ID: 904663310

View in Genome Browser
Species Human (GRCh38)
Location 1:32101200-32101222
Sequence CAGGGTAAGGCTGAGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904663310_904663316 4 Left 904663310 1:32101200-32101222 CCTTCCTACTCAGCCTTACCCTG 0: 1
1: 0
2: 3
3: 24
4: 311
Right 904663316 1:32101227-32101249 TTGTACGTGAAAGATATGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 81
904663310_904663317 5 Left 904663310 1:32101200-32101222 CCTTCCTACTCAGCCTTACCCTG 0: 1
1: 0
2: 3
3: 24
4: 311
Right 904663317 1:32101228-32101250 TGTACGTGAAAGATATGCTAGGG 0: 1
1: 0
2: 1
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904663310 Original CRISPR CAGGGTAAGGCTGAGTAGGA AGG (reversed) Intronic
900382054 1:2389763-2389785 CAGGGTAAGGCTGGATGGGCAGG - Intronic
900862811 1:5245200-5245222 CAGGGTCAGGCTGATTGGTACGG + Intergenic
901388253 1:8925370-8925392 CAGTGCAAGAATGAGTAGGAGGG - Intergenic
901736508 1:11315989-11316011 GAGGGGAAGGCAGGGTAGGAAGG - Intergenic
902104002 1:14018359-14018381 CAGGGTACGGGGGAGAAGGAGGG + Intergenic
904133360 1:28291847-28291869 CAGGGTGAGGCTGAGAAACAGGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904663310 1:32101200-32101222 CAGGGTAAGGCTGAGTAGGAAGG - Intronic
905434420 1:37946919-37946941 CAGGGCAGGGCTGGGCAGGAGGG - Intronic
906131917 1:43465302-43465324 CAGGGTAAGACTGGGAAGGTGGG - Intergenic
908152437 1:61316243-61316265 GAGGGTATGGCTGAGGAAGAAGG + Intronic
908779790 1:67679854-67679876 CAGGGTATGGCTCATTAGGAAGG + Intergenic
912619454 1:111140304-111140326 CAGGGTAAGGCTGCGGAGCGCGG + Intronic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
914877615 1:151524047-151524069 CAGGGTAAGGCAGATCAGGAGGG + Intronic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
915482596 1:156197254-156197276 CAGGCTGAGGCTGGGGAGGAGGG + Intronic
915646326 1:157275291-157275313 CAGTGCAAGAATGAGTAGGAGGG + Intergenic
917630473 1:176886785-176886807 AAGTGAAAGGCTGAGTAGGCAGG - Intronic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
921039581 1:211416798-211416820 CAGGCTGAGCCTGAGCAGGACGG - Intergenic
921833120 1:219750346-219750368 CTGGGGAAGGCAGAGTAGGATGG + Intronic
922985397 1:229862368-229862390 CAGGCAAAGGCAGAGTGGGAAGG + Intergenic
1063096573 10:2913638-2913660 CTGAGGAAGGCAGAGTAGGAAGG + Intergenic
1063139364 10:3242949-3242971 CAGGGTAAGGCTGAAACTGATGG - Intergenic
1064130593 10:12706197-12706219 CTGGGTGAGACAGAGTAGGATGG + Intronic
1065395452 10:25231911-25231933 CAGGGTGAGGCTGAGTTTGAAGG + Intronic
1065961082 10:30734864-30734886 CATGATAAGGGTGATTAGGATGG + Intergenic
1067905855 10:50290262-50290284 CGGGGTAATTCTGACTAGGATGG - Intergenic
1068158879 10:53237790-53237812 AAGGGTAAGTCAGAGCAGGAGGG - Intergenic
1069587142 10:69614885-69614907 CAAGGTGAGTCTGAGTAGCAGGG - Intergenic
1069677672 10:70260251-70260273 CACGGTATGGCTGGGGAGGAAGG - Intronic
1069906614 10:71735961-71735983 GAGGGTGAGGCTCAGTAAGAGGG - Intronic
1069940675 10:71953191-71953213 CAGTGCAAGAATGAGTAGGAGGG + Intergenic
1070156678 10:73839732-73839754 CAGGGGCAGGCTGAGGAGGTAGG + Intronic
1071330357 10:84552698-84552720 CAGTGTGAGGCTGAGCAGGTAGG - Intergenic
1071432674 10:85618660-85618682 CAAGGGAAGGCTGAGGAGGAGGG - Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1072202483 10:93173318-93173340 CAGGCTAAGGGTGGGAAGGAAGG - Intergenic
1073036108 10:100565182-100565204 CAGGGTGAGGCTGGGCTGGACGG + Intergenic
1073772703 10:106752756-106752778 CAGGGTAATGCTAAGGAGAATGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074715435 10:116214180-116214202 CATTTGAAGGCTGAGTAGGAGGG - Intronic
1075105391 10:119536855-119536877 CAGATTGAGGCAGAGTAGGAGGG - Intronic
1075868122 10:125745125-125745147 CTGGGTGAGGCAGAGCAGGATGG + Intronic
1077572778 11:3354070-3354092 CAGTGCAAGAATGAGTAGGAAGG + Intronic
1078413152 11:11144021-11144043 CAGGGACAGGCTGAGCAGGGCGG - Intergenic
1078510032 11:11978175-11978197 CAGGAGAAGGTTGAGAAGGAAGG + Intronic
1079151673 11:17905497-17905519 CAGGCTTAGTCTGAGGAGGAAGG + Intronic
1079350448 11:19687332-19687354 CAGGTTATGGCTGAGAGGGAAGG - Intronic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081871429 11:46384345-46384367 CAGGGTGAGGCTGTGGTGGATGG - Intergenic
1082811197 11:57480044-57480066 CACGGTATGGCTGGGTGGGAGGG - Intergenic
1084861019 11:72018291-72018313 CATGGTAAGGCTGCGAGGGAGGG + Exonic
1085251032 11:75144239-75144261 CAGTGTCAGGCTGAGAAGGATGG + Intronic
1085719840 11:78903229-78903251 GAGGGTGAGGCTGAGGAGGGTGG - Intronic
1087195548 11:95301061-95301083 CAGGGTAAGGCAAGGTGGGAAGG + Intergenic
1087970400 11:104474014-104474036 CAAGGTAGGGCTGAGTTGGGTGG + Intergenic
1088921360 11:114261653-114261675 CAGGGTAGGGCTGAGTAAGGAGG + Intronic
1089173872 11:116534740-116534762 CAGGGTAAGGAGGAATGGGAAGG + Intergenic
1089876796 11:121730209-121730231 GAGGGTAAGGAAGAGAAGGAGGG - Intergenic
1090033582 11:123228922-123228944 CAGGGTCAGGATGAGAAGGCAGG - Intergenic
1090261777 11:125326447-125326469 TAGGGTCAGGCTGATTATGAAGG + Intronic
1090925728 11:131248773-131248795 CAGGGAAAGGTGGAATAGGAAGG - Intergenic
1091189657 11:133680481-133680503 CAGCTCAAGGCTGTGTAGGATGG - Intergenic
1091679570 12:2517174-2517196 CAGGGTAAGGCTGATTTGCCAGG - Intronic
1091860806 12:3781286-3781308 CAGTATAATGCTGAGTAGAAGGG + Intergenic
1093530033 12:20149715-20149737 CAGGGGAAGGCTGAGCATGGTGG + Intergenic
1095808815 12:46349990-46350012 AGGAGTAAGGCTGACTAGGAAGG + Intergenic
1097957910 12:65505632-65505654 CAGTGTAGGGCTGGGGAGGAGGG - Intergenic
1103851864 12:123938602-123938624 CAGCGTTAGGAGGAGTAGGATGG - Intronic
1107835236 13:44407567-44407589 AAAGGTAAGGCTCAGTAGGTGGG - Intergenic
1108780311 13:53822328-53822350 CAGGGTTAGGCTGAATAAGGAGG + Intergenic
1112278260 13:98040496-98040518 CAGGGTGGGGCTGAGTAGAGAGG - Intergenic
1113138099 13:107116401-107116423 CAGGGAAAGGGTGTGTATGAAGG - Intergenic
1113556614 13:111240700-111240722 CAGGGAAGGGCTGATTAGGTAGG + Intronic
1113665499 13:112138235-112138257 CAGAGTCAGGCTGAGTGGGCTGG + Intergenic
1114652450 14:24294298-24294320 CAGGGCGAGGCTGAGTATGGTGG + Intronic
1115362043 14:32514791-32514813 CTGGGAAAGGATAAGTAGGAGGG + Intronic
1115428960 14:33294027-33294049 CAGGACAAGGCTGAATAAGATGG + Intronic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1117569531 14:57032815-57032837 CATTGTAAGGCTGAGTTGGGAGG - Intergenic
1117740078 14:58808927-58808949 AAGGGCAAGGCTGACTAGAAAGG - Intergenic
1118494370 14:66293676-66293698 CAGGGTAAGGCAGAGAAAGGAGG + Intergenic
1119161114 14:72453187-72453209 CTGGGTCAGGCTGGGTAGGGGGG + Intronic
1119954044 14:78775938-78775960 CTGGGTAGGACAGAGTAGGATGG - Intronic
1120900429 14:89570546-89570568 CATGGAATAGCTGAGTAGGATGG + Intronic
1121243897 14:92449213-92449235 CAAGGTAAGGCTGAGCAGACAGG + Exonic
1121883374 14:97520216-97520238 CAGGGCAAGGCATAGTAGGTTGG - Intergenic
1122412598 14:101533600-101533622 CAGGGTGAGGCTGGGCAGGAGGG + Intergenic
1122506995 14:102238038-102238060 CAGTGCAAGAATGAGTAGGAAGG - Intronic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1124220609 15:27847083-27847105 AAGGGGATGGCTGAGAAGGAGGG - Intronic
1124694521 15:31852954-31852976 CAGGGACAGGCTGAGGAGGTGGG + Intronic
1124804436 15:32867327-32867349 CAGGGTGAGGCTGGGAAGGCAGG - Intronic
1124864914 15:33480057-33480079 CATGGTAAGACTGGGGAGGAGGG + Intronic
1125184324 15:36913157-36913179 CCGAGTAAGTCTGAGTTGGATGG - Intronic
1125347335 15:38731740-38731762 GAGGGAAAGGCTGAGCAGGTGGG - Intergenic
1125478291 15:40062557-40062579 CAGACTTAGGCTGAGGAGGAAGG + Intergenic
1128638008 15:69315537-69315559 GAAGGTAAGGCTGGGTAAGAAGG - Intronic
1129030556 15:72614931-72614953 AAGGGAAAGGCAGAGTGGGAAGG - Intergenic
1129209670 15:74060369-74060391 AAGGGAAAGGCAGAGTGGGAAGG + Intergenic
1130578581 15:85115226-85115248 CAGGCTAATGCTGGGAAGGATGG - Intronic
1130602154 15:85283491-85283513 GAGGGTAAGGAGGAGTGGGAGGG + Intergenic
1131017853 15:89072506-89072528 AAGGGGAAGGATGAGCAGGAGGG + Intergenic
1131017865 15:89072536-89072558 AAGGGGAAGGATGAGCAGGAGGG + Intergenic
1131079426 15:89522490-89522512 CAGAGTATGGGTGAGTAGGCAGG + Intergenic
1132689882 16:1177690-1177712 CAGGGAAGGGCTGGGCAGGATGG + Intronic
1132815204 16:1822539-1822561 GAGTGTCAGGCTGAGCAGGAAGG - Intronic
1133294091 16:4742107-4742129 CAGAGTGAGTCTGAGGAGGAGGG - Intronic
1133853164 16:9524981-9525003 AAGGGGAAGGCTGAGAAAGAAGG - Intergenic
1134301741 16:12997691-12997713 TAGGTTAAGGCTGGGTATGATGG - Intronic
1137886257 16:52106973-52106995 CATGGTAAGGCAATGTAGGATGG + Intergenic
1138231085 16:55336793-55336815 TTGGGTAGGGCTCAGTAGGAGGG + Intergenic
1139619464 16:68125541-68125563 CAGGGAAAGGCGCAGTAGGAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1141893479 16:86943555-86943577 CTGGGTAGGCCAGAGTAGGAGGG - Intergenic
1144177196 17:12718668-12718690 CAAGGGAAGGCTGTGTGGGATGG + Intronic
1144352516 17:14411487-14411509 CAAGGTAAAACTGAGTAGGGAGG - Intergenic
1145001187 17:19305861-19305883 GGGGGAGAGGCTGAGTAGGAAGG - Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146562663 17:33884608-33884630 TAGTGTAAGGCAGAGCAGGAGGG - Intronic
1146587204 17:34092477-34092499 CAAGGGAGGGCTGAGTGGGAGGG + Intronic
1146890256 17:36502096-36502118 CAGGGTAAGGCTGGGTGGGAGGG + Intronic
1147121792 17:38339398-38339420 CCAGGTAAGGATGAGGAGGATGG - Exonic
1147424458 17:40339376-40339398 AGGGATAAGGCTGAGCAGGATGG + Intronic
1149655312 17:58306736-58306758 CAGGGTCAGGTGGAGTTGGAAGG + Intronic
1150495810 17:65607095-65607117 CAGGGGACGTCTCAGTAGGAGGG + Intronic
1150674645 17:67234522-67234544 TAGAGTAAGGATGAGTATGATGG - Intronic
1151185008 17:72357433-72357455 CAGGGTAGGGCAGAGTAGAGAGG + Intergenic
1151904099 17:77036382-77036404 CAGGGGAAGGCTGGGCCGGAGGG - Intergenic
1153795261 18:8616141-8616163 CAGGGGAAGGTCGAGCAGGATGG - Intronic
1155287833 18:24309425-24309447 GAGGGAAAGGCTGAGGTGGAAGG - Intronic
1156106515 18:33669280-33669302 CAGGCTAAAGGTGAGAAGGATGG + Intronic
1157584331 18:48791520-48791542 CAGGCTGAGGCTGGGTGGGAGGG - Intronic
1157863900 18:51164933-51164955 CAGGGGAGAGCTGAGTGGGAGGG + Intergenic
1158755566 18:60320561-60320583 CAAGCTCTGGCTGAGTAGGAGGG + Intergenic
1159034742 18:63265922-63265944 AAGGGTGAGGCTAAGAAGGAAGG + Intronic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159551714 18:69902325-69902347 AAGGGTGAGGCCGAGCAGGATGG - Intronic
1159877219 18:73826622-73826644 CAGTGGAAGGCTGAGCAGCAGGG + Intergenic
1161066351 19:2240281-2240303 CAGGGTCAGGCTGAAAAGGGGGG - Intronic
1161587676 19:5114350-5114372 CAGGCCAAGGCAGAGCAGGAGGG - Intronic
1163361632 19:16850619-16850641 CAGGGGAAGGCGGAGTACGATGG + Intronic
1163388609 19:17015750-17015772 CAGGGCAAGGATGGGCAGGAGGG + Intronic
1163529519 19:17841602-17841624 CGGGGTAAGGCTGAAGGGGAGGG + Intronic
1163648615 19:18504204-18504226 AGGGGTGAGGCTGAGGAGGAGGG + Intronic
1163769257 19:19180723-19180745 CAGGATCAGGCTGAGGAGGGCGG + Exonic
1164417771 19:28060688-28060710 CAGGGCAGGGCCGAATAGGATGG - Intergenic
1165247233 19:34504737-34504759 CAGGGTGGGGCTGGGTGGGAGGG - Exonic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1167007539 19:46785704-46785726 CAGGTTAAGGTTCAGTAGTATGG + Intronic
1167284558 19:48591743-48591765 CAGGGTAAAGCGGGGCAGGAGGG + Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168122439 19:54259395-54259417 AAGGGGAGGGATGAGTAGGAAGG - Intronic
925033910 2:671962-671984 GAGGGAAAGGCTGAGCAGGGAGG + Intronic
925622564 2:5808065-5808087 CAGGGGCAGGCAGAGTTGGATGG - Intergenic
925742109 2:7015077-7015099 CAGCTTAAGGCTGAGTTTGAGGG + Intronic
926205307 2:10831213-10831235 AAGGGGAAGGCTAAGTAGGTGGG - Intronic
926326271 2:11786850-11786872 CAGGGCAAGGCTGAGGATGTTGG - Intronic
926458888 2:13102832-13102854 CAGGGTGAGGCTGAGTAATGGGG - Intergenic
926682429 2:15674113-15674135 CAGGGTGAGGCTGGGAAAGAAGG + Intergenic
927599934 2:24431906-24431928 CAAGGGAATGCTTAGTAGGAGGG - Intergenic
928082110 2:28320694-28320716 AGGGCTAAGGCTGAGCAGGAAGG - Intronic
928852057 2:35759879-35759901 CAGGGAAAGGCAGAGCAAGATGG - Intergenic
929451749 2:42042616-42042638 GCGGGTGAGGCTGAGTAGGAGGG + Intergenic
929832567 2:45358810-45358832 CAGGGTAAGGCTGATGGGGCAGG + Intergenic
931987140 2:67753270-67753292 CATAGTAAGGCTGAGTAAGAAGG + Intergenic
932587444 2:73040400-73040422 CAGGTTAAGGGTGGGAAGGATGG - Intronic
932872708 2:75419383-75419405 CAGGGTATGGCTTAGTAAGAAGG + Intergenic
934961031 2:98673189-98673211 CATTGTAAGGCTGAAGAGGAAGG - Intronic
937088224 2:119186206-119186228 CAGGGAAAGGCTGGTTGGGAGGG - Intergenic
937252236 2:120532270-120532292 AGGGGGAAGGCTGAGGAGGAGGG - Intergenic
937858671 2:126691322-126691344 CAGTGTAAGGCTGCTCAGGAGGG - Intronic
937940929 2:127285445-127285467 CAGGGTGAGGCTGAGGTGGGCGG + Intronic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
942994676 2:182246697-182246719 CAGGGTAAGGCTGGGCATGGTGG - Intronic
943318913 2:186423058-186423080 CAGGGCAAGGCTTAGTTGGATGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945509578 2:210684156-210684178 CAGGGCAAGGCTGAGGCTGAAGG - Intergenic
945986021 2:216354243-216354265 CAGGATTAGGCTGAGTAGGAAGG + Intronic
946189813 2:218002280-218002302 CAGGGGAGGGCTGTGGAGGAAGG + Intronic
946758547 2:222971189-222971211 CATGGGTAGGCCGAGTAGGAGGG + Intergenic
948223284 2:236290135-236290157 GAGGGGAAAGCTGGGTAGGATGG + Intergenic
948523288 2:238554997-238555019 CAGGGCAGGGCTGAGTAGCAGGG - Intergenic
948877503 2:240837507-240837529 CAGGGACAGGCTGAGGAGGTAGG - Intergenic
1168955912 20:1834243-1834265 GAGGCTAAGGCTGCGTGGGATGG - Intergenic
1169034698 20:2440058-2440080 CAGGGGAAAGCTGAGTTTGAAGG + Intergenic
1169491406 20:6074239-6074261 CTGGGCAAGGCTGGGAAGGAAGG + Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170652765 20:18257678-18257700 CAGGGTAAGGTTGGGCAGGGTGG + Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172523576 20:35584225-35584247 GAGGGTAAGGCTGGGCAGGTAGG - Intergenic
1173154984 20:40601101-40601123 CAGGTTAAGGCAGGGGAGGAGGG + Intergenic
1177244036 21:18498759-18498781 CAGAGCAAGGCTGAGAAGGATGG + Intergenic
1178120764 21:29467790-29467812 CAGGGTAGCACTGAGTTGGAAGG + Intronic
1178699387 21:34820237-34820259 CTGGGTGGGGCTGAGTAGAATGG + Intronic
1178874288 21:36400912-36400934 CAGGGTAAGGCAGTGTGGGCTGG + Intronic
1179568898 21:42266360-42266382 CAAGGTGAGTCTGATTAGGAGGG + Intronic
1181622966 22:24103456-24103478 CAGGGCCAGGCTATGTAGGACGG + Intronic
1181964592 22:26647633-26647655 CAGGGTAAGGCTGCAAGGGAAGG + Intergenic
1183354822 22:37352523-37352545 CAGGGTAAGGCCATATAGGAGGG + Intergenic
1184017184 22:41795152-41795174 CAGTGCAAGGTTGGGTAGGAGGG + Intronic
1184629480 22:45764313-45764335 CCTGGTAATGCTGAGCAGGAAGG - Intronic
1185230183 22:49675769-49675791 CAGGGTTAGGTTGGGTTGGATGG - Intergenic
950011315 3:9726048-9726070 CAGCGTGAGTCTGAGGAGGAGGG + Exonic
952371259 3:32724844-32724866 CAGAGTGAGGCTGGGTACGATGG - Intronic
952565472 3:34652376-34652398 CAGGGGAAGGATGAGCGGGACGG - Intergenic
953979227 3:47405428-47405450 CAGGCTAAGGCTGACTAGCAGGG - Intronic
954363550 3:50134710-50134732 CAGGCTAGGGCTGGGGAGGAGGG + Intergenic
954525645 3:51268365-51268387 TAGGGTAAGGCTGTGTGGAAAGG - Intronic
955863386 3:63356025-63356047 AAGGCCAAGGATGAGTAGGAGGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956145489 3:66187258-66187280 AAGGGTAAGGCTGTGTGTGAAGG - Intronic
956146612 3:66197331-66197353 CAGGGTAAGGGTGAGTGTCAAGG + Intronic
956623655 3:71246046-71246068 CAGGGCTAGGCTGATAAGGAGGG + Intronic
957585023 3:82122032-82122054 CTGAGAAAAGCTGAGTAGGAAGG - Intergenic
958867652 3:99519655-99519677 AAGGGGAAGGCAGAGGAGGAGGG + Intergenic
959209429 3:103358098-103358120 CATGGTAAGGGTGAGTTGAAAGG - Intergenic
959712492 3:109398935-109398957 GAGGGTGAGGCTAGGTAGGAAGG + Intergenic
962203371 3:133417072-133417094 GAGGGCAGGGCTGAGTAGAAGGG - Intronic
962378276 3:134876633-134876655 CAGGGAGAGGCTCAGTAGGCTGG + Intronic
962528276 3:136255232-136255254 CAGGGAGTGGCTGAGTAGAAGGG - Intronic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
963258344 3:143168924-143168946 CAGGGCAAGGCTGGGTGGGATGG + Intergenic
964004352 3:151810845-151810867 CAGTGCAAGAATGAGTAGGAGGG - Intergenic
965059950 3:163772904-163772926 AAGGGTAGGAATGAGTAGGAAGG - Intergenic
965079884 3:164021878-164021900 CAGTGCAAGAATGAGTAGGAGGG + Intergenic
967049447 3:185769205-185769227 CATGGGGAGGCTGAGGAGGATGG + Intronic
968681558 4:1924344-1924366 CAGGGTAAGGCGGTGTCGGGTGG + Intronic
969603322 4:8189566-8189588 CAGGGTGAGGCTGGCAAGGATGG + Intronic
975102238 4:70526913-70526935 CAGGGAAAGGCAGGGTTGGAGGG - Intronic
976858505 4:89632570-89632592 AAGAGTAAGGATGAGTGGGATGG + Intergenic
977995912 4:103497149-103497171 CAGGTCAAGGCTGGGTAGGGAGG + Intergenic
981068014 4:140505902-140505924 GAGGGTAATGCTGACTAGGGTGG + Intergenic
982285113 4:153725930-153725952 CAGTGTAAGTCTGGGTAGCAAGG - Intronic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
988586028 5:32508255-32508277 CAGTCTGAGGCTGAGTAGGATGG + Intergenic
989704637 5:44314113-44314135 CAGGGGAAGGCTGGGAAGGGTGG + Intronic
990088887 5:52015680-52015702 TAGGGTGAGGCAAAGTAGGAGGG - Intronic
990751297 5:59019616-59019638 CTGGATAAGGCAGGGTAGGATGG - Intronic
991392867 5:66167157-66167179 CAGGGAAAGGCTGTGGGGGAGGG - Intronic
993386517 5:87268421-87268443 CAGGGTAGGGCAGAGTAGAGCGG + Exonic
993774981 5:91982424-91982446 CAGGGAAAGGATGAGAAGGTGGG - Intergenic
995216822 5:109604915-109604937 CAGGTTATGGCTGAGTGTGATGG + Intergenic
997356018 5:133263442-133263464 GAGGGTAGGGCTGAGGAAGAAGG + Intronic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
1001313043 5:170624817-170624839 CAGGGTAAGGATGGTGAGGAAGG - Intronic
1001857721 5:175027230-175027252 CAGTGTAAGGCATTGTAGGAAGG - Intergenic
1002447439 5:179298021-179298043 CAGAGAGAGGCTGAGCAGGAGGG - Intronic
1003087706 6:3074189-3074211 CACGGTGAGGCTGAGTGGGCAGG - Intronic
1003611255 6:7616808-7616830 CAGAGAAAGGCTGTTTAGGATGG - Intergenic
1004022389 6:11787421-11787443 CAGTGCAAGAATGAGTAGGAGGG - Intronic
1004619892 6:17323122-17323144 CAGTGCAAGAATGAGTAGGAGGG + Intergenic
1005871016 6:29974627-29974649 GAGGGTGAGGCTGAGGATGAAGG + Intergenic
1006058906 6:31404828-31404850 GAGGGTGAGGCTGAGGATGAAGG - Intronic
1006071390 6:31499713-31499735 GAGGGTGAGGCTGAGGATGAAGG - Intronic
1006151232 6:31991318-31991340 GAGGGGAAGGATGAGTAGGGAGG + Intronic
1006157533 6:32024056-32024078 GAGGGGAAGGATGAGTAGGGAGG + Intronic
1006313639 6:33278035-33278057 CAGAGAGAGGCTGAGCAGGAAGG + Exonic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1011626797 6:89289689-89289711 AAGGGGAAGGGTGAGGAGGAGGG + Intronic
1012179121 6:96128879-96128901 CTTTGAAAGGCTGAGTAGGAAGG + Intronic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1017541585 6:155408422-155408444 CAGGGTCAGGATGAGTCAGAGGG - Intronic
1020122602 7:5513518-5513540 CAGGGTCAGGATGGGAAGGACGG + Intronic
1020787691 7:12591147-12591169 CAGTGGAAGAATGAGTAGGAAGG + Intronic
1020958479 7:14772876-14772898 AAGGGGAAGGATGAGCAGGAGGG - Intronic
1020999772 7:15314171-15314193 CGGGGTGAGACTGAGCAGGAGGG + Intronic
1021859081 7:24887887-24887909 AAGGGCAAGGCTTAGCAGGATGG + Intronic
1021895783 7:25234371-25234393 TTGTGTAAGGCTGATTAGGAAGG + Intergenic
1022183048 7:27940320-27940342 CAGGGTAAGGCTGATCACGGGGG - Intronic
1022565412 7:31395149-31395171 AAGGGAAAGGATGAGTAGGGTGG + Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1027184874 7:75965075-75965097 CTGGGGAAGCCTGTGTAGGATGG + Intronic
1032101708 7:128984966-128984988 AAGAGGGAGGCTGAGTAGGAAGG - Intronic
1032219037 7:129979992-129980014 CTGGGTAAGGCTGAGGCGGGCGG + Intergenic
1033453462 7:141481886-141481908 CCGGGCAGGGGTGAGTAGGATGG + Intergenic
1033579904 7:142723250-142723272 CAAGGTGAGGCTGTGTTGGAGGG - Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034776543 7:153832603-153832625 CAGTGGAAGTCTGAATAGGATGG + Intergenic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035186315 7:157128753-157128775 CACGGTACGGCTGAGTTGAAGGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1039471066 8:37814144-37814166 CAGAGAAAGGCTGAGTGGGTGGG + Intronic
1040499364 8:47993385-47993407 CAGTGCAAGAATGAGTAGGAGGG + Intergenic
1045111406 8:98941440-98941462 CAGTGGAAGGCTGAGGAGAAGGG + Intronic
1047138299 8:122106774-122106796 AAGGGGAAGGAAGAGTAGGAGGG - Intergenic
1047975585 8:130127151-130127173 GAAGGTGTGGCTGAGTAGGAAGG + Intronic
1048995194 8:139789742-139789764 CAGGGGAAGGCCAGGTAGGAGGG + Intronic
1049155460 8:141063588-141063610 GAGGTCAAGGCTGAGGAGGAAGG + Intergenic
1049706559 8:144045865-144045887 CAGCGGCAGGCTGAGTGGGAGGG + Intronic
1050137521 9:2482431-2482453 CTGGGTAAGGCTGAATATGAAGG + Intergenic
1051739948 9:20241728-20241750 CAGCCTAAGGCTGAGTAGAGAGG + Intergenic
1051995306 9:23208768-23208790 CAGGGTAAGTCTCATTAAGAAGG + Intergenic
1053618649 9:39794394-39794416 CAGGGTAAGGTGGGGTGGGAAGG - Intergenic
1054265506 9:62913035-62913057 CAGGGTAAGGTGGGGTGGGAAGG + Intergenic
1055454405 9:76459350-76459372 TGGGGGAAGGCTGAGAAGGATGG + Intronic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1056801220 9:89693397-89693419 CAGTGTGAGGTTGAGTAAGATGG + Intergenic
1057006571 9:91566033-91566055 CCGGGTAAGGCAGAGAAGCATGG - Intronic
1057281329 9:93713751-93713773 CAGGGACAGGGTGAGAAGGAAGG - Intergenic
1057392471 9:94651265-94651287 CAGGGTTTGGCTTAGGAGGAGGG - Intergenic
1059153139 9:111967043-111967065 AAGAGTAAGGCTCAGAAGGAAGG + Intergenic
1059929663 9:119248465-119248487 ATGGGTAAGGCTGAGCAGGGTGG + Intronic
1060290874 9:122301299-122301321 CTGGGTAAGGCAGAGCAGGGTGG + Intronic
1060892800 9:127199205-127199227 TGGGGCAGGGCTGAGTAGGAGGG + Intronic
1060979356 9:127783855-127783877 GAAGGTCAGGCTGAGGAGGAAGG - Intergenic
1061057830 9:128233631-128233653 CAGGGTAGCCCTGAGTATGAGGG + Intronic
1061645688 9:131999219-131999241 CAGGGTAAGAGAGAGTTGGAAGG + Intronic
1061669270 9:132179488-132179510 GAGGGCAAGGCCGGGTAGGATGG + Intronic
1061860807 9:133467935-133467957 CAGGGTCAGGCTGATGACGATGG - Exonic
1061975548 9:134066663-134066685 CAGGGTAGGGCGGGGGAGGACGG + Intronic
1062382346 9:136292476-136292498 CAGGGCAAGGCTGAGTCTCAGGG + Intronic
1185868855 X:3646451-3646473 CATGGTAGGGCTCAGGAGGAAGG + Intronic
1188348168 X:29093943-29093965 CAGGGAAAGGCTGGGCAAGAAGG - Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190732991 X:53236721-53236743 GAAGGGAAGGCTGAGCAGGAAGG - Intronic
1191254002 X:58272030-58272052 CAGGGTGAGGTTGAGCAGGCTGG - Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191778971 X:64846737-64846759 CAGTGCAAGAATGAGTAGGAGGG - Intergenic
1192238434 X:69311395-69311417 AAGGGTTAGGCTTAGTTGGAAGG + Intergenic
1192304371 X:69943896-69943918 AAGGGTAAGGAAGAGTGGGAAGG - Intronic
1193699146 X:84741931-84741953 CAGTGCAAGAATGAGTAGGAGGG - Intergenic
1194873948 X:99163867-99163889 CAGGCTAAGGGAGAGTAGGGAGG + Intergenic
1196193649 X:112818679-112818701 CGGGGTAAGGGAGAGTTGGAGGG + Intronic
1200951866 Y:8905305-8905327 CGGGGGAAGGCTGGGGAGGATGG + Intergenic
1201542913 Y:15128194-15128216 CCAGGTAAGGCTGATTAGGCTGG + Intergenic