ID: 904662631

View in Genome Browser
Species Human (GRCh38)
Location 1:32096569-32096591
Sequence CTACTTGGGAGGCCCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2389
Summary {0: 1, 1: 24, 2: 103, 3: 482, 4: 1779}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904662631_904662636 -10 Left 904662631 1:32096569-32096591 CCTGCCTCGGGCCTCCCAAGTAG 0: 1
1: 24
2: 103
3: 482
4: 1779
Right 904662636 1:32096582-32096604 TCCCAAGTAGCTGGGATTACAGG 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
904662631_904662639 9 Left 904662631 1:32096569-32096591 CCTGCCTCGGGCCTCCCAAGTAG 0: 1
1: 24
2: 103
3: 482
4: 1779
Right 904662639 1:32096601-32096623 CAGGTGTGCACCACCACACCCGG 0: 1539
1: 5896
2: 24700
3: 65088
4: 142610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904662631 Original CRISPR CTACTTGGGAGGCCCGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr