ID: 904653038 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:32020562-32020584 |
| Sequence | ACCAAATGCCTCCAATAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 156 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 10, 4: 143} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904653037_904653038 | -6 | Left | 904653037 | 1:32020545-32020567 | CCAAAAACTGGAAACAAACCAAA | 0: 8 1: 124 2: 767 3: 2480 4: 5498 |
||
| Right | 904653038 | 1:32020562-32020584 | ACCAAATGCCTCCAATAAACTGG | 0: 1 1: 0 2: 2 3: 10 4: 143 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904653038 | Original CRISPR | ACCAAATGCCTCCAATAAAC TGG | Intronic | ||