ID: 904657546

View in Genome Browser
Species Human (GRCh38)
Location 1:32060553-32060575
Sequence CCACTACCACACCTGTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904657541_904657546 -5 Left 904657541 1:32060535-32060557 CCACCGTTTTCTGTTTCCCCACT 0: 1
1: 0
2: 0
3: 21
4: 268
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657538_904657546 20 Left 904657538 1:32060510-32060532 CCATAGAATTGGCTGAAACACCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657537_904657546 21 Left 904657537 1:32060509-32060531 CCCATAGAATTGGCTGAAACACC 0: 1
1: 0
2: 2
3: 7
4: 95
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657542_904657546 -8 Left 904657542 1:32060538-32060560 CCGTTTTCTGTTTCCCCACTACC 0: 1
1: 1
2: 8
3: 42
4: 480
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657539_904657546 0 Left 904657539 1:32060530-32060552 CCCTACCACCGTTTTCTGTTTCC 0: 1
1: 0
2: 1
3: 14
4: 232
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657536_904657546 24 Left 904657536 1:32060506-32060528 CCTCCCATAGAATTGGCTGAAAC 0: 1
1: 1
2: 0
3: 9
4: 66
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96
904657540_904657546 -1 Left 904657540 1:32060531-32060553 CCTACCACCGTTTTCTGTTTCCC 0: 1
1: 0
2: 0
3: 23
4: 215
Right 904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904657546 Original CRISPR CCACTACCACACCTGTGTTA TGG Intronic
900279127 1:1854548-1854570 TCACTACAAAACCTGTTTTAAGG + Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
903150564 1:21405109-21405131 CCACTCCCACATCTCTGCTAAGG + Intergenic
903826707 1:26150820-26150842 GCACCACCACACCTGGGTTATGG - Intergenic
904657546 1:32060553-32060575 CCACTACCACACCTGTGTTATGG + Intronic
911080665 1:93926715-93926737 ACACAACCAGACCTGTATTATGG - Intergenic
912414753 1:109500297-109500319 CCACAGCCACACCAGTGATAGGG - Intronic
914786086 1:150832388-150832410 CTACTGCCACACCTGTTTCAAGG + Exonic
915455015 1:156034682-156034704 CCTCTACCACACCTGACCTATGG + Intergenic
917776894 1:178347327-178347349 CCCCTATCAGACCTGTGTGACGG + Intronic
919280797 1:195485918-195485940 CCACTACCACACCTGAACTCAGG - Intergenic
1063616169 10:7602225-7602247 CAACTACCACATCTGTTTTGGGG + Intronic
1069906359 10:71734801-71734823 CCACTCTCACACCTGAGTTCAGG + Intronic
1077247028 11:1544638-1544660 CCAGTACCCCACCTGTGTAATGG - Intergenic
1087874296 11:103337367-103337389 CCTCTAGCACAGCTGGGTTAGGG + Intronic
1091300845 11:134506937-134506959 CCACTACTACATCTCTGTTTTGG - Intergenic
1094433963 12:30400331-30400353 CCCCTGGCACACATGTGTTATGG + Intergenic
1102967857 12:117141801-117141823 CCACTTCCACACCTGGCTCATGG + Intergenic
1108166505 13:47698908-47698930 CCACAGCCATACCTGTGTTTAGG + Intergenic
1110047451 13:70848036-70848058 CCACTGCCAAACCTGTGGAAGGG - Intergenic
1113590222 13:111493713-111493735 CCAGTGCCCAACCTGTGTTACGG + Intergenic
1121159340 14:91721911-91721933 ACACCAGCACACCTGGGTTAGGG - Intronic
1122557005 14:102585869-102585891 CCACACCCACACCTTTGCTAGGG - Intergenic
1127257071 15:57301510-57301532 CCAGTACCCCACATGTTTTAGGG - Intergenic
1132028358 15:98421229-98421251 CCACTTCCCCACCTGTGTACTGG + Intergenic
1135297397 16:21294224-21294246 CCACGACCACTCCTGTGCCAGGG - Intronic
1135341881 16:21655349-21655371 AGACTACCATACCTGTGTGAAGG + Exonic
1136128062 16:28199714-28199736 CCACCACCACACCTGGCTAATGG + Intronic
1136773601 16:32860037-32860059 CCACAACCAGGTCTGTGTTATGG - Intergenic
1140778941 16:78276131-78276153 TCACTACCACTCATGAGTTAAGG - Intronic
1203076017 16_KI270728v1_random:1122148-1122170 CCACAACCAGGTCTGTGTTATGG - Intergenic
1147621908 17:41873732-41873754 CCACTCCCACCCCTTTGTTGGGG + Intronic
1148706835 17:49641719-49641741 CCACTATTACACATTTGTTAAGG - Intronic
1150828548 17:68498049-68498071 CCCCCATCACACCTGTGTTTAGG - Intergenic
1151435126 17:74090574-74090596 CCACAGCCACACCTGTGTTGGGG + Intergenic
1153024298 18:658798-658820 CCACCTCCACCCCTGTGTCAAGG - Intronic
1156015333 18:32540943-32540965 CCACCACCACACATGTGCCAAGG - Intergenic
1156955823 18:42962527-42962549 CCACTAACAGACGTGTGTTTAGG + Intronic
1158087658 18:53672099-53672121 CCTCTAGCACAGCTGGGTTAGGG + Intergenic
1159697041 18:71573469-71573491 CCTCTAGCACCCCTGGGTTAGGG + Intergenic
1164262096 19:23576836-23576858 CCTCTACCACCGCTGGGTTAGGG - Intronic
1167632130 19:50631920-50631942 CCACTACCAATCCTGGCTTAGGG + Intronic
1168163787 19:54532899-54532921 CCACCACCAGACCTGGGTTGTGG - Intronic
932290331 2:70571627-70571649 CCACTACCCCACATGTCTTTGGG + Intergenic
934718476 2:96556757-96556779 CCATTCCCTCACCTGTGATATGG + Intergenic
936937307 2:117850694-117850716 CCACTATCAAAGCAGTGTTAAGG - Intergenic
940887773 2:159004777-159004799 CCTCTAGCACCCCTGGGTTAGGG - Intronic
941162453 2:162051678-162051700 CCTCCACCACCCCTGTGTCAAGG - Intronic
944048519 2:195440130-195440152 CCACTAGCACTGCTGTATTAGGG + Intergenic
944503869 2:200390006-200390028 CCACTAGCAAACCAGTGCTAGGG - Intronic
946327364 2:218991745-218991767 CCATTTCCACACCTGTGTATGGG + Intronic
948754472 2:240150933-240150955 CTCCTACCACCCCTGTGTTCTGG - Intergenic
948754484 2:240150980-240151002 CTCCTACCACCCCTGTGTTCCGG - Intergenic
948754508 2:240151074-240151096 CTCCTACCACCCCTGTGTTCCGG - Intergenic
1170740798 20:19054342-19054364 CCACCTCCACACATGTGTTAAGG - Intergenic
1172623164 20:36332702-36332724 CCACTTCCTCACCTGTGAAATGG - Intronic
1174544092 20:51312325-51312347 CCCCTACAACACATGTATTAGGG - Intergenic
1174897092 20:54461493-54461515 ACAGAATCACACCTGTGTTAGGG + Intergenic
1182330827 22:29550722-29550744 CCACAACAACCCCTGTGGTAGGG - Intronic
1183588126 22:38764766-38764788 CCACTCCCACACCTGAGGCATGG - Intronic
954460544 3:50624376-50624398 CCACTCGCAGACCTGTGTTCTGG + Intronic
954901410 3:54023204-54023226 CCATTGCCACACATGTGTCATGG - Intergenic
959545623 3:107592797-107592819 CCACCTCCACACATGTCTTAAGG + Intronic
961265348 3:125637270-125637292 CCTCTAGCACCCCTGGGTTAGGG - Intergenic
961828876 3:129613076-129613098 CCATTCCCACACCTGTGTAATGG + Intergenic
966081447 3:176007775-176007797 ACATTACCACACCAGTATTAAGG - Intergenic
973907522 4:55546550-55546572 CCACTACCCCGCCTGTGTCCAGG + Intronic
980657728 4:135811694-135811716 CCACCACCACACCAGTCTCATGG - Intergenic
981457572 4:144971767-144971789 CCACTGCCACACCCCTGTTTGGG + Intronic
989345582 5:40425721-40425743 CCTCTAGCACCCCTGGGTTAGGG + Intergenic
990209495 5:53467194-53467216 CCACTCCCTCACCTCTGTTATGG + Intergenic
996721178 5:126631571-126631593 CCACCACCACACCTGTGAGCTGG + Intergenic
997627451 5:135340584-135340606 CCATAACCACACCTGTGTGATGG - Intronic
1006668199 6:35712925-35712947 CCACCACCACACCTGGCTTTGGG - Intronic
1007606895 6:43123886-43123908 CCACCACCCCACCTGAGTAAGGG - Intronic
1010456576 6:76063520-76063542 TCACTGCCACACCAGTGTTTGGG - Intronic
1010818980 6:80391227-80391249 CCACTACACCATCTGTATTAGGG - Intergenic
1013739172 6:113263435-113263457 CCACTAGCGCCACTGTGTTAGGG - Intergenic
1013923969 6:115445857-115445879 CAACTACCACACCTCTGTCATGG - Intergenic
1015483423 6:133741455-133741477 CCACTACCACAGCTGGGGTGTGG - Intergenic
1016339502 6:143047498-143047520 CTAATACCACAGCTGTTTTAAGG - Intergenic
1018100180 6:160430994-160431016 CCACCACCACAACCGTGGTACGG - Intronic
1025029625 7:55546738-55546760 CCACCACCACCCCTGAATTAAGG + Intronic
1025728391 7:64088633-64088655 CCTCTAGCACAGCTGGGTTAGGG - Intronic
1026608745 7:71838574-71838596 GTACCACCACACCTGTGGTATGG + Intronic
1027832201 7:83192769-83192791 CTACCACCACACTTGTGTTACGG + Intergenic
1032285247 7:130534720-130534742 CCTTTACTACACCTGTGTTTAGG - Intronic
1038008622 8:23456592-23456614 CAACTACAAGACCTCTGTTAAGG + Intronic
1045434648 8:102149844-102149866 CCACTGCCACTGCTGTGTTTTGG - Intergenic
1054851548 9:69851716-69851738 GCACCACCACACCTGGCTTACGG - Intronic
1058329411 9:103740529-103740551 CCACTGCCCCCTCTGTGTTACGG + Intergenic
1060917370 9:127399028-127399050 GCAGAAACACACCTGTGTTAGGG + Intronic
1062282456 9:135758118-135758140 CCACGGCCACACCTGTGTCTCGG - Intronic
1062286383 9:135774849-135774871 CCCCTTCCACACCTGGGTGAGGG + Intronic
1186325603 X:8473431-8473453 CCACAAACACAGCTGTGTCAAGG - Intergenic
1187509666 X:19906342-19906364 CCACTCCTACCCCTGTGATATGG - Intergenic
1187808265 X:23145102-23145124 CCAATACCAAATTTGTGTTAGGG - Intergenic
1190700391 X:52983995-52984017 CCACTGTCACAACTGTGTCAGGG + Intronic
1190797630 X:53759680-53759702 CCACTGTGACACCTGTGTTGCGG - Intergenic
1197100250 X:122644908-122644930 ACAATACCACAGCTGTGTGATGG - Intergenic
1199878122 X:151951139-151951161 ACACTACTACACATCTGTTATGG - Intergenic
1200280193 X:154770688-154770710 CCACTCCCACACCAGAGTAAAGG - Intronic
1200288754 X:154850585-154850607 ACACTACCACACCTGGCTAAGGG + Intronic
1200845162 Y:7824855-7824877 CCACTATTACACCTGTGATTTGG + Intergenic
1201857015 Y:18555908-18555930 CCTCTAGCACAGCTGGGTTAAGG - Intronic
1201876306 Y:18764472-18764494 CCTCTAGCACAGCTGGGTTAAGG + Intronic