ID: 904657546

View in Genome Browser
Species Human (GRCh38)
Location 1:32060553-32060575
Sequence CCACTACCACACCTGTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904657537_904657546 21 Left 904657537 1:32060509-32060531 CCCATAGAATTGGCTGAAACACC 0: 1
1: 0
2: 2
3: 7
4: 95
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657542_904657546 -8 Left 904657542 1:32060538-32060560 CCGTTTTCTGTTTCCCCACTACC 0: 1
1: 1
2: 8
3: 42
4: 480
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657540_904657546 -1 Left 904657540 1:32060531-32060553 CCTACCACCGTTTTCTGTTTCCC 0: 1
1: 0
2: 0
3: 23
4: 215
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657539_904657546 0 Left 904657539 1:32060530-32060552 CCCTACCACCGTTTTCTGTTTCC 0: 1
1: 0
2: 1
3: 14
4: 232
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657536_904657546 24 Left 904657536 1:32060506-32060528 CCTCCCATAGAATTGGCTGAAAC 0: 1
1: 1
2: 0
3: 9
4: 66
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657541_904657546 -5 Left 904657541 1:32060535-32060557 CCACCGTTTTCTGTTTCCCCACT 0: 1
1: 0
2: 0
3: 21
4: 268
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657538_904657546 20 Left 904657538 1:32060510-32060532 CCATAGAATTGGCTGAAACACCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904657546 Original CRISPR CCACTACCACACCTGTGTTA TGG Intronic