ID: 904643018

View in Genome Browser
Species Human (GRCh38)
Location 1:31944715-31944737
Sequence GGCGTGGGTCCGCGCGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904643010_904643018 2 Left 904643010 1:31944690-31944712 CCGGGAGAAGTCAAGGGTCGCTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 904643018 1:31944715-31944737 GGCGTGGGTCCGCGCGCGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904643018 Original CRISPR GGCGTGGGTCCGCGCGCGGA GGG Intronic
900100679 1:960808-960830 GGCGGGGGTCGGGGCGCGGGGGG + Intronic
900990038 1:6094403-6094425 GACGTGGGTCATGGCGCGGACGG - Exonic
901551132 1:9997157-9997179 GGGGTGGGGCCGCGCGCGGGAGG - Intergenic
904643018 1:31944715-31944737 GGCGTGGGTCCGCGCGCGGAGGG + Intronic
908605464 1:65792976-65792998 GCCGGGGGCGCGCGCGCGGACGG - Intronic
914674842 1:149900373-149900395 GGCGGGGGTCCGTGCCTGGATGG - Exonic
919878907 1:201889373-201889395 GGAGTGGGGCCGAGCGCGGCTGG + Intronic
920002395 1:202808544-202808566 GGCGGGGAGCCGCGCGCGGAGGG - Exonic
922586411 1:226737561-226737583 GCCGCGGCTCCGCGCGCAGATGG + Exonic
1062874159 10:931731-931753 GGCGCGGGTCCGCGCGGGGGCGG - Intergenic
1063458865 10:6203142-6203164 GGCGTGCGCCGGCGCGCGGCCGG - Intronic
1066963635 10:42242442-42242464 GGAGCGGGTGCGCGCGCGGTTGG - Intergenic
1080456892 11:32426999-32427021 GCCCCGGGTCCCCGCGCGGAGGG + Intronic
1083657047 11:64234728-64234750 GGCGCGGGCCCGGGCGCGGCGGG - Exonic
1084393239 11:68892112-68892134 GAGGTGGGTTCACGCGCGGAGGG + Intronic
1084393250 11:68892152-68892174 GAGGTGGGTTCACGCGCGGAGGG + Intronic
1086728785 11:90222776-90222798 GACCTGGGGCCGCGCGAGGACGG + Intronic
1089243056 11:117098237-117098259 GGCATGGGTCCGCGGGAGGCCGG + Exonic
1091295479 11:134471307-134471329 GGTGTGGGGCAGCGCGGGGAGGG - Intergenic
1092159944 12:6310680-6310702 AGCGCGGGTCCGGGCGAGGAGGG - Intronic
1094828238 12:34288158-34288180 GGCCTGGGTCCTCCCACGGATGG + Intergenic
1094828481 12:34289168-34289190 GGCCTGGGTCCTCCCACGGACGG + Intergenic
1097155020 12:57006266-57006288 GGCCGGGGTCGGCGCGCGGGCGG + Intronic
1100632005 12:96399515-96399537 GGCGCGGGTCCGCGGGAGGTGGG - Intronic
1104634575 12:130429734-130429756 TGCGTGGGGCTGCGGGCGGAAGG + Intronic
1108054213 13:46469906-46469928 GGCTTGGGGCCGGGCGCGGTGGG + Intergenic
1118312697 14:64705082-64705104 GGCTCGGGTCCTCGCGCAGAAGG - Intronic
1126113226 15:45187566-45187588 GGCGTGGGTCCGGGGGCGACAGG + Intronic
1128547834 15:68579505-68579527 GGGGTTGGGCCGGGCGCGGAGGG - Intronic
1129710751 15:77819284-77819306 GGAGCGGAGCCGCGCGCGGACGG - Intronic
1132694285 16:1195090-1195112 GGCGTGGGTCGGGGTGGGGAAGG + Intronic
1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG + Intronic
1133908073 16:10039619-10039641 GGGGAGGGTCTGCGCGGGGAGGG + Intronic
1136512546 16:30748268-30748290 GGCGTGAGTCGGCGCTCGGCTGG - Exonic
1141997488 16:87644776-87644798 GGCGTGAGCCAGCGCTCGGACGG + Exonic
1142203409 16:88771719-88771741 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203422 16:88771759-88771781 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203435 16:88771799-88771821 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203448 16:88771839-88771861 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203461 16:88771879-88771901 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203474 16:88771919-88771941 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203487 16:88771959-88771981 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1142203500 16:88771999-88772021 GGCCTGGGGCCGCGGGTGGATGG - Intronic
1142203513 16:88772039-88772061 GGCCTGGGGCCGCGGGTGGACGG - Intronic
1146034029 17:29390633-29390655 CGCGTGGGCCCGCCCGCCGAGGG + Exonic
1146646877 17:34581761-34581783 GGCCGCGGGCCGCGCGCGGAGGG + Intronic
1147598834 17:41733752-41733774 GGGGTGGGTGGGCGGGCGGAGGG - Intronic
1148284089 17:46372777-46372799 GGCGGGGGCGCGCGCGCGGCGGG + Intergenic
1148306310 17:46590698-46590720 GGCGGGGGCGCGCGCGCGGCGGG + Exonic
1150692346 17:67377394-67377416 GGGGAGGGGACGCGCGCGGAAGG + Intronic
1152141776 17:78540981-78541003 GGCGTGGGTGGGTGAGCGGATGG + Intronic
1152141790 17:78541026-78541048 GGCGTGGGTGGGTGAGCGGATGG + Intronic
1152141800 17:78541055-78541077 GGCGTGGGTGGGTGAGCGGATGG + Intronic
1152356777 17:79811383-79811405 GGAGTGGGTCCCCGAGAGGATGG - Intergenic
1156099777 18:33578855-33578877 TGTGTGCGTGCGCGCGCGGAGGG + Intronic
1160739726 19:680233-680255 CGCGTGGGGCCGGGCGCGGGAGG - Intronic
1161150100 19:2702863-2702885 GGCGGGGCTCCGGGCGCGGGCGG + Intergenic
1162426948 19:10602669-10602691 TGCGGGGGCCCGAGCGCGGAGGG - Intronic
1163012257 19:14433484-14433506 GCCAGGGGTCCCCGCGCGGAGGG - Intronic
1165412915 19:35673352-35673374 GGCGAGGGTCCCGGCGCGGCGGG + Intronic
1166042906 19:40214017-40214039 GGCGTGGGTGTGGGCGCGGGCGG - Exonic
1166139813 19:40799735-40799757 GGCGTGTGTCCGCCCCCGGCCGG + Exonic
1166798988 19:45444344-45444366 GGCGTGGGAGCGCGCCCGGGAGG - Intronic
1168408067 19:56121009-56121031 GGCGTGAGTGGGCGCGCGGCCGG - Intronic
927714267 2:25342066-25342088 GGCCTGGGCCCGCGGGCGGCCGG - Intronic
927904599 2:26847890-26847912 GGCCGGGGTCCGAGAGCGGACGG - Intronic
930724424 2:54668442-54668464 GGGGAGGGTCTGCGCGCGGCTGG - Exonic
931348973 2:61471287-61471309 GGGGTGGGCGAGCGCGCGGAGGG - Intergenic
932765221 2:74465037-74465059 GGCGTGGTACCGTGCGCGGCGGG - Exonic
938100164 2:128493067-128493089 GGCATCGGTGCGCCCGCGGAGGG - Intergenic
939990967 2:148876289-148876311 CACCTGGCTCCGCGCGCGGAAGG + Intronic
940360433 2:152790840-152790862 GGTGTGGGGCGGCGGGCGGATGG - Intergenic
1169195879 20:3681810-3681832 AGCTCGGGTCAGCGCGCGGAGGG - Intronic
1169345086 20:4823086-4823108 GGCGGGGGTCCGCGCGCCCCGGG + Intronic
1170889101 20:20364300-20364322 GTCGTGCGTCCTCGCGGGGAGGG - Intergenic
1172118301 20:32584121-32584143 TGTGTGTGTGCGCGCGCGGAGGG - Intronic
1173589088 20:44210451-44210473 GGCGGGGGACCGCGGGAGGACGG + Intronic
1174017758 20:47502272-47502294 CGAGGGGGTCCCCGCGCGGAGGG + Intronic
1175847401 20:62065899-62065921 GGCGGGGGGCGGCGCGCGGCCGG + Intergenic
1176567879 21:8396414-8396436 GGCGCGCGTACGCGCGGGGAGGG - Intergenic
1176575783 21:8440633-8440655 GGCGCGCGTACGCGCGGGGAGGG - Intergenic
1176952694 21:15065084-15065106 GGCGTGGGGCGGCGAGGGGAGGG - Intergenic
1180622516 22:17171594-17171616 GGAGTGGGCCCGGGCGCGGCCGG + Intergenic
1182149507 22:28018290-28018312 CGCGTGTGTGCGCGCGCGGGGGG + Intronic
1182278690 22:29206003-29206025 CGCGAGGGGCCGCGCGCGGAGGG + Exonic
1184769166 22:46587873-46587895 GGGGTGGGGCCGCGGGAGGATGG + Intronic
1185259642 22:49854167-49854189 GGCCGGGGTCCGCGCGGGGGCGG - Intronic
1185272730 22:49936196-49936218 GGCGTGGGCCGGAGCGCGGTTGG + Intergenic
951485250 3:23203105-23203127 CTCGCGGGTGCGCGCGCGGACGG + Intronic
963160756 3:142149143-142149165 GGCGCGGGCCCGCGCGCGGAGGG - Intronic
970188174 4:13484333-13484355 GGGGCGGGGCCGCGCGCAGAGGG - Exonic
972675694 4:41257501-41257523 GGCTCGGGTGCGGGCGCGGAGGG + Intronic
976600626 4:86934944-86934966 GGGGCGGGGCCTCGCGCGGAGGG + Intronic
978777046 4:112515258-112515280 GGCGTGGCTGCGGGTGCGGAGGG - Exonic
1000210108 5:159100580-159100602 GGAGCGGGTCCGAGCGAGGACGG + Intergenic
1002581025 5:180209413-180209435 CGCCAGGGTCCGCGCGCGGGAGG - Intergenic
1006787599 6:36678950-36678972 GGCGTGGGTCGGTGCGCGCTCGG + Intronic
1007584199 6:42978862-42978884 GGCCTGGGTGCGGGCGCGGGCGG - Exonic
1018686449 6:166307879-166307901 GGCTGGGGCCCGCGCGCGGCTGG + Exonic
1019110069 6:169702353-169702375 GCCGTGGACCCGCGTGCGGACGG + Exonic
1024579913 7:50793223-50793245 GGCGGGGAGCCGCGCGCGGCAGG - Intronic
1026000322 7:66556173-66556195 GCCGTGGGGCCGCACGGGGACGG + Intergenic
1034392976 7:150800604-150800626 TGGGAGGGTCCGCGGGCGGACGG - Exonic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1049541718 8:143211747-143211769 GGGGTGGGGCCACGCGCGGAGGG + Intergenic
1049641122 8:143716455-143716477 GGGGTGCGTCCGCGCGCCGAGGG + Intronic
1057922097 9:99105503-99105525 GGCGTGTGTCCGGGCGCGGGCGG + Intronic
1060376251 9:123117345-123117367 GGCGTGGGTGGGTGCGGGGATGG - Intronic
1203470234 Un_GL000220v1:112835-112857 GGCGCGCGTACGCGCGGGGAGGG - Intergenic
1203478055 Un_GL000220v1:156807-156829 GGCGCGCGTACGCGCGGGGAGGG - Intergenic
1201073712 Y:10171339-10171361 TGCGTGGGTCCGCGGGCGGCCGG - Intergenic