ID: 904653038

View in Genome Browser
Species Human (GRCh38)
Location 1:32020562-32020584
Sequence ACCAAATGCCTCCAATAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904653037_904653038 -6 Left 904653037 1:32020545-32020567 CCAAAAACTGGAAACAAACCAAA 0: 8
1: 124
2: 767
3: 2480
4: 5498
Right 904653038 1:32020562-32020584 ACCAAATGCCTCCAATAAACTGG 0: 1
1: 0
2: 2
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904653038 Original CRISPR ACCAAATGCCTCCAATAAAC TGG Intronic