ID: 904646169

View in Genome Browser
Species Human (GRCh38)
Location 1:31968223-31968245
Sequence TACTTGGGAGGCTGCGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14748
Summary {0: 2, 1: 60, 2: 2338, 3: 4877, 4: 7471}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904646165_904646169 -9 Left 904646165 1:31968209-31968231 CCTGTAGTCTCAGCTACTTGGGA 0: 2447
1: 50969
2: 166631
3: 227311
4: 241340
Right 904646169 1:31968223-31968245 TACTTGGGAGGCTGCGGCGGAGG 0: 2
1: 60
2: 2338
3: 4877
4: 7471
904646162_904646169 5 Left 904646162 1:31968195-31968217 CCTGGATGTGCACTCCTGTAGTC No data
Right 904646169 1:31968223-31968245 TACTTGGGAGGCTGCGGCGGAGG 0: 2
1: 60
2: 2338
3: 4877
4: 7471
904646160_904646169 28 Left 904646160 1:31968172-31968194 CCGTCTAAAAAAAAAAAAAATTA 0: 57
1: 920
2: 7631
3: 118576
4: 106283
Right 904646169 1:31968223-31968245 TACTTGGGAGGCTGCGGCGGAGG 0: 2
1: 60
2: 2338
3: 4877
4: 7471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904646169 Original CRISPR TACTTGGGAGGCTGCGGCGG AGG Intergenic
Too many off-targets to display for this crispr