ID: 904658247

View in Genome Browser
Species Human (GRCh38)
Location 1:32065574-32065596
Sequence TCACTTCTGTGTACCACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904658244_904658247 13 Left 904658244 1:32065538-32065560 CCAGAAAGCTGCATTGTGTTTTA No data
Right 904658247 1:32065574-32065596 TCACTTCTGTGTACCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904658247 Original CRISPR TCACTTCTGTGTACCACCAG AGG Intergenic
No off target data available for this crispr