ID: 904652016

View in Genome Browser
Species Human (GRCh38)
Location 1:32013271-32013293
Sequence CTGGAGGGAGAAATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 1, 2: 9, 3: 69, 4: 682}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904652016 Original CRISPR CTGGAGGGAGAAATTGAGGA AGG (reversed) Intergenic
900391625 1:2436320-2436342 GTGGAGGGAGGAAGGGAGGAGGG - Intronic
900391645 1:2436373-2436395 GTGGAGGGAGGAAGGGAGGAGGG - Intronic
900391668 1:2436440-2436462 GTGGAGGGAGGAAGGGAGGAAGG - Intronic
900391702 1:2436539-2436561 GTGGAGGGAGGAAGGGAGGAGGG - Intronic
900391718 1:2436583-2436605 TTGGAGGGAGGAAGGGAGGAGGG - Intronic
900399153 1:2465959-2465981 CAGAAGGGAGAAACTGAGGTGGG - Intronic
900651337 1:3731440-3731462 CTGCAGAGAGAATTTGAGAAAGG - Intronic
900932865 1:5747745-5747767 AGGGAGGGAGAAAGGGAGGAGGG + Intergenic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901774780 1:11552970-11552992 ATGGTGAGAGAAATTGAGTAGGG + Intergenic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902154661 1:14475022-14475044 ATGGAGGGATAAATTGTAGATGG + Intergenic
902291849 1:15440482-15440504 CTGGAGGGAGATCTGCAGGAGGG - Exonic
902671153 1:17974873-17974895 GTGCAGGGAGAAAGAGAGGATGG - Intergenic
903026072 1:20430660-20430682 CGGGAGGGAGGAGGTGAGGAAGG + Intergenic
903037818 1:20505684-20505706 AGGGAGGGAGAAAGAGAGGAAGG + Intronic
903377415 1:22875623-22875645 AGGAAGGGAGAAAGTGAGGAAGG - Intronic
903668707 1:25022915-25022937 CTGCAGAGAGAAGTGGAGGAGGG - Intergenic
904602969 1:31683847-31683869 CTGGAGTGGGAAATGGAGGCAGG - Intronic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904700604 1:32355756-32355778 TTGGAGGAATCAATTGAGGAAGG + Intronic
904889772 1:33771117-33771139 AGGCAGGGAGAAATGGAGGAGGG - Intronic
905100652 1:35519003-35519025 CTGTAAGGAGAATTTGAGCAAGG - Intronic
905105255 1:35559952-35559974 CTGGAGGGAGCAATTAAGGAAGG + Intronic
905114514 1:35625820-35625842 CTGTAAGGAGAATTTGAGAAAGG + Intronic
905260522 1:36714997-36715019 TTGGAATGAGAAAGTGAGGATGG + Intergenic
905429448 1:37910850-37910872 GTGGAGGGAGGTATTGAGGATGG - Intronic
906070899 1:43015723-43015745 ATGAAGGGAGAAATGGAGGAGGG - Intergenic
906552001 1:46672946-46672968 CTGGAGGAAGAACTTGAGGCGGG + Exonic
907117175 1:51979134-51979156 ATGGAGGAAGAAAGTGAGGTTGG + Intronic
907118248 1:51988632-51988654 ATGGATGAAGAAATTGAGGCAGG + Intronic
907594371 1:55705886-55705908 GAGGAGGGAGAAAAGGAGGAAGG - Intergenic
907656606 1:56349020-56349042 AAGGAGGGAGAAAAGGAGGAAGG + Intergenic
907817005 1:57928388-57928410 CTGGTGGGAGATATTGATAATGG - Intronic
907930158 1:58991551-58991573 GTGGAGGGAGAAGTTGAGCTGGG + Intergenic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
910633662 1:89383472-89383494 CAGGAAGCAGGAATTGAGGAGGG + Intronic
911716080 1:101134687-101134709 ATAGAAGGAGAAATTCAGGATGG - Intergenic
911737743 1:101355956-101355978 GTGGAGGGAGATCTTGAGGGTGG + Intergenic
911759607 1:101600545-101600567 GTAGAGGGAGGTATTGAGGATGG + Intergenic
912227969 1:107757759-107757781 GAGGAGGCAGAAATTTAGGATGG - Intronic
912584960 1:110754043-110754065 GTGGTGGGAGAAAGGGAGGAAGG + Intergenic
912936253 1:114005897-114005919 AGGTAGGGAGAAATTTAGGAGGG + Intergenic
913063654 1:115230246-115230268 CTGGAGGGGGAAGATGAGGGAGG + Intergenic
913475641 1:119234692-119234714 CTGCAGGAAGAAATGAAGGAAGG - Intergenic
914455769 1:147834895-147834917 ATGGAGGGAGGAGTTCAGGAAGG - Intergenic
914826200 1:151139482-151139504 CTGAAGGGATAAGTTGAAGAGGG + Intronic
915064002 1:153209889-153209911 CTGGAGTAAGAACTGGAGGAAGG - Intergenic
915282632 1:154833073-154833095 CTGGAGGGAGGAAAGGGGGAAGG - Intronic
915893880 1:159796000-159796022 GTGGAGAGAGAAATTGATGGTGG + Intergenic
916355672 1:163904261-163904283 CTGATGAGAGAAATTGAAGAGGG - Intergenic
916424491 1:164667970-164667992 CTGGAGGGAGAAGTGGGAGAAGG - Intronic
916671305 1:167023466-167023488 TTGGATGGAGAAGATGAGGAAGG + Intergenic
917691359 1:177472770-177472792 CTGGAGGGAGAAGGTGGGCAGGG + Intergenic
917911686 1:179654345-179654367 CTGAAGGAAGAAAATGAGGTAGG + Exonic
917912229 1:179661567-179661589 CTGGAGGGTAAAACTGAGGATGG - Intronic
918544583 1:185668157-185668179 ATGGAGGGAAAAATAGAGGGAGG - Intergenic
918850162 1:189677994-189678016 CTAGAGAGAGAATTTGGGGAAGG + Intergenic
918966792 1:191361212-191361234 CTTGCTGGAGAAATTTAGGAAGG + Intergenic
920377125 1:205514955-205514977 ACCGAGGGAAAAATTGAGGAAGG + Intronic
923433940 1:233950613-233950635 ATGGAGGGAGAAAGGGTGGAGGG - Intronic
923458506 1:234187089-234187111 CAGGAAGGGGAAATTGATGATGG + Intronic
924419583 1:243895842-243895864 CTGGTGGGAGACTTGGAGGATGG - Intergenic
924544821 1:245016522-245016544 ATGGTGTGAGAAATAGAGGAAGG - Intronic
924575603 1:245277994-245278016 ATGGAGGGAAAAAATTAGGAAGG + Intronic
924602568 1:245504355-245504377 AGGGAGGGAGAAAGAGAGGAAGG - Intronic
924813151 1:247420908-247420930 CTGGATGGAGAATTGGAGGCAGG - Intronic
1062928399 10:1335424-1335446 ATGGAGGGAGAAATAGAGGAAGG + Intronic
1062997623 10:1881753-1881775 CTGGAGGGAGCAACAGAGAAGGG + Intergenic
1063389628 10:5640783-5640805 CTGCAGGGTGAACTTGAGGAAGG - Exonic
1063534203 10:6866996-6867018 AGGGAGGGAGGAAGTGAGGAAGG - Intergenic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1063713512 10:8504520-8504542 TTGGAGGAAGAAATTGGGAAGGG - Intergenic
1063948007 10:11196229-11196251 CTCGAGGAAGAAAATGAAGATGG + Intronic
1064247419 10:13680108-13680130 CTCCAGGAAGAAATTGAGGCAGG + Intronic
1064652079 10:17519585-17519607 AGGGAGGGAGAAAGAGAGGAAGG + Intergenic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065113701 10:22464176-22464198 ATGGAGAGAGAAAGGGAGGAAGG + Intergenic
1065607423 10:27432624-27432646 AGGGAGGGAGAAAAGGAGGAAGG - Intergenic
1065694835 10:28370213-28370235 AGGGAGGGAGAAAGAGAGGATGG + Intergenic
1067509439 10:46883059-46883081 CTGGAGTGAGAAATAGATCAAGG + Intergenic
1067652815 10:48168796-48168818 CTGGAGTGAGAAATAGATCAAGG - Intronic
1068311886 10:55289456-55289478 ATGGAAGGAGAGAGTGAGGAAGG + Intronic
1068730762 10:60355721-60355743 CTGGAGGGAGATGTTGGGGAAGG - Intronic
1068885339 10:62091867-62091889 CTGAAGCAAGAAATTCAGGAGGG + Exonic
1069782148 10:70963496-70963518 GGGGAGGGAGAAAGAGAGGAAGG + Intergenic
1070179060 10:73997669-73997691 GTGAAGGGAAAAGTTGAGGAGGG + Intergenic
1071068531 10:81665847-81665869 CTGGAGAGAGAAAATGAAGAAGG + Intergenic
1071444806 10:85735948-85735970 AAGGAGGGAGAAAGTGAAGAAGG + Intronic
1073827232 10:107337600-107337622 CTTGAGAGATACATTGAGGAGGG - Intergenic
1074008491 10:109453199-109453221 CTGGATGGTGAAATTGAGGAGGG - Intergenic
1075070789 10:119318747-119318769 CAGAAGGGAGAAGCTGAGGATGG - Intronic
1075391205 10:122093689-122093711 ATAGAGAGAGAAACTGAGGATGG - Intronic
1075417846 10:122278634-122278656 CTGGAGGAAGGAACTGGGGAAGG - Intronic
1075504312 10:123008849-123008871 ATGGAGGGCGAAAGCGAGGAGGG + Intergenic
1075786387 10:125052958-125052980 CTGGGGGAAGAATTTGAGAATGG - Intronic
1076701777 10:132276967-132276989 CTGGAAGGAGGAATGGAGGAGGG - Intronic
1076843652 10:133058506-133058528 GGGGAGGGAGGAAGTGAGGACGG - Intergenic
1077468161 11:2743528-2743550 CCAGAGGGAGAACTTGAGCAGGG + Intronic
1077613448 11:3659340-3659362 CTGGAGGGAGAAAGAGAGAGAGG + Intronic
1079252043 11:18793521-18793543 CTGCATGGAGAAAATGAGGAGGG - Intergenic
1079590693 11:22178960-22178982 CTGAAGGTAGAAATTTAGGCTGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080769824 11:35330307-35330329 CTGGAGGTTGAAAGTGAGAAAGG - Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081745421 11:45469458-45469480 GGAGAGGGAGAAAATGAGGAAGG - Intergenic
1083095984 11:60251969-60251991 CTGGAGGGAGGAAATAAAGAGGG + Intergenic
1083106496 11:60363340-60363362 TTGGAGGGAGGAAGTGAGGAGGG - Intronic
1083538994 11:63498581-63498603 GTGGAAAGAGACATTGAGGAAGG - Intergenic
1083542170 11:63519598-63519620 CTGGAGGGAGAAAAGAAGGAAGG + Intergenic
1084181919 11:67451161-67451183 CTGGAAGGAGGACTTGAGGGAGG - Intergenic
1084283447 11:68115445-68115467 CTGGTGGGGGAAGTTGAGAAAGG + Intronic
1084457122 11:69274301-69274323 CTGATGGCAGGAATTGAGGAAGG + Intergenic
1084851431 11:71944394-71944416 CTTGGGGCAGAAATGGAGGAGGG + Intronic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085235079 11:75008379-75008401 GTGCAGGGAGGAATTGGGGAAGG + Exonic
1086589321 11:88493623-88493645 CTGGAGAGAGTAATTCAGGATGG - Intergenic
1086791073 11:91038707-91038729 CAGGAGGGAGAAATGGAGGTAGG + Intergenic
1086892311 11:92272189-92272211 CTTGAAGGGGAAATTGAGGAGGG + Intergenic
1087117804 11:94543843-94543865 CCGGAGGGAGGGATTGAGGGAGG - Exonic
1088572129 11:111232629-111232651 CTGCAGGGATCAAATGAGGAAGG + Intergenic
1089051365 11:115548863-115548885 CTTGTGGGATAAATTGAGAATGG + Intergenic
1089341239 11:117759292-117759314 AGGGAGGGGGAAATAGAGGAGGG + Intronic
1089916430 11:122161358-122161380 CTGGAGGGAGAAGCTCAGGGTGG + Intergenic
1089958759 11:122597249-122597271 ATGGAGGGAGGGATGGAGGAAGG + Intergenic
1090072265 11:123554260-123554282 TTGGAGGAATAACTTGAGGAAGG + Intronic
1090736823 11:129617943-129617965 CTGGAGGGAGAAAAGTGGGAAGG - Intergenic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1092051286 12:5472518-5472540 CTGGAGGGAGAAAGTGAGGGTGG - Intronic
1092484041 12:8886298-8886320 CTGCTGAGAGAAATTGAGGATGG - Intronic
1092699515 12:11212337-11212359 CTGGAGGGAGGGAGAGAGGAGGG + Intergenic
1092778614 12:11965182-11965204 ATAGAGGGAGAAAGTGAGGAAGG - Intergenic
1093472911 12:19524025-19524047 AGGGAGGGAGAGATGGAGGAAGG - Intronic
1093536459 12:20229457-20229479 ATGGAGGGAGAAAAGAAGGAAGG + Intergenic
1093710722 12:22327362-22327384 TTTGAGGGAGACATTGTGGAAGG - Intronic
1093909395 12:24728591-24728613 CTGTAGAGAGATATTGAGGATGG - Intergenic
1094026106 12:25960661-25960683 CTTGAGGAAAAAAATGAGGAAGG - Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094236559 12:28174106-28174128 CTGGAGGGCCAAAGTGAGGGTGG + Intronic
1094288945 12:28824417-28824439 TTGGAGGGAGAAAATCAAGAAGG - Intergenic
1094357680 12:29595646-29595668 CTGGATGGAGCAGTTCAGGAGGG + Intronic
1096020024 12:48316256-48316278 GTGGAGGGGGAAATAGAGGCAGG + Intergenic
1096413889 12:51396218-51396240 TTGAAGGGAGGAATGGAGGAAGG - Intronic
1097010929 12:55953072-55953094 CTGGAGGGTGCAATTGAGATGGG + Exonic
1098833397 12:75391000-75391022 CCGGAAGGAGAAAGGGAGGAGGG - Intergenic
1099609404 12:84848365-84848387 AGGGAGGGAGAAATGGAGGGAGG + Intergenic
1099899690 12:88692563-88692585 AAGGAGGGAGGAATGGAGGAAGG + Intergenic
1099988477 12:89697369-89697391 CTGGAGGGAGAAATTAAGGAAGG + Intronic
1100205427 12:92343624-92343646 CTGGTGGGAGATGTTGATGATGG - Intergenic
1100726514 12:97414561-97414583 TTGGAGGGAGGAAGGGAGGAAGG - Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1101255567 12:102973669-102973691 GAGGAGGGAGAGATTGAGGAAGG - Intergenic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1102717369 12:114986117-114986139 TGGGAGGGAGAAAGAGAGGAAGG - Intergenic
1102772343 12:115489219-115489241 CGAGAGGAAGAAATTGAGGAAGG + Intergenic
1103164667 12:118760228-118760250 CTAGAGGGAGAACTTGAGGTGGG + Intergenic
1103513380 12:121490477-121490499 CCAGAGGAAGAAACTGAGGAAGG - Intronic
1103556783 12:121771210-121771232 CTGGAGGGAGCGAGTGAGGCTGG + Intronic
1103598826 12:122041219-122041241 CCGGAGGGGGAAACTGAGGCTGG - Intronic
1103857626 12:123984450-123984472 CTGGATGGGGAAATGGAGGGTGG + Intronic
1104140033 12:125979125-125979147 CAAGAGAGAGAAACTGAGGAAGG + Intergenic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1105212065 13:18262720-18262742 TTGGATGGAGAAACTGAGGCTGG - Intergenic
1105456381 13:20544865-20544887 CTGCAGGGAGAAGCTGAGGGAGG + Intergenic
1105600852 13:21885794-21885816 CTGGAGGGAGAGATTAAGAAGGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107758298 13:43649896-43649918 CTGGAGGGAGTAACTGAGGAGGG - Intronic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1109475527 13:62876332-62876354 GTGGCGAGAGAAAATGAGGAAGG + Intergenic
1110706909 13:78607704-78607726 CTGAAGGGTGGAATGGAGGAAGG + Intergenic
1110827546 13:79990145-79990167 CTAGAGGGAGAAATAGTGGAGGG - Intergenic
1111235587 13:85404031-85404053 CTGGAGATAGACAGTGAGGATGG - Intergenic
1111852929 13:93599843-93599865 GAGGAAGGAGAAATGGAGGATGG + Intronic
1112168123 13:96941771-96941793 AAGGAAGGAGAATTTGAGGAAGG - Intergenic
1112884315 13:104149594-104149616 ATGGAGGGAGGAATTGAGATGGG + Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113420748 13:110169996-110170018 CTTGAGACAGAAATTGAGGAAGG + Intronic
1113532416 13:111037884-111037906 ATGGAAGGAGAAATGGAGGGCGG + Intergenic
1114340519 14:21738176-21738198 CTCAATGGAGAAAATGAGGAAGG + Intergenic
1114482588 14:23044785-23044807 CTGGAGGAAGCATGTGAGGAGGG + Intergenic
1114851737 14:26390404-26390426 TTGGAGGCAGAAAATGAGTAAGG + Intergenic
1115989573 14:39138523-39138545 CTGGTGTGAGAAGTTCAGGATGG + Intergenic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1116875111 14:50103499-50103521 GTGGAAGGAGGAATTGAGTAAGG + Intergenic
1117557158 14:56897268-56897290 CTTGAGGGAGAACTGGGGGAGGG + Intergenic
1117913930 14:60657667-60657689 TTGGAGGGAAAAAGTGAGGGAGG - Intronic
1118765179 14:68904737-68904759 CTAGAGGGAGAAAAGGAGGAAGG + Intronic
1119141261 14:72269384-72269406 ATGGAGGGAGAAAGTGAGAAAGG - Intronic
1119266454 14:73265527-73265549 CTGGAGGCAGAATAGGAGGAAGG - Intronic
1119414632 14:74461342-74461364 ATGGAGGGAGATGTTGGGGAAGG - Intergenic
1119859553 14:77926280-77926302 CTTGTGGGAGAACTTGGGGAAGG - Intronic
1120260426 14:82177677-82177699 CTGGATATAGAAATTGTGGATGG - Intergenic
1120583349 14:86280730-86280752 ATGGAGGGAGAAAATGAAGGGGG - Intergenic
1120860051 14:89246938-89246960 TTGGAGGGATGAATTGAGGGAGG - Intronic
1121481002 14:94273664-94273686 CTGGTGGGAGACATTGAAGTTGG + Intronic
1121512887 14:94525802-94525824 CTGGAGGTAGAAACTCAGGATGG - Intergenic
1121635326 14:95450117-95450139 GTGGAGGGAGAAAATGAGGGAGG + Intronic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1122039871 14:98979556-98979578 CAGGAGGAAGAAAGTGAGGGGGG - Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122380580 14:101302510-101302532 CAGGAGGGAGGAATTGAGAGTGG + Intergenic
1122387779 14:101360831-101360853 ATGGAGGGGGAACTTGAGCAAGG - Intergenic
1122444643 14:101760631-101760653 CTTGCGGGAGAAACTGCGGAGGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1123113093 14:105882118-105882140 GGGGAGGGAGGAATGGAGGAAGG - Intergenic
1124155530 15:27222068-27222090 CTCCAGGAAGAAAATGAGGAGGG - Intronic
1124469576 15:29971160-29971182 CAGGAGGGATAAACTGTGGAGGG - Intergenic
1124594720 15:31083030-31083052 CTGGACGGAGACAAGGAGGAAGG + Intronic
1124625454 15:31305035-31305057 CTTGGAGGAGAAATTGAGAAAGG - Intergenic
1124917032 15:33985992-33986014 ATGGAGGCAGAAATTCATGATGG + Intronic
1125546588 15:40510808-40510830 CTGGAGGGAGCACTTGGGGCTGG + Intergenic
1125591072 15:40854737-40854759 CTGGATGGAAATAGTGAGGATGG - Intronic
1125840713 15:42798868-42798890 GAGGAGGGAGAACTTGAAGAAGG + Intronic
1125877523 15:43163234-43163256 CTGGGAGGTGAAATTAAGGAAGG - Intronic
1125949630 15:43741093-43741115 CTTGTGGGAGAAACGGAGGAGGG - Intergenic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1126526167 15:49656902-49656924 AGGGAGTGAGAAATGGAGGAAGG + Intergenic
1126688883 15:51272152-51272174 CTGAAGGGAAAAATCGAAGATGG - Intronic
1127734150 15:61826778-61826800 CAGGTGGGAGAAAGTCAGGAAGG + Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128306222 15:66600578-66600600 GTGGAGGGAGAAACTGAAGACGG + Intronic
1128805954 15:70531416-70531438 AGGGAGGGAGAAAGAGAGGAAGG + Intergenic
1128979413 15:72175623-72175645 CTGCTGGGGGAAACTGAGGAAGG - Intronic
1129669056 15:77597079-77597101 CTGGAGGGAGGAAGGGAGGGAGG - Intergenic
1129786713 15:78314553-78314575 CTGGAGGTAGAGATTCAGAAGGG + Intergenic
1130424972 15:83787839-83787861 CTGGAGGGAGAGGTTGAGAAAGG - Intronic
1130577397 15:85104795-85104817 CTGAAGAGAGAAAGTGAGGCAGG + Intronic
1130783181 15:87066669-87066691 TTGGAGGCAGGAATTGATGAGGG + Intergenic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131833211 15:96367264-96367286 CCGGAGGGAGAGCTGGAGGAAGG - Intergenic
1131966891 15:97853764-97853786 GGGGAGAGAGAAATTGAAGATGG - Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132891898 16:2208736-2208758 CTGGAGGGGGAGATTGTGCAGGG - Intronic
1132931017 16:2459352-2459374 CCTGAGGGAGGAAGTGAGGAAGG - Intergenic
1132938825 16:2496885-2496907 CTTGTGGAAGAACTTGAGGATGG - Exonic
1133559854 16:6941062-6941084 GTGGAGGGAGAAATGGAGGTGGG + Intronic
1133707082 16:8364966-8364988 GTTGAGGGAAAAATTGAGGGGGG - Intergenic
1134145815 16:11760630-11760652 CTGGATGGAGGAAATGTGGAGGG - Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134667961 16:16033253-16033275 AAGGAGGGAGAAGTTGGGGAGGG - Intronic
1135282020 16:21159965-21159987 TTGGAGGGGAAAGTTGAGGAGGG - Intronic
1135504690 16:23026211-23026233 CGGGAGGGAGACAGTGAGGTGGG + Intergenic
1135673230 16:24392515-24392537 CAGGTGGGGGAAACTGAGGACGG - Intergenic
1135849899 16:25953733-25953755 CAGGAGTGAGAAAGTGAGGCAGG + Intronic
1135898462 16:26432274-26432296 CTGGAGAGAGAGATTGAGATCGG - Intergenic
1136381828 16:29899533-29899555 CGGGAGGGAGAAGCTGAGAAAGG + Exonic
1137492488 16:48944580-48944602 GGGGAGGGAGAAGTAGAGGAGGG - Intergenic
1137935239 16:52628797-52628819 CTGGAGAGAGAATTTAGGGAAGG + Intergenic
1137946231 16:52735500-52735522 CTGGTGGGATAAAGGGAGGATGG - Intergenic
1138196413 16:55055426-55055448 CTAGAGGGAGACTTTGAGGTTGG + Intergenic
1138299969 16:55917862-55917884 CTTGAGGGAGAAGTTTGGGATGG - Intronic
1139076859 16:63461852-63461874 AGAAAGGGAGAAATTGAGGATGG + Intergenic
1139189542 16:64845772-64845794 CTGGAGGGAGCAAAGCAGGAAGG + Intergenic
1139189649 16:64847309-64847331 GTGGAGGGACAAAGAGAGGAAGG - Intergenic
1139259270 16:65576563-65576585 CAGGAGTGAGAGAGTGAGGAAGG + Intergenic
1140047653 16:71453293-71453315 CTGGAGGGAGGAAGTGAGCTGGG - Exonic
1140137623 16:72221603-72221625 CTGGAGGGAGAGTATGGGGAAGG + Intergenic
1140461613 16:75144624-75144646 CTGGAAGGAGAAAGTGGTGATGG - Intergenic
1140465350 16:75176768-75176790 CAGGAGGGAGGAAGTGGGGAGGG + Intergenic
1140526621 16:75628474-75628496 CTGGAGGATAAAATTAAGGAAGG - Intronic
1141321002 16:83008737-83008759 AAGGAGGGAGAAAGAGAGGAAGG - Intronic
1141368902 16:83469273-83469295 CAGGAGGAAGAATTTGAAGATGG + Intronic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1143965783 17:10755763-10755785 AGGGAGGGAGAAAGAGAGGAAGG - Intergenic
1144272187 17:13628948-13628970 TTGGAAGGAGAAAGTGAAGATGG - Intergenic
1144481716 17:15635490-15635512 GTGGCTGGAGTAATTGAGGAGGG - Intronic
1144916584 17:18728282-18728304 GTGGCTGGAGTAATTGAGGAGGG + Intronic
1145969963 17:28950862-28950884 CTGGAGGAAGGAGATGAGGAGGG + Intronic
1146494361 17:33307715-33307737 CTGGTGGGGGAACTTGAGGAAGG + Intronic
1146545732 17:33736466-33736488 CTGGCGGGAGACACTGAGGCAGG - Intronic
1147131898 17:38414792-38414814 CTGTAGGGAAAAAGAGAGGAGGG + Intergenic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147382941 17:40066178-40066200 CTGGAGAGGGAATTTGAGGAGGG + Intronic
1147598410 17:41731560-41731582 CTGGAGGGAGACAAAGAGGAAGG + Intronic
1148104476 17:45112138-45112160 CTGGAGGGAGGAGTCCAGGAAGG + Exonic
1148225658 17:45896421-45896443 CTGGCCGGAGAATGTGAGGAAGG + Intronic
1148853444 17:50565822-50565844 CAGGAGGGAGGAAAGGAGGAGGG + Intronic
1149755492 17:59182353-59182375 CAGGAAGGAGAACCTGAGGAGGG - Intronic
1149921512 17:60664911-60664933 CTGGGGAGAGAGATTGAGGCAGG - Exonic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151652826 17:75480770-75480792 TGGGAGGGAGAAAGAGAGGAAGG - Intronic
1152250982 17:79212421-79212443 CAGGAAGGAGAAATTGGGAACGG - Intronic
1152328732 17:79658248-79658270 AGGGAGGGAGAAATGGAGGAGGG - Intergenic
1153997373 18:10454346-10454368 CTGGAGGGAGGAGAGGAGGAGGG + Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154339702 18:13492767-13492789 GGGGATGGAGAAAATGAGGAAGG - Intronic
1155248506 18:23933996-23934018 CTTGTGGGAGATATTGGGGAAGG + Intronic
1156632250 18:38984274-38984296 CAGGAGGGAGAATGTGAAGAAGG - Intergenic
1156767632 18:40677417-40677439 TTGGCGGGAGGAATTGAGTAGGG - Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157408063 18:47440423-47440445 CTGGAGGTAGAACCTGAGAAGGG + Intergenic
1157612719 18:48968449-48968471 AGGGAGGGAGGAAATGAGGAAGG + Intergenic
1159059156 18:63496599-63496621 CTGGAGAGAGGTATTGGGGAAGG + Intronic
1159080501 18:63730659-63730681 CTGGAAAGAGGAATTGAGGGGGG + Intergenic
1159673966 18:71258276-71258298 GTGAAGGGAGAGAGTGAGGATGG - Intergenic
1160239781 18:77114869-77114891 CTGCAGGGAGGAAGTGGGGAAGG + Intronic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160389904 18:78522083-78522105 CTGGATGGGGAGGTTGAGGATGG - Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161326288 19:3665767-3665789 CTCGAGGGAGGATGTGAGGAGGG + Intronic
1161329013 19:3677745-3677767 ATGGAGGGAGGGATGGAGGATGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161483923 19:4524790-4524812 CTGGGGGGGGAAACTGAGGCAGG - Intronic
1162534148 19:11253325-11253347 GAGGAGGGAGAAGTTGGGGAGGG - Intronic
1163852029 19:19669442-19669464 CTGGAGGGAGAACTTAGGGTTGG - Intronic
1163857877 19:19720171-19720193 CAGCAGGCAGAAAATGAGGAAGG + Intronic
1163935688 19:20441117-20441139 CTGGAGAGAGAAAGAGAGCATGG - Intergenic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164500712 19:28817657-28817679 CTGAAGGTAGACATAGAGGAGGG - Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164767214 19:30781256-30781278 CAGGAGGCAGAAATGCAGGATGG + Intergenic
1164776532 19:30857572-30857594 CTGGGTGGAGAACTTGGGGAAGG + Intergenic
1164787462 19:30944821-30944843 AGGGAGGGAGAAAGGGAGGAAGG + Intergenic
1164912307 19:32022882-32022904 ATGGATGGGGAAATTGACGAAGG - Intergenic
1165928275 19:39341128-39341150 CTTAAGGGAGAAATTGAGGCTGG - Intronic
1166258405 19:41621381-41621403 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1166373317 19:42314074-42314096 ATGGAGGGAGAAAATCAGGGCGG + Intronic
1166487450 19:43225501-43225523 AGGGAGGGAGAAAGAGAGGAAGG + Intronic
1166494298 19:43287390-43287412 AGGGAGGGAGAAAGAGAGGAAGG + Intergenic
1166576187 19:43840538-43840560 CTGGACTGAGAAATGGGGGATGG + Intronic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166885939 19:45960949-45960971 TGGGAGGGAGAAAGGGAGGAAGG + Intronic
1166929702 19:46294894-46294916 TTCAAGGGAGAAACTGAGGAAGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167229115 19:48270619-48270641 AGGGAGGGAGAAAAGGAGGAAGG + Intronic
1167604301 19:50473292-50473314 AAGGAGGGAGAAATAGAGGAAGG - Intronic
1167631291 19:50627805-50627827 ATGGAGAGAGAAAATGAGAAGGG + Intronic
1167789704 19:51666633-51666655 AGGGAGGGAGAAAGAGAGGAAGG + Intergenic
1167890937 19:52538713-52538735 ATGGAGAGAGAAAGTGAGAAAGG + Intronic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
925601674 2:5614216-5614238 CTGTTGGGAGAAATAGGGGAGGG + Intergenic
926941186 2:18138664-18138686 AGGGAGGAAGAAATTGAGGATGG - Intronic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
928001662 2:27528288-27528310 CTGATGAGAGAAATTGAAGATGG + Intergenic
928216311 2:29364301-29364323 CTGGAAGGGGAAATGGAGTATGG + Intronic
929197790 2:39204157-39204179 CTGGAGGGAGATATTAATGTGGG - Intronic
929578220 2:43066033-43066055 CTGGCGGGAGAGGTTGAGGAAGG + Intergenic
929697518 2:44131794-44131816 TTGGAGGGAGATATTTTGGAGGG - Intergenic
929853428 2:45613925-45613947 GTGGAGGGAGAAGTTGGAGAGGG - Intergenic
929918503 2:46155554-46155576 CTGAAGGGAGAAAGTGAGTAGGG - Intronic
930203080 2:48563012-48563034 CTGAAGTGGGAAACTGAGGAGGG + Intronic
930539996 2:52693468-52693490 AGGGAGGGAGAAAGGGAGGAGGG + Intergenic
932108825 2:68974530-68974552 CAGATAGGAGAAATTGAGGAAGG + Intergenic
932320265 2:70817113-70817135 CTGGAGGGAGGAAGTGAAGAAGG + Intronic
932947812 2:76257877-76257899 CTGGTAGGAGAAAGTGGGGAAGG + Intergenic
932982339 2:76684923-76684945 TTGGAGGGAGGAAATGAAGACGG - Intergenic
933066435 2:77804713-77804735 AGTGAGGGAGAAAGTGAGGAGGG + Intergenic
933939499 2:87233619-87233641 CAGGAGGGAGCAATAGAGAAAGG - Intergenic
934301561 2:91779688-91779710 TTGGATGGAGAAACTGAGGCTGG + Intergenic
934557374 2:95294586-95294608 CTGTGGGGAGAAACTGAGGCTGG - Intergenic
935129384 2:100249915-100249937 ATGCAGGAAGAAATTCAGGAAGG - Intergenic
935213278 2:100956351-100956373 CTGGAGGGAGGAAGGAAGGAGGG - Intronic
935788610 2:106570986-106571008 AAGGAGGGAGAAAAGGAGGAAGG - Intergenic
936126062 2:109789908-109789930 CTGGGGCAAGAAATTAAGGATGG + Intergenic
936218631 2:110581560-110581582 CTGGGGCAAGAAATTAAGGATGG - Intergenic
936233578 2:110724970-110724992 ATGGAGGGAGGAAGAGAGGAAGG + Intergenic
936353636 2:111732154-111732176 CAGGAGGGAGCAATAGAGAAAGG + Intergenic
936934203 2:117822793-117822815 TGGGAGGGAGAAATTGAAAAGGG - Intronic
937549337 2:123067576-123067598 CAGGTGGGAGATATTGGGGAGGG + Intergenic
937613687 2:123894018-123894040 ATGGAAAGAGATATTGAGGAGGG - Intergenic
938710651 2:133973672-133973694 CTGTTGGGAGACACTGAGGAAGG - Intergenic
938830507 2:135045834-135045856 CTGGAGGAAGACAATGAAGATGG + Intronic
939316296 2:140553988-140554010 CTGGAGGAAGAAACAGAAGAAGG + Intronic
940843276 2:158609850-158609872 CTGGGGGCAGAAGTTAAGGAGGG + Intronic
941347701 2:164390405-164390427 GTGGGGCGAGAGATTGAGGAAGG - Intergenic
941601818 2:167551868-167551890 CTGGAGGGGGCATTTGAGAAGGG + Intergenic
941862200 2:170294834-170294856 CTGGTGGAAGATATTGAGAATGG + Intronic
942022491 2:171880704-171880726 CTAGAGGGAGAAAGGAAGGAGGG - Intronic
942072899 2:172331316-172331338 CTTCATGGAGAAATTGAGGAGGG + Intergenic
942377616 2:175353477-175353499 CTGGAAGGAGGAAGTGAGGCAGG - Intergenic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
942573782 2:177341009-177341031 CTGGTGGGAGATATTGATAATGG + Intronic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
943330782 2:186556373-186556395 AGGGAGGGAGAAAGAGAGGAAGG - Intergenic
943418988 2:187643775-187643797 CTGGAGGGTGCCACTGAGGATGG + Intergenic
944144703 2:196494514-196494536 CAGAAGGGAGAAGTTTAGGAAGG + Intronic
944817599 2:203394114-203394136 GTTGAGGGAGAAAGTGAGAACGG + Intronic
945187390 2:207153319-207153341 CTGGGGGAAGAAATAGAGGGAGG + Intronic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
947111206 2:226721411-226721433 CTGGAGGGAGCAAGGAAGGAGGG + Intergenic
947218200 2:227768213-227768235 CTGGAGGGGTAAATGGGGGAGGG - Intergenic
947536011 2:230940806-230940828 CTGCAGGGAGGAATTAAGAAGGG + Intronic
947563336 2:231177202-231177224 CTGGTGGGAGAAATCATGGAGGG - Intergenic
947837449 2:233185857-233185879 CAGGAAGGAGAAAATGAAGAAGG + Exonic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948461654 2:238132627-238132649 CTGGAGGGAGGGATACAGGAAGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169111312 20:3035965-3035987 CGGGAGAGAGAAAGCGAGGAGGG + Intronic
1170255536 20:14339016-14339038 ATGCAGGGAAAAATTGAGAAAGG - Intronic
1170917759 20:20644678-20644700 GTGAAGGGAGAAGTTGGGGAAGG - Intronic
1171040489 20:21758145-21758167 TTGGAAGAAGAACTTGAGGAAGG + Intergenic
1171074235 20:22105754-22105776 CTGGAAGGAGAAGTTGCGTAAGG + Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171355002 20:24537126-24537148 CTGGAGAGATAAAGTTAGGAGGG - Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171568269 20:26217199-26217221 CAGGAGGGATAAATTGGGGATGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1172053656 20:32139085-32139107 GGAGAGGGAGAGATTGAGGAAGG - Intronic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172793737 20:37523227-37523249 CTGGAGGGCACAGTTGAGGAAGG + Exonic
1172891294 20:38267538-38267560 GTGGAGTGAGAAAATGGGGAAGG + Intronic
1173317275 20:41956416-41956438 AAGGAGGGAGAAATTGAGACTGG + Intergenic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1173550034 20:43926516-43926538 CTGGAGGAAGAAATGAGGGAGGG - Intronic
1173807297 20:45934443-45934465 CTCGAGGGGGAAACTGAGGCGGG + Intergenic
1174163122 20:48565606-48565628 TTGGAGGGACGAAATGAGGAAGG - Intergenic
1174298479 20:49565794-49565816 CTGGAAGGAGAAAGTGAGATTGG + Intronic
1174444585 20:50582149-50582171 CAGGAGGGAGCAATGGAGAAAGG - Intronic
1174902457 20:54514852-54514874 AGGGAGGGAGAAATGGGGGAAGG - Intronic
1174933099 20:54836993-54837015 CTTGAAGGAGAAAGTGGGGAGGG + Intergenic
1175037553 20:56014687-56014709 CTGTAGGGAGAAAAATAGGAAGG - Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176087263 20:63303840-63303862 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087306 20:63304000-63304022 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087330 20:63304080-63304102 CTGGAGGGAGAAGAGGAGGGAGG - Intronic
1176087341 20:63304120-63304142 CTGGAGGGAGAAGAGGAGGGAGG - Intronic
1176087352 20:63304160-63304182 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087364 20:63304200-63304222 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087376 20:63304240-63304262 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087389 20:63304280-63304302 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087412 20:63304360-63304382 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087425 20:63304400-63304422 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087438 20:63304440-63304462 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087461 20:63304520-63304542 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087473 20:63304560-63304582 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087485 20:63304600-63304622 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087496 20:63304640-63304662 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176985851 21:15434582-15434604 TTGGAGGGAGAAATTAAGGGAGG + Intergenic
1177824867 21:26071343-26071365 CTGGAGAGGGAAACTGAAGATGG - Intronic
1178660742 21:34505521-34505543 CTGGAGGGAGAGTGTGAGGCAGG + Intergenic
1179299143 21:40090752-40090774 CAGGAGGCAGAAATTCAGGCGGG - Intronic
1179567491 21:42258346-42258368 ATGGAGGGAGGAATAGAGGGAGG - Intronic
1180590415 22:16932500-16932522 CTGAAGGCAGAAAGTGAGGCAGG + Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1180899188 22:19358548-19358570 CTGGAGGGGGAATTTGAGGGAGG + Intronic
1181094512 22:20496183-20496205 GGGGAGGGAGATAGTGAGGAAGG - Intronic
1181411925 22:22730194-22730216 CTGGAGGGAGGAAAGGAGAAAGG - Intergenic
1181700678 22:24619600-24619622 TTGGATGGAGAAACTGAGGCTGG + Intronic
1181893345 22:26084309-26084331 CTCGAGGGAGAGACTGAGGCTGG + Intergenic
1182022805 22:27095281-27095303 ATGGAGGGAGAACTTGAGCAGGG + Intergenic
1182797208 22:32999739-32999761 CTGGAGGCAGAACTAGAGGGAGG + Intronic
1183197486 22:36363442-36363464 CTGGAGGGAGAGACAGAGGGAGG + Intronic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183482017 22:38070428-38070450 AGGGAGGGGGAAATTCAGGAAGG - Intronic
1184033058 22:41905956-41905978 CAGGAGAGAGAAACTCAGGAAGG - Exonic
1184186629 22:42869227-42869249 CTCGCTGGAGAAACTGAGGAGGG - Intronic
1184764414 22:46564126-46564148 CTGGAGCTAGGAATTGAGGAAGG + Intergenic
1203225852 22_KI270731v1_random:78058-78080 TTGGATGGAGAAACTGAGGCTGG + Intergenic
1203264976 22_KI270734v1_random:8726-8748 TTGGATGGAGAAACTGAGGCTGG - Intergenic
949620094 3:5801094-5801116 AGGGAGGGAGAAAAAGAGGAAGG - Intergenic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
951830884 3:26925750-26925772 CTGGAGAAAGAAAGTGAAGATGG + Intergenic
953027314 3:39152718-39152740 CGGGGAGGAGAAACTGAGGAAGG + Intronic
953125592 3:40088871-40088893 CTGGAGGCAGGAAGTCAGGAAGG + Intronic
953495991 3:43387407-43387429 CGGCAGGGAGAGCTTGAGGAGGG + Intronic
953737392 3:45508141-45508163 CTGAAGGGAGAAATTCAGTTTGG - Intronic
953960877 3:47264803-47264825 CTGGATGGAGGACTTGGGGAGGG + Intronic
955109028 3:55929375-55929397 CTGCTTGGAGAAATTGAGAAGGG - Intronic
955445955 3:59009647-59009669 TTTGAGGGAATAATTGAGGAGGG + Intronic
957110580 3:75951134-75951156 CAGGGGGGATAAATTGGGGATGG - Intronic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
960220673 3:115104914-115104936 CTGGTGGGGGATATTGATGATGG + Intronic
960651335 3:119953847-119953869 CTGCAGGGAGAGATTGGTGATGG - Intronic
960723769 3:120649833-120649855 CTGGAGAGAGAAACTGAGACAGG + Intronic
960744364 3:120870294-120870316 GTGGATGGAGAGGTTGAGGAAGG - Intergenic
961191435 3:124965428-124965450 ATAGTGGGAGACATTGAGGAGGG + Intergenic
962490874 3:135892998-135893020 AGGGAGGGAGAAAGTAAGGAAGG + Intergenic
962700906 3:137999112-137999134 CTGGAGGGAGAGATTGGAGGTGG + Intronic
962795016 3:138842468-138842490 CCGGAGGGAGGAAGTCAGGAAGG - Intergenic
962819745 3:139036960-139036982 CTGGAGGGAGGAGTTGATGGAGG + Intronic
963811528 3:149781596-149781618 CTGATGGAAGAAATAGAGGAAGG - Intronic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
966035441 3:175407633-175407655 CTAGAGGGAGAAAGTGAGAAAGG + Intronic
966252958 3:177887436-177887458 GTGGAGGGTGAATTTGATGAGGG - Intergenic
966330007 3:178801042-178801064 ATGGAGGGAGAAAATGAGAATGG + Intronic
966567469 3:181398889-181398911 ATGGATGGAAAAATTGATGATGG + Intergenic
966807557 3:183818866-183818888 CTGGAGGGAGAGGATGAGGCTGG + Intronic
967584797 3:191199063-191199085 AGGGAGGGAGAAACTGAAGAAGG + Intergenic
967712395 3:192724024-192724046 AGGGAGGGAGAAAGGGAGGAAGG + Intronic
967842655 3:194019246-194019268 CTGGAGGAGGGACTTGAGGAAGG - Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968936534 4:3614043-3614065 CTGGCTGGAGAAGCTGAGGATGG - Intergenic
968957401 4:3726299-3726321 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957407 4:3726323-3726345 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957413 4:3726347-3726369 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968977227 4:3828235-3828257 CTGGGGTGAGAAATGGAGGTTGG + Intergenic
968986988 4:3880847-3880869 AAGGAAGGAGAAATTGAGGGAGG + Intergenic
969139409 4:5055541-5055563 CTGGAGGGAGGATTTGAGGGTGG - Intronic
969728843 4:8941295-8941317 AAGGAAGGAGAAATTGAGGGAGG - Intergenic
970110258 4:12629820-12629842 GTGGAGGGAGAGAGTGAAGAGGG + Intergenic
970388662 4:15583989-15584011 CTGATGAAAGAAATTGAGGAAGG + Intronic
970683286 4:18536191-18536213 AGGGAGGGAGGAATGGAGGAAGG - Intergenic
971195862 4:24471507-24471529 CTGGAGCGAGAAATAGAGAGAGG - Intergenic
971598836 4:28567574-28567596 CAGGAGAGAGAAAGTGGGGAAGG + Intergenic
971849279 4:31962490-31962512 CTGGAGTGAGACATTGAGCAAGG - Intergenic
972208490 4:36807082-36807104 GTGGTGGGAGAAAATGGGGATGG + Intergenic
973886215 4:55324743-55324765 TTCAAGGGAGAAGTTGAGGATGG + Intergenic
974319591 4:60329569-60329591 ATGGAGGGAGGAAGGGAGGAAGG + Intergenic
974438695 4:61889410-61889432 TTGGAGAGAGAAATTCATGAAGG + Intronic
975308518 4:72877102-72877124 GTGGAGGGAGAAATGCAGGCGGG + Intergenic
975512776 4:75211710-75211732 CTAAATGTAGAAATTGAGGAGGG - Intergenic
975622560 4:76308576-76308598 GTGGAGGGAGAACTGGGGGAAGG - Intronic
975663958 4:76715578-76715600 CTTGTGGGAGAAGGTGAGGAAGG - Intronic
975705941 4:77112168-77112190 CTGGAGGGAAAATGAGAGGAAGG - Intergenic
975736078 4:77382530-77382552 CCGGGGACAGAAATTGAGGAGGG + Intronic
976551197 4:86397321-86397343 CTTGAAGGAGAAATTGATAAAGG - Intronic
976697031 4:87927728-87927750 AGGGAGGGAGGAATGGAGGAAGG - Intergenic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
977740574 4:100476193-100476215 ATGGAGGGAGAAAGGAAGGAAGG - Intronic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
981095990 4:140782282-140782304 CTGGAGGGAGGGTTTAAGGAAGG + Intergenic
981500909 4:145450348-145450370 TTGGAAGGAAAAATTGAAGAAGG + Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982346007 4:154360318-154360340 GTGGAGGAAGAAATTGAGGCTGG - Intronic
983082632 4:163406002-163406024 ATGGGGGCAGAAAATGAGGAAGG - Intergenic
983540220 4:168901366-168901388 ATGGAGGGAGAAATTCGGGAGGG - Intronic
983575437 4:169256316-169256338 AGGGAGGGAGAAATAGAGGGAGG + Intronic
983699008 4:170568308-170568330 CTGGAGAGATATATTAAGGAAGG - Intergenic
984428310 4:179615941-179615963 TTGAAGGGAGAACTGGAGGATGG + Intergenic
984443024 4:179797318-179797340 AAGGAGGGAGAAAGTGAGGGAGG + Intergenic
984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG + Intronic
985025829 4:185738076-185738098 GTGGAGGCAGATGTTGAGGAAGG - Intronic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985896327 5:2751671-2751693 CGGGAGTGAGGAGTTGAGGAAGG + Intergenic
986002930 5:3644246-3644268 CTGGGGGCATTAATTGAGGATGG + Intergenic
986178513 5:5372264-5372286 CTGGTGGTAGAAACTGAGCAGGG - Intergenic
987057595 5:14209848-14209870 CTGGTGAGAGGAATTTAGGAGGG + Intronic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
987733334 5:21806107-21806129 CTCAAGGGAGGAATTGGGGAAGG + Intronic
987759488 5:22142027-22142049 TTGGAATGAGAAACTGAGGATGG + Intronic
988545927 5:32157277-32157299 CTGGTGGGAAAAAGGGAGGAAGG - Intronic
988905247 5:35781365-35781387 TTGGAGGGAGAAATTGAAGAGGG + Intronic
988968031 5:36439547-36439569 ATGAAGGGACAAATTCAGGAAGG + Intergenic
989070896 5:37510252-37510274 GTTGAGGGAGGAATGGAGGAGGG - Intronic
989193277 5:38691787-38691809 CTTGAAGGAGGAACTGAGGAAGG - Intergenic
989714817 5:44450686-44450708 CTGTGGGGAGACATTGGGGAGGG - Intergenic
989779761 5:45249939-45249961 CTGCAGGGGGAAAGTGGGGATGG - Intergenic
989810611 5:45668380-45668402 CAGGAGAGAGAGATTGAGGGAGG - Intronic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990295480 5:54397665-54397687 AAGGAAGGAGAAATGGAGGAAGG - Intergenic
991894209 5:71375459-71375481 TTGGAATGAGAAACTGAGGATGG + Intergenic
991989604 5:72324515-72324537 CAGGTTGGAGAAATGGAGGAGGG - Intronic
992057126 5:73001166-73001188 GTGGAGGGATAACTTGAGGCTGG + Intronic
992201676 5:74390810-74390832 CTTTAGGGTGAAATTGTGGAGGG + Intergenic
992256724 5:74928754-74928776 ATGGAGGGAGAAAGGGAGGGAGG - Intergenic
992600709 5:78396304-78396326 CTGGTGGGAGATATTGATAATGG + Intronic
993615583 5:90107499-90107521 CTGGAGGAAGAAATTGTGTTTGG - Intergenic
994140487 5:96335636-96335658 CTTGGGGGAGAAATTGGAGATGG - Intergenic
994265520 5:97711445-97711467 AGGGAGAGAGAAATGGAGGAAGG - Intergenic
994375621 5:99013830-99013852 GTGGAGGGAGGTATTGAGGATGG + Intergenic
995158241 5:108941977-108941999 CTGGAGGGAGATGTTGATAATGG + Intronic
995512155 5:112921109-112921131 CTGCGGGGAGGAATGGAGGAAGG + Intronic
995569559 5:113465112-113465134 GCGGAGGGAGACAATGAGGAAGG + Intronic
996031139 5:118705018-118705040 CTGGAGCTAGACATTGATGATGG - Intergenic
996416630 5:123217749-123217771 AGGGAGGGAGAAAGGGAGGAGGG + Intergenic
996710466 5:126538192-126538214 CCGGAGGAAGAAAGTGAGGGGGG - Intergenic
996817272 5:127588050-127588072 CAGGAGGGAGAAATCTAGAAGGG + Intergenic
997393230 5:133533846-133533868 CTGGAGAGAGAAGTTGGGGCAGG - Intronic
997399555 5:133591767-133591789 GAGGAGGGAGAAATGGAGAAGGG + Intronic
997691740 5:135831999-135832021 TGGGAGAGAGAAATGGAGGATGG + Intergenic
998161502 5:139815186-139815208 GTGGAGGGAGAAGTGGAGGGAGG - Intronic
998574389 5:143298034-143298056 CTGGAGGGAGAAAACGAGTGAGG + Intronic
999425094 5:151481001-151481023 CTGGAGGGGAAAATTGGGCAGGG - Intronic
1000044268 5:157508780-157508802 TTGGAGGGAGACATTGAGGAGGG - Intronic
1000132100 5:158309997-158310019 AGGGAGGGAGGAAGTGAGGAAGG - Intergenic
1000133621 5:158323253-158323275 GAGGAGGGAGTAATTGAGGTTGG + Intergenic
1000465593 5:161572081-161572103 CTGGTGGGGAAAATTTAGGAAGG + Intronic
1000631398 5:163595042-163595064 CTGGAAAGAGAAGTTGTGGAGGG - Intergenic
1000965274 5:167648544-167648566 CTGTTAGGAGAAAATGAGGAAGG - Intronic
1001099683 5:168803999-168804021 AGGGAGGGAGAAAATGATGAAGG + Intronic
1001822078 5:174718349-174718371 GTGGAGGCAGAAAGGGAGGAGGG + Intergenic
1001935423 5:175700179-175700201 CTTGAGGGAGACAGTGAGGGAGG - Intergenic
1002030968 5:176430199-176430221 CTGGAGAGAGAAACAGAGGGTGG - Intergenic
1002289816 5:178192635-178192657 AGGGAGGGAGAAAGGGAGGAAGG + Intergenic
1002387753 5:178881243-178881265 CTGGAGGGAGGAATTGTGAGGGG + Intronic
1002493696 5:179597839-179597861 CTGGAGGGAGAAGGCCAGGAGGG - Intronic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1003405477 6:5824017-5824039 CTGGAAGCAGAAAGTGAGGTCGG - Intergenic
1003479782 6:6520302-6520324 GTGGAGGGAGAAAGTGGGGGAGG + Intergenic
1003483429 6:6553958-6553980 CGGTAGGGAGAAATTAGGGAGGG + Intergenic
1003673383 6:8180565-8180587 CTGGAGAGAGAACTTGGGGGTGG + Intergenic
1003745553 6:8997666-8997688 AAGGAGGGAGAAATGGAGGGAGG - Intergenic
1003857111 6:10287588-10287610 AGGGAGGGAGAAAGGGAGGAAGG + Intergenic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1005277751 6:24238155-24238177 ATGGAGGGAGGAATGGAGGGAGG + Intronic
1005680723 6:28205405-28205427 CTGGTGGGAGATATTGATAATGG + Intergenic
1006046550 6:31303795-31303817 CTGTAGGGAGAATGTTAGGATGG + Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007024984 6:38562264-38562286 CAGGAGGAAGAAACTGAAGAGGG - Intronic
1007272908 6:40651771-40651793 CTGGAGGAAGAACCTGGGGAGGG - Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007509195 6:42362522-42362544 ATGGAGGGACAAACTGAGAATGG + Intronic
1007917860 6:45577592-45577614 CTGGAGGGAGTAAATGAGGCTGG + Intronic
1007925048 6:45643651-45643673 CTGGTGGGAGAAGGCGAGGAAGG - Intronic
1008201629 6:48598199-48598221 CGGGAGCCAGAAATAGAGGAGGG - Intergenic
1008929758 6:56926441-56926463 CCGTAAGGGGAAATTGAGGAGGG + Intronic
1009785718 6:68336759-68336781 GTGGAGGGAAAAATAGAGAAAGG - Intergenic
1011000759 6:82585519-82585541 CTGGAGGAAGAAGTAGAGAAAGG - Intergenic
1011907146 6:92385982-92386004 CTAGTGGGAGAAATGGAGGATGG - Intergenic
1012000641 6:93650447-93650469 GTGGTGGGAGAACTTGAGAAAGG + Intergenic
1012021976 6:93934201-93934223 CTGGAGGGACAATTTGAAGATGG + Intergenic
1012410167 6:98947776-98947798 CGGGAGGGAGAAGTAAAGGAAGG + Intronic
1012412812 6:98978767-98978789 CTGCAAGGAAAAATTCAGGAAGG + Intergenic
1012909230 6:105100949-105100971 TCGGAGGGAGGAAGTGAGGAAGG - Exonic
1014891705 6:126851946-126851968 GTGGAGGAAGGTATTGAGGATGG - Intergenic
1015208326 6:130667168-130667190 CTGGAGGCAGCTATTGAGTAGGG - Intergenic
1015554103 6:134443192-134443214 GTGGAGAGAGAAGTTGAAGAGGG + Intergenic
1015936499 6:138410081-138410103 CTAGGTGGAGAAATTGAAGAAGG - Intronic
1016363433 6:143291600-143291622 CTGGCGGGGGAAATGGAAGAAGG - Intronic
1017092280 6:150770765-150770787 CTGGAAGGAGAAACTGTGCAGGG - Intronic
1017200709 6:151751565-151751587 CTGAAGGGAGAAATTTAGGGGGG + Intronic
1017340950 6:153321074-153321096 CAGGTGGGAGAAACTGAGCATGG - Intergenic
1017538389 6:155373157-155373179 AGGGAGGGAGAAAAGGAGGAAGG - Intergenic
1018597305 6:165495371-165495393 CAGGAAGGAGAAAAAGAGGAAGG + Intronic
1019062373 6:169265673-169265695 GTGGAGGAAGCACTTGAGGAAGG + Intergenic
1020498630 7:8888950-8888972 CTGGTGGGAGAAACTGAGAAAGG - Intergenic
1021247018 7:18275629-18275651 CTGGTGGGAGCACTTGAGGCAGG - Intronic
1021829463 7:24589628-24589650 CTGGAGGGAGGAATTTATGTTGG + Intronic
1021839134 7:24708016-24708038 CTGTAGGGAGAAAAGGAGGCGGG + Intronic
1022268712 7:28784915-28784937 GTGGAGAGAGAAATTGAAGAAGG - Intronic
1022311649 7:29201946-29201968 CTGGAGGATGATATTGGGGAGGG + Intronic
1022543858 7:31166850-31166872 CTGCAGGGAGACCTTGAGTAGGG - Intergenic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023628512 7:42140010-42140032 TTGGAGGGTGAATTTCAGGAGGG - Intronic
1023824578 7:44000462-44000484 CAGGAAGGAGAACCTGAGGAGGG + Intergenic
1023883685 7:44335703-44335725 GGGGAGGGGGAAGTTGAGGAGGG - Intergenic
1025128679 7:56364481-56364503 CAGGTGGGAGAAGCTGAGGACGG + Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026088130 7:67279224-67279246 CAGGAAGGAGAACCTGAGGAGGG + Intergenic
1026159026 7:67852654-67852676 AAGGAGGGAGAAAAGGAGGAGGG + Intergenic
1026159099 7:67852969-67852991 CTGGAGGGAGAAGGGGATGAGGG + Intergenic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1026726113 7:72871047-72871069 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1026864881 7:73817400-73817422 CTGGAGAGAAAAATTAAGAAGGG - Intronic
1026903385 7:74049223-74049245 CTGCATGGAGGAATGGAGGATGG - Intronic
1027117728 7:75494557-75494579 CAGGAAGGAGAACCTGAGGAGGG + Intergenic
1027274076 7:76540923-76540945 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1027327518 7:77059975-77059997 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1027460087 7:78441030-78441052 CTTGAGGGAGATATTTAGGTTGG + Intronic
1028260558 7:88658994-88659016 CTGGAGGCAGAAGTGGTGGAAGG + Intergenic
1028887396 7:95949125-95949147 CTTCAAGGAGAAATTAAGGAGGG + Intronic
1029456490 7:100674776-100674798 CTGGAGGAAGAAACTGGGGGCGG - Intronic
1029571232 7:101371000-101371022 CTGTAGGGAGTAAATGAGGAAGG - Intronic
1029607875 7:101609812-101609834 AGGGAGGGAGGAATGGAGGAAGG - Intergenic
1029719769 7:102355498-102355520 CAGGAAGGAGAACCTGAGGAGGG - Intergenic
1029752844 7:102553760-102553782 CAGGAAGGAGAACCTGAGGAGGG + Intronic
1029770795 7:102652852-102652874 CAGGAAGGAGAACCTGAGGAGGG + Intronic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1030910371 7:115240927-115240949 CTGGTGGGAGACATTGATAATGG - Intergenic
1031004834 7:116458703-116458725 GTAGAGGGAGGTATTGAGGATGG - Intronic
1031098343 7:117448083-117448105 GTGGAAAGAGACATTGAGGAAGG + Intergenic
1031242724 7:119266702-119266724 CTGGAGGAAGAAATTCAAGCTGG - Intergenic
1031778720 7:125935702-125935724 CTTGGAGGAAAAATTGAGGAAGG + Intergenic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1033639476 7:143247328-143247350 GGGCAGGGAGAAATGGAGGAAGG + Intronic
1033753786 7:144380439-144380461 CTGGAGGGAGATGTTTAAGAGGG + Exonic
1034024869 7:147690014-147690036 CTGGAGGCGGAATTTGGGGAGGG - Intronic
1034329240 7:150268774-150268796 CTGGCGGGAGACATGTAGGACGG - Intronic
1034399683 7:150854141-150854163 CTGGAGGGAGCAGGTGAGGCAGG - Intronic
1034668814 7:152841086-152841108 CTGGCGGGAGACATGTAGGACGG + Intronic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1035760502 8:2065238-2065260 TTGGAAGGAGAATTTGAGGCTGG + Intronic
1036685140 8:10904569-10904591 CTGGAGGGAGCAGGTGAGGCAGG + Intronic
1037824111 8:22150668-22150690 ATGGAGGGAGATATTTAGAAAGG - Intronic
1037933520 8:22898865-22898887 CAGGAGGGAGAAGTTCAGGAAGG + Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1040318600 8:46277711-46277733 ATAGAGGGAGACATTGAGGCAGG - Intergenic
1041452171 8:58016932-58016954 GTAGGGGGAGAAATTTAGGAAGG + Intronic
1042214824 8:66420289-66420311 CTGGAGGGAGTAACTGGTGAAGG - Intergenic
1042917810 8:73892555-73892577 AAGGAGTGAGAAAGTGAGGATGG + Intergenic
1043147230 8:76673836-76673858 CAGGAGAGAGAAATGGGGGAGGG + Intergenic
1044438248 8:92190826-92190848 CTGGTGGGAGATATCGATGATGG + Intergenic
1044518401 8:93167332-93167354 CTGGAGGTATAAACTGAGAAAGG - Intergenic
1044584782 8:93859300-93859322 ATGGAGGGAGAAATAGATGGTGG + Intronic
1044598747 8:93983184-93983206 CTAGAGGGAGCGATAGAGGACGG - Intergenic
1044728464 8:95211971-95211993 CTGGAGAGAGAAGGCGAGGAAGG + Intergenic
1044741602 8:95332809-95332831 CTGGAGGGAGGAATAGAGGAGGG + Intergenic
1045582795 8:103499389-103499411 AAGGAGGGAGAACGTGAGGAGGG - Intergenic
1045755115 8:105533705-105533727 AGGGAGGGAGAAAGTAAGGAGGG - Intronic
1045755160 8:105533852-105533874 AGGGAGGGAGAAAGGGAGGAAGG - Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046204167 8:110968481-110968503 CGGGAGGGAGAAAGTGGGGATGG - Intergenic
1046494663 8:114997827-114997849 GAGGAGGGAGAAAGAGAGGAGGG + Intergenic
1047554986 8:125919626-125919648 CTGGAGGGCTGAATTGAAGAAGG + Intergenic
1047597197 8:126390592-126390614 CTGCAGGGAGGACTGGAGGATGG - Intergenic
1047711853 8:127560384-127560406 ATGCAGGGAGAAATTGAAGTGGG + Intergenic
1047805493 8:128355312-128355334 GTGGAGGGAGAAATAGACAAAGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048416159 8:134229888-134229910 GTGGAGGGAGATATGGAGCAAGG - Intergenic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048665441 8:136656246-136656268 GTGGAAGGAGAAATTCAGGAAGG - Intergenic
1048682179 8:136855218-136855240 AGGGAGGGAGAAAGGGAGGAAGG + Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048854822 8:138677440-138677462 AAGGAGGGAGAAATTGAAAAAGG + Intronic
1049583160 8:143421782-143421804 CTGCAGGGAGAAGCTGGGGATGG + Intronic
1049752029 8:144289477-144289499 GTGGAGGTAGAAGATGAGGAAGG - Intronic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1050336000 9:4590586-4590608 CTGGTTGGAGAAAATGAGAAAGG + Intronic
1050357777 9:4799101-4799123 AGGGAGGGAGAAAAAGAGGAAGG - Intronic
1050873449 9:10605491-10605513 CTGGAGTGAGAAGATGATGAAGG + Intronic
1052859516 9:33428411-33428433 CAGGAGAGAGAAAGTAAGGAGGG + Intergenic
1053168692 9:35862899-35862921 CTGGAGGGTGACAGTGATGAAGG - Intergenic
1054833198 9:69648847-69648869 CTGCAGGGAGGAATGGAGGTGGG - Intronic
1055546582 9:77380742-77380764 CAGGAGGGATAATTTCAGGATGG + Intronic
1055785095 9:79863316-79863338 CGGGAGGGCGAACTTGCGGACGG - Intergenic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056458110 9:86782935-86782957 CTGGAGGAAGACATAGAGGTCGG - Intergenic
1057003759 9:91537246-91537268 CTGGAGGAAGCAGGTGAGGAGGG + Intergenic
1058053555 9:100428487-100428509 CTGGAGGAAGATGTAGAGGAAGG + Intronic
1058540103 9:106002863-106002885 CTGCAGGGAGAAGTTCAAGAGGG + Intergenic
1058643326 9:107107902-107107924 AGGGAGGGAGGAATGGAGGAAGG + Intergenic
1058672854 9:107375285-107375307 GTGGAGAGAGAAATTGGAGATGG + Intergenic
1058725517 9:107799808-107799830 CTGGCTGAAGAAGTTGAGGATGG + Intergenic
1058985240 9:110203816-110203838 CTGAAGAGAGAAATCAAGGAGGG - Intronic
1059735282 9:117094145-117094167 AGGGAGGGAGAAAGGGAGGAAGG + Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059972629 9:119683323-119683345 CTAGAGGGAGAGATTGAAGTTGG + Intergenic
1060127984 9:121068459-121068481 CTGATGGAAGAAATTGAAGAGGG + Intergenic
1061260618 9:129478889-129478911 CTGAGGGGATAAATTAAGGAAGG - Intergenic
1061679915 9:132237906-132237928 CTGGAGGGACAAAGTGAAGGGGG + Intronic
1061706529 9:132457431-132457453 CTGGAGGAAGATATTGAAGCAGG - Intronic
1061724970 9:132577292-132577314 ATGGAGGGAGAAAAAAAGGAAGG + Intergenic
1061907527 9:133706443-133706465 CTGGTGGGAGGAGATGAGGAAGG + Intronic
1061911810 9:133729024-133729046 GTGGAGGGAGGAATGGATGAAGG + Intronic
1203785615 EBV:125973-125995 CTGGATGGAGATATTGGGCAGGG - Intergenic
1185683786 X:1910431-1910453 AGGGAGGGAGAAAGTGAGGAAGG - Intergenic
1186019187 X:5235081-5235103 AGGGAGGGAGAAAAGGAGGAAGG - Intergenic
1186748692 X:12598452-12598474 CTGGCAGGAGAGAATGAGGATGG - Intronic
1187084323 X:16026181-16026203 CTTGGGAGAGAAATTGAGCACGG + Intergenic
1188089745 X:25949699-25949721 CTTGAAAGGGAAATTGAGGAAGG - Intergenic
1188630262 X:32348443-32348465 CTGGAGGCTGAAATTCAGCAGGG - Exonic
1188833015 X:34924073-34924095 ATGGAGGGAGAAAATGAGAGTGG + Intergenic
1189961138 X:46325884-46325906 CTCCAGGGAGAAATGGAGGCGGG + Intergenic
1190534622 X:51413548-51413570 ATGGAGGGAGAAAGAGAAGAGGG - Intergenic
1190797104 X:53756016-53756038 CTCGAGTGGGAAAATGAGGAAGG + Intergenic
1192156029 X:68747237-68747259 CTGGAGGGAGGAAGTGGGGCAGG + Intergenic
1192296191 X:69851285-69851307 ATGAAGGAAGAAATTGAGCAGGG - Intronic
1192442313 X:71183592-71183614 CTGGAAGCAGAAACTGGGGAGGG - Intergenic
1192572229 X:72215815-72215837 CGGGAGGGAAAACTTCAGGAGGG - Intronic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1195089579 X:101445766-101445788 GTGGAGGGAGGATGTGAGGAGGG + Intronic
1195900523 X:109792891-109792913 CTTGGGGGAGAAAGTGGGGAAGG - Intergenic
1197732509 X:129823316-129823338 CTGGAGGGCAGCATTGAGGAAGG - Intronic
1197993719 X:132348601-132348623 CTAGAGGGAGAAAGGAAGGATGG + Intergenic
1198112063 X:133510370-133510392 ATGGAGGGAGAAAAGGAGGGAGG - Intergenic
1198229166 X:134673262-134673284 AGGGAGGGAGGAATGGAGGAAGG + Intronic
1198370226 X:135982817-135982839 CTGGGGGGAGAAAGAAAGGATGG + Intergenic
1198558017 X:137816653-137816675 ATAGAGAGAGAAAGTGAGGAGGG - Intergenic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1201269340 Y:12239279-12239301 ATGGAGGGAGGAAGGGAGGAAGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201458971 Y:14201501-14201523 ATGGAGGGAGGAAATAAGGAAGG + Intergenic