ID: 904655161

View in Genome Browser
Species Human (GRCh38)
Location 1:32040115-32040137
Sequence AGAATAGTGCCTATTAGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904655157_904655161 -3 Left 904655157 1:32040095-32040117 CCAGACCAGGTTGCGGGGCAAGA 0: 1
1: 0
2: 0
3: 5
4: 103
Right 904655161 1:32040115-32040137 AGAATAGTGCCTATTAGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 127
904655152_904655161 17 Left 904655152 1:32040075-32040097 CCTAGATGGCAAGCAGCTAGCCA 0: 1
1: 0
2: 1
3: 11
4: 133
Right 904655161 1:32040115-32040137 AGAATAGTGCCTATTAGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 127
904655158_904655161 -8 Left 904655158 1:32040100-32040122 CCAGGTTGCGGGGCAAGAATAGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 904655161 1:32040115-32040137 AGAATAGTGCCTATTAGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904655161 Original CRISPR AGAATAGTGCCTATTAGGGC CGG Intronic
901856289 1:12046345-12046367 AGAATAGTGCATGGTGGGGCCGG - Intergenic
902225392 1:14993561-14993583 AGAACACTGCTTGTTAGGGCTGG - Intronic
903775794 1:25792862-25792884 AGAATAGTGCGTTTTAGGCTGGG - Intergenic
904655161 1:32040115-32040137 AGAATAGTGCCTATTAGGGCCGG + Intronic
910148292 1:84108737-84108759 AGAATAATGGTTACTAGGGCAGG - Intronic
911711166 1:101075358-101075380 AGAATAGTGATTAACAGGGCTGG - Intergenic
912893102 1:113556859-113556881 AGAATATTCCTTATTAGGCCGGG - Intronic
912928905 1:113938573-113938595 AGAATGGTGCCAATAAGGGTAGG + Intronic
918952836 1:191161407-191161429 AGAATAGTGATTATTAAGGATGG + Intergenic
919237732 1:194868035-194868057 AGAATGGTGGTTATCAGGGCTGG + Intergenic
923139078 1:231145588-231145610 AGAATAGTGATTATTAAGGCTGG + Intergenic
1063251433 10:4279418-4279440 AGAACGGTGCTTATTAGGGGAGG - Intergenic
1064524462 10:16239819-16239841 AGAATAGTGCCTAGTGGGCCAGG + Intergenic
1066246695 10:33590711-33590733 AGAATAGAACCTATTTGGGGTGG - Intergenic
1066748676 10:38630297-38630319 AGAATAATGGTTATTAGGGGCGG + Intergenic
1066967997 10:42287480-42287502 AGAATAATGGTTATTAGGGGCGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1069966216 10:72119423-72119445 AGGTTAGTGCCCACTAGGGCTGG - Intronic
1071941422 10:90595555-90595577 AGCATAGTCTCTATTTGGGCAGG - Intergenic
1075827594 10:125373053-125373075 AAAAGAGTGCCAAGTAGGGCTGG + Intergenic
1077949791 11:6943977-6943999 AGAATAGTGCATGGTATGGCTGG + Intronic
1080487806 11:32729177-32729199 ACACTGGAGCCTATTAGGGCAGG - Intronic
1081342294 11:41943176-41943198 AGAATAGTGAGTATTGGGGTAGG - Intergenic
1084866482 11:72062415-72062437 AGAACAGTGCATTTTAGGCCAGG + Intronic
1086047141 11:82546572-82546594 AGAATAGAGCAAATTAAGGCAGG - Intergenic
1086130970 11:83402044-83402066 AGAGTAGGCCCTTTTAGGGCAGG - Intergenic
1096501505 12:52066687-52066709 ACAATAGGGCCTATGAGTGCTGG + Intergenic
1099974045 12:89527921-89527943 AGAATAGAGGTTACTAGGGCTGG + Intergenic
1100631639 12:96395557-96395579 AGCATAGTGCCTAGTAGAGGAGG + Intronic
1103042883 12:117710393-117710415 AGCAAAGTGTGTATTAGGGCTGG + Intronic
1104106379 12:125663817-125663839 ATAAGAATGCATATTAGGGCCGG + Intergenic
1107095908 13:36534946-36534968 AGAATAGTGGTTACCAGGGCTGG - Intergenic
1108556379 13:51597269-51597291 AGAAAAGTGCCTATGAGCACTGG - Intronic
1115088243 14:29542991-29543013 AGAACAGTGCCTATTTGACCTGG - Intergenic
1116096963 14:40382474-40382496 AAAATAGTGACTATAGGGGCCGG + Intergenic
1118794081 14:69123991-69124013 AGAATAGTGACTACTTGGCCGGG - Intronic
1121634413 14:95443956-95443978 AAAATAGTGCATTTTAGGCCGGG - Intronic
1121764119 14:96470681-96470703 AGAAAAGTGCCTTTGAGGGTCGG + Intronic
1125616835 15:41021909-41021931 TGAATACTGCCTATTAGAGTAGG - Intronic
1128265195 15:66259976-66259998 AGAAAAGTGCCAATCAGGGTAGG - Intergenic
1129129407 15:73479600-73479622 AGAATAGTGGTTACTAGGGGTGG - Intronic
1131199587 15:90385714-90385736 AAAATTATGCCTACTAGGGCAGG - Intergenic
1131211706 15:90503368-90503390 AGAAAAGTGCTTATCAGGACTGG + Intergenic
1131939835 15:97548856-97548878 ATAAAAGTGCTTATAAGGGCTGG - Intergenic
1133141626 16:3748847-3748869 AGAAAAGTGCTTAACAGGGCCGG + Intronic
1133573002 16:7060554-7060576 AGAATAGCTACAATTAGGGCTGG + Intronic
1136734083 16:32447002-32447024 AGAATAATGGTTATTAGGGGAGG - Intergenic
1137620260 16:49871692-49871714 GGAATAGTGCTAACTAGGGCGGG + Intergenic
1203018996 16_KI270728v1_random:382593-382615 AGAATAATGGTTATTAGGGGAGG + Intergenic
1203037331 16_KI270728v1_random:655751-655773 AGAATAATGGTTATTAGGGGAGG + Intergenic
1145758936 17:27414643-27414665 AGAACAGTGCCCAGTAGAGCTGG + Intergenic
1147992637 17:44344412-44344434 AGAATAGGGCAGAATAGGGCAGG + Intergenic
1153689376 18:7576313-7576335 AGAAGAGTGCATATTAGTGTGGG + Intronic
1155539862 18:26857791-26857813 AGAAAAGTGCCAAGTACGGCTGG - Intronic
1158042902 18:53118227-53118249 ATAATATTGCCTATAAGAGCTGG - Intronic
1158422538 18:57308386-57308408 AGAATGGTGGTTACTAGGGCTGG + Intergenic
1159139256 18:64372763-64372785 AGAACAGTGCCTCTTAGTTCTGG - Intergenic
1159933577 18:74340825-74340847 AGAATAGTGCTTACCGGGGCTGG + Intronic
1166218314 19:41350803-41350825 AGAATAGGGCTTACTGGGGCTGG - Intronic
927783553 2:25957181-25957203 AGAATAGTCCCTCTTAGGGGGGG - Intronic
929196983 2:39194983-39195005 AGAATAGTGGTTATCAGGGCTGG - Intronic
929786234 2:44994599-44994621 TGAATGGTGCCTATTGGGGTTGG + Intergenic
930148666 2:48034479-48034501 AGAATAGTTGCTTTTAAGGCAGG + Intergenic
932765530 2:74466867-74466889 AGAATAAGGCCTCTTAGGGCAGG + Intergenic
932972439 2:76561298-76561320 AGAATATTGCTCCTTAGGGCAGG + Intergenic
934311656 2:91872420-91872442 AGAATAATGGTTATTAGGGGTGG + Intergenic
936383410 2:112007525-112007547 AGAATAGTGCTTGCCAGGGCTGG - Intronic
937991002 2:127662320-127662342 GGAATAGTGCCTATCAGTGCAGG - Intronic
938810960 2:134852428-134852450 AGAATATTGCCTACGATGGCTGG - Intronic
939130500 2:138230098-138230120 AGAATGGTGGCTACTAGGGGTGG + Intergenic
940237663 2:151528268-151528290 AGAAATGTGCCTAATAGTGCAGG - Intronic
943500488 2:188682498-188682520 ACAGTAGGGCCTATTAGAGCAGG - Intergenic
945299566 2:208203328-208203350 AAAATATTACCTATTAGGCCAGG + Intergenic
945786731 2:214248611-214248633 AGAATAGTGCCTAGCACGGCCGG - Intronic
946679371 2:222196780-222196802 AGAAAAGTGACTATTAGCCCTGG - Intergenic
1169417367 20:5429011-5429033 AGAATAGTGAGTATTAGGCCAGG + Intergenic
1169647068 20:7823682-7823704 AGAAGAGTGGTTATTAGGGCTGG + Intergenic
1171085972 20:22238801-22238823 AGAATAATGCCTCTTAAGCCAGG - Intergenic
1173287819 20:41688981-41689003 AGAGTCGTCCCTAGTAGGGCTGG - Intergenic
1177912155 21:27046200-27046222 AGAATGGGGCCTAATAGGACTGG - Intergenic
1179061596 21:37984371-37984393 AGAGAAGTGTTTATTAGGGCTGG - Intronic
1181166011 22:20983385-20983407 AGAAAAGTGCCTGGCAGGGCTGG - Intronic
1182964277 22:34506712-34506734 AGAATCTTCCCTAGTAGGGCTGG - Intergenic
949677292 3:6470523-6470545 AGAATAGTGTGTAGTAGGCCGGG - Intergenic
953633085 3:44636399-44636421 AGATTGGTGCCTGCTAGGGCTGG - Intronic
955731586 3:61993070-61993092 TGAACAGTGCATATTAGTGCAGG + Intronic
963166153 3:142205921-142205943 AGAATAGGGGCTATAAGGGATGG - Intronic
968348015 3:198027526-198027548 AGAATAGAGGCTGTCAGGGCTGG - Intronic
974727712 4:65817410-65817432 ATAATAGTGCCTCTCAGGGTAGG + Intergenic
975603568 4:76128906-76128928 AGAATAGTGGCTACTAGAGGTGG + Intronic
976619976 4:87117520-87117542 ATCCTAGTGCCTATCAGGGCTGG + Intronic
977043823 4:92045166-92045188 AGCATAGTTCCTAGTAGGGTGGG + Intergenic
977181181 4:93876661-93876683 AGAATAGTTCCCATAAGGACAGG - Intergenic
977593772 4:98855240-98855262 AGAATAGTGATTATTAAGGGTGG + Intergenic
978131631 4:105205512-105205534 AGAATAGTACCTATTGGGTTGGG - Intronic
984175398 4:176411029-176411051 AGATTAGTGCCTTTTAGAGACGG + Intergenic
984235552 4:177153455-177153477 AGAATATGGCTTTTTAGGGCCGG + Intergenic
987095269 5:14543920-14543942 AGAACTGTGCCTATTAGCTCTGG - Intergenic
990622287 5:57573083-57573105 AGAATGGTGGCTACCAGGGCTGG - Intergenic
991661639 5:68956830-68956852 AGAAAAGTGGTTATCAGGGCTGG + Intergenic
992884278 5:81142370-81142392 AGCATAGTTCTTTTTAGGGCTGG - Intronic
993557569 5:89360218-89360240 AGAGTAGTGGTTATGAGGGCTGG - Intergenic
996817238 5:127587820-127587842 AGAACAGTCTCTGTTAGGGCAGG + Intergenic
1001211842 5:169817114-169817136 AGAATTGGGCCTATTAGGAAAGG - Intronic
1002644547 5:180646720-180646742 AGCATAGTGCCTGTTCGGGGTGG - Intronic
1004311091 6:14545710-14545732 AGAATAATGCCTCTTGGGGATGG + Intergenic
1005152771 6:22771917-22771939 AGAATAGTGTCTATCAGGCAGGG - Intergenic
1005533578 6:26733095-26733117 AAAAAAGTGCTTATTAGGCCAGG + Intergenic
1005535072 6:26746581-26746603 AAAAAAGTGCTTATTAGGCCAGG - Intergenic
1005537217 6:26768559-26768581 AAAAAAGTGCTTATTAGGCCAGG - Intergenic
1007117492 6:39353853-39353875 AGCATAGTGCCCATTGTGGCTGG - Intronic
1013617669 6:111859886-111859908 AGAATATCCCATATTAGGGCTGG + Intronic
1014909664 6:127076323-127076345 AGAATATTGCCTATTAGTTATGG - Intergenic
1018925215 6:168201211-168201233 AGACAAATGCCTATTAGTGCAGG - Intergenic
1018964191 6:168471223-168471245 AGAATGGTGGCTACTAGGGCTGG - Intronic
1020812999 7:12868839-12868861 AGAATAGTGACTAATAGTTCTGG + Intergenic
1023364126 7:39446119-39446141 AGAAAAATGCCAACTAGGGCAGG + Intronic
1029929283 7:104353644-104353666 GCATTAGTGCCTAATAGGGCGGG + Intronic
1031960430 7:127984668-127984690 AAAACAGTGCATCTTAGGGCAGG - Intronic
1033233988 7:139623812-139623834 AGAATTGTGCGTATCATGGCGGG - Intronic
1034409459 7:150932248-150932270 AGAATAATGGATATTGGGGCAGG + Intergenic
1036821798 8:11946019-11946041 AGAATTGTGGTTATCAGGGCTGG + Intergenic
1044298800 8:90559149-90559171 AGAGTAGTGGTTGTTAGGGCTGG + Intergenic
1044908875 8:97035624-97035646 AGAATAGTGGCCATTAGGAGAGG - Intronic
1045865879 8:106864788-106864810 GCAATGGTGCTTATTAGGGCCGG + Intergenic
1051609585 9:18948230-18948252 ACAGTAGTGCCTATCATGGCAGG + Intronic
1052661796 9:31442407-31442429 AAAATAGTGCCTACCAGGGGTGG + Intergenic
1053242572 9:36508104-36508126 AGAATAGTGGCTATTATTGAGGG + Intergenic
1057416432 9:94867751-94867773 AGAACAGATCCTATCAGGGCTGG - Intronic
1057731571 9:97613514-97613536 AGAACACTGCCTCTTAAGGCTGG - Intronic
1059034660 9:110740963-110740985 AGAATAGTGGCTGTCAGGGATGG + Intronic
1061534717 9:131240395-131240417 AGAATAGTGCCTCTTCCTGCCGG + Intergenic
1186075569 X:5874781-5874803 AGAAGAGGACCTATTAGGGTTGG - Intronic
1188342966 X:29028246-29028268 AAAATGGTGCCTACCAGGGCTGG - Intronic
1190001423 X:46691664-46691686 AAAATAGTGCATATTGGGGATGG + Intronic
1192115107 X:68402732-68402754 AGAAGAGTGCTTATCAGGTCAGG + Intronic
1197442501 X:126509402-126509424 ATAAAATTGCCTACTAGGGCAGG + Intergenic
1198675714 X:139127994-139128016 AGAATAATGCCTATGAGTCCTGG - Intronic