 TCCCCCGCTCTTCCCCGGCGCGG + Intronic
1180228964 21:46414819-46414841 CACCCTGCTCCTCCTCCTCCTGG + Intronic
1181063580 22:20294093-20294115 TCCCCCTGTCCTCCACCTCCAGG + Intergenic
1182150097 22:28021732-28021754 TCCCGCCCTCCTGCTCCTCTGGG + Intronic
1182226135 22:28800299-28800321 TCCTCAGCGCCTTCTCCTCGGGG + Exonic
1183323045 22:37176698-37176720 TCCCCGCCTCCTCCTCCACTTGG - Intergenic
1183645527 22:39124013-39124035 TCCCCTGCTCCACCTTCTTGGGG + Intronic
1183983021 22:41553542-41553564 TGCCCCACTCCTCCGCCTGGCGG + Intergenic
1184103067 22:42351745-42351767 TCACCCCCTCCTCATCCTCGTGG - Intergenic
1184260114 22:43310155-43310177 TCCCTCGCTCCTGATCCTCCAGG + Intronic
1184347815 22:43924144-43924166 TCCCCCGCTCCCCGGCCTAGGGG - Intronic
1185226888 22:49658311-49658333 ACCCCCTCTGCTCCTCCTCCAGG + Intergenic
950210331 3:11118364-11118386 TCCTCCCCTCCTGCCCCTCGAGG + Intergenic
950386405 3:12663861-12663883 TCGCCCGCTCCTCCTCCCCGCGG + Exonic
950702457 3:14759750-14759772 TCCCCAACTCCTCCTGCTCCAGG - Intronic
952371881 3:32730318-32730340 CCTCCCGCTCCTTCTCCTCTAGG - Intronic
952871402 3:37904327-37904349 TGCCCCACTCCTCCTTCTCCTGG - Intronic
953772152 3:45785958-45785980 TCCCTCGGTTCTCCTCCTCGTGG - Intronic
954224614 3:49173882-49173904 TCCCCCCATCTTCCTCCCCGAGG + Intronic
954694052 3:52410804-52410826 GCCTCCGCCGCTCCTCCTCGCGG - Exonic
954852367 3:53614423-53614445 TCCCCACCTCCTACACCTCGGGG - Intronic
954861596 3:53695171-53695193 TCCCCAGCACCTCCTCCACGGGG - Intronic
955059541 3:55483637-55483659 GCCCCCAGTCCTCCTCCCCGTGG - Intronic
955182085 3:56682464-56682486 TCCCCTGCTGCCCCTCCCCGCGG - Intronic
955368675 3:58332744-58332766 TGGCCCGCTCCTCCGCCTCGCGG - Intergenic
955754710 3:62215757-62215779 TCCCCCTCTCCTCCTCTACAGGG - Intronic
958585191 3:96077971-96077993 TCCCCCTCTCCCCCACCTCAAGG - Intergenic
958642902 3:96831349-96831371 GCCCCTGATCCTCCTCCACGTGG + Intronic
961497643 3:127306147-127306169 TCCCCCACTCCTCCTCTGCATGG + Intergenic
961819999 3:129571144-129571166 TGCCCCGCTGTGCCTCCTCGGGG + Exonic
963926988 3:150961171-150961193 TCCCCCTCCCCTCCTCCTTGTGG + Intronic
966866496 3:184261437-184261459 TCCCCCGCGCCTCCGCCTCCCGG + Exonic
967266870 3:187699015-187699037 TCCACCCCTCCTTCTCCTCCCGG - Intronic
968462525 4:732446-732468 TCCCCTTCTCCTCCTCCCTGCGG - Intronic
968660254 4:1795842-1795864 TCCCCCACTCCTCCTCTGCAGGG + Intronic
969155967 4:5210248-5210270 TCTCCTCCTCCTCCTCCTCAAGG + Intronic
969487074 4:7478324-7478346 TCACCAGCTCCCCCTCCTCCAGG + Intronic
973230397 4:47834440-47834462 TCCCCATTTCCTCCTCCTCTGGG - Intronic
973551262 4:52038184-52038206 TCCCCCGCTCCTCCAGCCCGCGG + Intronic
973781294 4:54290516-54290538 TGCCCAGGTCCTCCTCCTCAGGG - Exonic
974047212 4:56908184-56908206 TCGCCCGCCCCTCCTCACCGAGG + Exonic
975696961 4:77023041-77023063 TACCCAGCTCCACCTCCTCCTGG - Intronic
975983415 4:80183653-80183675 GCCTCCGCTCCTCCTCCCCAGGG + Intergenic
976268891 4:83210994-83211016 TCCCCCTTTCCTCCTCCCCCAGG + Intergenic
977705773 4:100068500-100068522 TCCCCAGCTCCCCCTACTTGAGG + Intergenic
978159307 4:105527023-105527045 TGCCCCTCTCTTCCTCCTCCTGG + Intergenic
978351595 4:107825274-107825296 TCCCCAGCCCATCCTCCTCCTGG - Intronic
978889448 4:113805707-113805729 TCCCCCTTTCCTCCTCGTCAAGG - Intergenic
979014729 4:115419069-115419091 TCCCCTGCCCCTCCTCCCCAAGG + Intergenic
982139450 4:152304175-152304197 TCCCCCTCAGCACCTCCTCGTGG + Intergenic
984850085 4:184145049-184145071 TCACCTCCTCCTCCTCCTCCTGG - Intronic
986773919 5:10996504-10996526 CCCCCCGAGCCCCCTCCTCGAGG - Intronic
987085352 5:14462789-14462811 TCTCCAAATCCTCCTCCTCGGGG + Exonic
990007742 5:50963559-50963581 GCCTCCGCTCCTCCTCCGCCCGG + Intergenic
990984129 5:61626189-61626211 TGCCCAGCTCTGCCTCCTCGGGG - Intergenic
991987830 5:72308207-72308229 GCCCCCTCTCTTCGTCCTCGTGG - Intronic
997102829 5:130987664-130987686 TCCACCCCTCCTCCTCCCTGGGG + Intergenic
997697714 5:135874513-135874535 TTCCCCACTCCTCCTCCCAGTGG + Intronic
998038900 5:138938307-138938329 TTACCAGCTCCTTCTCCTCGTGG + Intergenic
998379987 5:141717491-141717513 TCTCCCCCTCCTCCTCCTTCAGG - Intergenic
1001382232 5:171312296-171312318 TGCACCGCGCATCCTCCTCGGGG - Intergenic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1002033388 5:176447436-176447458 GCCGCCGCCCCTTCTCCTCGAGG - Intergenic
1002744795 5:181461631-181461653 GCCCCCACTCCTCCTCATCACGG - Intergenic
1006321864 6:33323901-33323923 TCTCCTCCTCCTCCTCTTCGGGG + Intronic
1006617386 6:35339737-35339759 TCCCCCGCTCCCTCTCCCCACGG + Intergenic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1007546022 6:42695344-42695366 TCCCCTGCCCCTCCTCGTCCGGG - Intergenic
1007722204 6:43891703-43891725 TCCCCTGCTCCTCTACCTGGAGG - Intergenic
1012392332 6:98756664-98756686 TCCCCCTTTCCTCCTCCAGGAGG + Intergenic
1013619168 6:111872517-111872539 TGCCCCACTCCTCCACCTCTCGG - Intronic
1013673978 6:112436480-112436502 TTCCCCTCTCCTCCTCCTTTGGG - Intergenic
1014001461 6:116370734-116370756 TCTCCCGCTCCTCCTCTCCCGGG - Intronic
1015149524 6:130020857-130020879 TGGCCCGCTTCTCCACCTCGGGG + Intronic
1015502089 6:133945170-133945192 ACCCCCGCTCCCCCTCATCATGG + Intergenic
1017913310 6:158813541-158813563 TCCACCCCTCCTCCTCCACGAGG - Intronic
1018887415 6:167951647-167951669 TCTCCCGCTCCTCCTCCAGGCGG - Exonic
1018950303 6:168374545-168374567 TTCCCGGCTCCTCCTCGCCGAGG + Intergenic
1019249706 6:170735172-170735194 GCCCCCACTCCTCCTCATCACGG - Intergenic
1019266488 7:120038-120060 GCCCTCGCTCCTGCTCCTCAGGG - Intergenic
1021313261 7:19117469-19117491 TCCCCCGCGCGCCCTCCCCGCGG - Exonic
1022207651 7:28179917-28179939 CCCCCCGCTCCACCTCCCCGCGG + Intronic
1022517741 7:30986765-30986787 TCCCCTGCTCCGCCTCCTTTGGG - Intronic
1024794109 7:53002634-53002656 ACACCTGCTCCTCCTCCTCCAGG - Intergenic
1026598594 7:71754468-71754490 TCCCCTCCTCCCCCTCCTCCCGG + Intergenic
1026681146 7:72467458-72467480 TCTCCGGCTCCTCCTCCACCTGG - Intergenic
1026851583 7:73727030-73727052 TCCTCCTCTCCTGCTCCCCGAGG - Intergenic
1029145354 7:98441982-98442004 CTCCCCTCTCCTCCTCCTGGTGG - Intergenic
1029690420 7:102177653-102177675 TCCCCACCTCCTCCTCCTCCAGG + Intronic
1032017562 7:128389557-128389579 CCACCCACTCCTCCTCCTCTTGG + Intergenic
1032466145 7:132146557-132146579 TCCCCCGGTCCCCCTCCTTCTGG + Exonic
1032761542 7:134947709-134947731 TCCTCTGCTCTTCCTCCTCCAGG - Exonic
1035305748 7:157930213-157930235 TCCCACGCTTCTCCTCCCCCAGG + Intronic
1035498390 8:72484-72506 GCCCCCACTCCTCCTCATCACGG + Intergenic
1035784262 8:2249230-2249252 CCCCTGGCTCCTCCTCCTGGAGG - Intergenic
1036897360 8:12646856-12646878 TCCCCAGCTCCTTCTGCACGGGG - Intergenic
1036950293 8:13133442-13133464 CCCCCCGCCCCTCTTCCTCGTGG + Intronic
1038267741 8:26049394-26049416 TCCTCTGCTCCTCCTCCCCCTGG + Intergenic
1042829272 8:73009045-73009067 CCTCCTCCTCCTCCTCCTCGGGG - Exonic
1043725772 8:83609152-83609174 TCTCCCTCTCCTCCTCTTCTAGG - Intergenic
1045582960 8:103499880-103499902 TCCTCCGCCCCTCCGCCTCCCGG - Intergenic
1047203584 8:122785773-122785795 TCCCCCTCTCCACCTCCCCAGGG - Intronic
1047717222 8:127606720-127606742 CCCCTGGCTCCTCCTCCTTGGGG + Intergenic
1048214078 8:132480292-132480314 TCCTCCGCTGCCCCTCGTCGCGG + Exonic
1049707863 8:144051107-144051129 TCACCTGCTCCACCTCCTGGGGG - Intergenic
1049989731 9:979246-979268 GCCCTCACTCCTCCTCCTCCTGG - Intronic
1053302352 9:36961000-36961022 TCCTCCTCTCCTCCTCATGGTGG + Intronic
1054820613 9:69516994-69517016 CCCCGCGCTCCTCTTCCTCCTGG + Exonic
1055955915 9:81773435-81773457 TCACCCCATCCTCCTCCTCCCGG + Intergenic
1056095380 9:83248061-83248083 TCCCCTGCTCCTCCTCCTTTTGG - Exonic
1056495163 9:87148766-87148788 TCCCCTGCATCTCCTCCTGGGGG + Exonic
1056815071 9:89795191-89795213 TCCTCCTCTCCTCCTCCCTGTGG + Intergenic
1057307481 9:93920635-93920657 AGCCACCCTCCTCCTCCTCGTGG - Intergenic
1059021382 9:110579936-110579958 TCCCCCTCTCATTCTCCTCCCGG + Intergenic
1060202267 9:121658239-121658261 TCCCCTGCACCTCCCTCTCGGGG + Intronic
1061779951 9:132989624-132989646 TCCCCCGGTCCTGCTCCTCCAGG + Intronic
1061798114 9:133100304-133100326 CCTCCGGCTCCTCCTCCTCCAGG + Exonic
1062190793 9:135246894-135246916 TCCCCTCCTCCTCCTCCTCCCGG - Intergenic
1203610606 Un_KI270748v1:92110-92132 GCCCCCACTCCTCCTCATCACGG - Intergenic
1185431649 X:14763-14785 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185432912 X:19778-19800 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185440973 X:227482-227504 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185442264 X:232600-232622 TCCGCCGCTCCTCGGCCTCGTGG - Intergenic
1185773616 X:2784687-2784709 TCCCCCACTCCTCCTCCTATTGG - Intronic
1187478631 X:19634632-19634654 TCCTCTCCTCCTCCTCCTTGTGG - Intronic
1189036001 X:37493777-37493799 TTCCCCGCTCCTCCACCCCGGGG - Intronic
1189037516 X:37507325-37507347 TTCCCCGCTCCTCCACCCCGGGG - Intronic
1190008085 X:46759040-46759062 CCCCCCGCGCCTCCTCCGAGCGG + Exonic
1190136585 X:47804472-47804494 CCTCCCCCTCCTCCTCCTCCGGG + Intergenic
1190700907 X:52989393-52989415 TGACCCACTCCTCCTCCTCTTGG + Intronic
1192610072 X:72559051-72559073 TCCCCCCCTCCCCCTCCCCACGG + Intronic
1194489710 X:94530897-94530919 TCAGCCACTCCTCCTCCTAGGGG - Intergenic
1198474710 X:136984014-136984036 TCTCCTGCCCCTCCTCCTCGAGG - Intergenic
1199044882 X:143158035-143158057 TCACTCGCTCCTCCTCCTAAAGG + Intergenic
1201296273 Y:12465892-12465914 TCCCCTACTCCTCCTCCTACTGG + Intergenic