ID: 904659934

View in Genome Browser
Species Human (GRCh38)
Location 1:32076800-32076822
Sequence GCGGCGGCCCAGAACGATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904659934_904659946 23 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659946 1:32076846-32076868 GGTGATTGGGTCCTAGAGGCTGG 0: 1
1: 0
2: 0
3: 25
4: 298
904659934_904659942 9 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659942 1:32076832-32076854 TCCATCGTGAAGGAGGTGATTGG 0: 1
1: 0
2: 1
3: 9
4: 99
904659934_904659947 28 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659947 1:32076851-32076873 TTGGGTCCTAGAGGCTGGCCAGG 0: 1
1: 0
2: 5
3: 28
4: 243
904659934_904659945 19 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659945 1:32076842-32076864 AGGAGGTGATTGGGTCCTAGAGG 0: 1
1: 3
2: 64
3: 845
4: 4821
904659934_904659948 29 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659948 1:32076852-32076874 TGGGTCCTAGAGGCTGGCCAGGG 0: 1
1: 0
2: 4
3: 37
4: 493
904659934_904659944 10 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659944 1:32076833-32076855 CCATCGTGAAGGAGGTGATTGGG 0: 1
1: 0
2: 1
3: 8
4: 107
904659934_904659941 2 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659941 1:32076825-32076847 CATTGGGTCCATCGTGAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 83
904659934_904659940 -1 Left 904659934 1:32076800-32076822 CCACCATCGTTCTGGGCCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 904659940 1:32076822-32076844 CTTCATTGGGTCCATCGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904659934 Original CRISPR GCGGCGGCCCAGAACGATGG TGG (reversed) Exonic
900530706 1:3151644-3151666 GCGGCCTCCCAGAACGGCGGTGG - Intronic
903007160 1:20306320-20306342 GCGGGGGCTCAGATCAATGGGGG + Intronic
904659934 1:32076800-32076822 GCGGCGGCCCAGAACGATGGTGG - Exonic
906283475 1:44569855-44569877 GCTGGGGCCCAGGACGATGCGGG - Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
912915635 1:113812037-113812059 GCAGCGGCCCAGGATGTTGGCGG + Exonic
913602368 1:120433971-120433993 ACGGCGGCCCAGATGGAAGGCGG + Intergenic
914190690 1:145407832-145407854 ACGGCGGCCCAGATGGAAGGTGG - Intergenic
914588498 1:149084676-149084698 ACGGCGGCCCAGATGGAAGGTGG - Intronic
922958629 1:229626025-229626047 GCGGCCGCCCAGAGCGGCGGCGG - Exonic
923008051 1:230067526-230067548 GCGGAGGCCCGGGACGAGGGCGG - Intronic
1073812320 10:107164551-107164573 GAGGGGTCCCAGAACGAAGGTGG + Intergenic
1074065370 10:110008247-110008269 GCGGCTGCCGAGAAGGAGGGAGG + Exonic
1074503450 10:114045393-114045415 GAGGCGGCCCCGGGCGATGGCGG - Exonic
1089562718 11:119352956-119352978 ACGGAGGCCCAGAAAGAGGGAGG + Intergenic
1090472527 11:126992957-126992979 GAGGAGGCACAGAAGGATGGTGG - Intronic
1090636375 11:128692880-128692902 GCGGCGGCCCAGGAGGGAGGCGG + Intronic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1094536203 12:31324608-31324630 GCGGCGGCCCCGAGCGCCGGGGG + Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1114605051 14:23989323-23989345 GGGGCAGCCCAGAACACTGGGGG - Intronic
1114610504 14:24036883-24036905 GGGGCAGCCCAGAACACTGGGGG - Intergenic
1122980326 14:105189057-105189079 GAGCCGGCCCAGAATGGTGGTGG + Intergenic
1124426804 15:29570065-29570087 GCGGCGGCCCTGACCGGGGGCGG - Intronic
1127935739 15:63635987-63636009 GCGGCGGCCCAGGCAGATCGAGG - Exonic
1137476064 16:48811052-48811074 GGGGCGGCCGCGATCGATGGCGG + Intergenic
1144684353 17:17216234-17216256 ACGGAGGCCCAGAGCCATGGGGG + Intronic
1148336037 17:46841947-46841969 GCGGCGGCCGCGGACGCTGGAGG - Intronic
1149309535 17:55380635-55380657 GCGGCAGCCCAGATAGATGTTGG + Intergenic
1151217547 17:72587932-72587954 GCGGGGGCCCAGACCAGTGGAGG + Intergenic
1164634304 19:29781293-29781315 GCGGTGGCCCAGCAGAATGGTGG + Intergenic
1165803255 19:38565643-38565665 GCGGTGGCCGTGACCGATGGGGG + Exonic
1166330598 19:42076114-42076136 GCGGCGGCCGAGGAGGAAGGTGG + Intronic
1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG + Exonic
1168315032 19:55481287-55481309 CCGGCGGCCCAGTACGAATGTGG + Exonic
925760852 2:7183099-7183121 GCTGCGGCCCAGAACTGAGGGGG + Intergenic
1180216010 21:46324246-46324268 GCAGCGGCGCAGAAAGGTGGAGG + Exonic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1184032947 22:41905479-41905501 GCGGCAGGCCAGCAGGATGGCGG - Exonic
1184108795 22:42383514-42383536 GCGGGGGCCCAGAACCAAGTTGG + Exonic
1184815038 22:46862688-46862710 GCCGCAGCCCAGAAGGGTGGTGG + Intronic
1185321098 22:50200614-50200636 CCGGCGGCCCAGAACCGCGGCGG + Intergenic
954063242 3:48086735-48086757 TAGGCAGCCCAGAACAATGGAGG + Intronic
966378797 3:179323225-179323247 GCGGCGGCCGAGAGCGCAGGCGG - Intronic
967731548 3:192911747-192911769 GCCACTGCCCAGAACCATGGAGG + Intronic
970399466 4:15703472-15703494 GCGATGGTCCTGAACGATGGGGG + Intronic
974454285 4:62106051-62106073 GCGGCAGTGCAGAAAGATGGCGG + Intergenic
975166739 4:71186654-71186676 GCAGCGGCCCGGAGCGGTGGGGG + Intergenic
975354486 4:73385328-73385350 GCGGCTGCCCAACAAGATGGAGG - Intergenic
1013755409 6:113455912-113455934 GAGGAGGCCCACAATGATGGTGG - Intergenic
1019132391 6:169886777-169886799 GCGGCGGGCCACCATGATGGAGG + Intergenic
1026010304 7:66630528-66630550 GCGGAGTCCCAGGACAATGGAGG + Intronic
1028621804 7:92834940-92834962 GCGGCGGCCCTGGAGGAGGGAGG - Intronic
1029996532 7:105013194-105013216 GCAGCGACCCAGAGCGCTGGGGG - Intergenic
1033299925 7:140176645-140176667 GCGGCGGCCCGGCCCGAGGGAGG + Intronic
1034458806 7:151186843-151186865 CCAGCGACCCAGAGCGATGGAGG - Exonic
1035273795 7:157735465-157735487 GCAGCGGCCCAGGAAGGTGGAGG + Intronic
1054159192 9:61661867-61661889 GCAGCGGCCCCGGGCGATGGGGG + Intronic
1054478966 9:65592872-65592894 GCAGCGGCCCCGGGCGATGGGGG + Intergenic
1061662016 9:132136560-132136582 GCGATGGCCCAGAATAATGGGGG - Intergenic
1189361846 X:40359223-40359245 GTGTCGGCCCAGATCGAGGGTGG - Intergenic
1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG + Intronic
1190337278 X:49270068-49270090 GCGGCGGCCGGGCAAGATGGCGG + Exonic