ID: 904645931

View in Genome Browser
Species Human (GRCh38)
Location 1:31966305-31966327
Sequence CTCTGAGAATGGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904645926_904645931 -9 Left 904645926 1:31966291-31966313 CCAATAATGACTGCCTCTGAGAA No data
Right 904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG No data
904645925_904645931 -6 Left 904645925 1:31966288-31966310 CCTCCAATAATGACTGCCTCTGA No data
Right 904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904645931 Original CRISPR CTCTGAGAATGGAGGAAAGA GGG Intergenic
No off target data available for this crispr