ID: 904644951

View in Genome Browser
Species Human (GRCh38)
Location 1:31958646-31958668
Sequence CCTCATCATGACCTGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904644944_904644951 19 Left 904644944 1:31958604-31958626 CCAAACCTGGCCTGTCTCCACTG No data
Right 904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG No data
904644946_904644951 9 Left 904644946 1:31958614-31958636 CCTGTCTCCACTGTTTCTGCTTC No data
Right 904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG No data
904644945_904644951 14 Left 904644945 1:31958609-31958631 CCTGGCCTGTCTCCACTGTTTCT No data
Right 904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG No data
904644943_904644951 22 Left 904644943 1:31958601-31958623 CCACCAAACCTGGCCTGTCTCCA No data
Right 904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG No data
904644947_904644951 2 Left 904644947 1:31958621-31958643 CCACTGTTTCTGCTTCAATTTAG No data
Right 904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904644951 Original CRISPR CCTCATCATGACCTGAAGCC TGG Intergenic
No off target data available for this crispr