ID: 904670493

View in Genome Browser
Species Human (GRCh38)
Location 1:32161261-32161283
Sequence CTAGTCCTGCCTCTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904670493_904670501 29 Left 904670493 1:32161261-32161283 CCAGGGGAGAGAGGCAGGACTAG 0: 1
1: 0
2: 1
3: 40
4: 380
Right 904670501 1:32161313-32161335 AAAATGCATTGATTTGTTATGGG 0: 1
1: 0
2: 1
3: 54
4: 533
904670493_904670500 28 Left 904670493 1:32161261-32161283 CCAGGGGAGAGAGGCAGGACTAG 0: 1
1: 0
2: 1
3: 40
4: 380
Right 904670500 1:32161312-32161334 CAAAATGCATTGATTTGTTATGG 0: 1
1: 0
2: 3
3: 55
4: 578
904670493_904670502 30 Left 904670493 1:32161261-32161283 CCAGGGGAGAGAGGCAGGACTAG 0: 1
1: 0
2: 1
3: 40
4: 380
Right 904670502 1:32161314-32161336 AAATGCATTGATTTGTTATGGGG 0: 1
1: 0
2: 3
3: 34
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904670493 Original CRISPR CTAGTCCTGCCTCTCTCCCC TGG (reversed) Intronic
900541333 1:3204518-3204540 CTAGCCCTGCCCCTGTCCCAGGG + Intronic
900603882 1:3515351-3515373 CTTGTCCTGCCTCCACCCCCAGG + Intronic
901136672 1:7001503-7001525 TCAGTCCTGCTTCTGTCCCCTGG + Intronic
901328056 1:8380985-8381007 CATGTCCTGCCTCTGACCCCAGG + Intronic
901819911 1:11822054-11822076 GTTTTCCTTCCTCTCTCCCCTGG - Intronic
902383766 1:16065022-16065044 CTTCTCCACCCTCTCTCCCCAGG + Intronic
903262737 1:22140063-22140085 ATAGTCCTGGCTCTCGCCACTGG + Intronic
903788221 1:25875329-25875351 CGCGTCCTGCCTGTCTTCCCCGG + Intergenic
904670493 1:32161261-32161283 CTAGTCCTGCCTCTCTCCCCTGG - Intronic
906259112 1:44372974-44372996 CTACTCCTGCTTCTATCCCTTGG - Intergenic
906525861 1:46492987-46493009 CTATTCCCGCCACTCTCTCCAGG + Intergenic
907069103 1:51518656-51518678 CCAGACCTGCCTTTCTCCCAGGG - Intronic
907980868 1:59479469-59479491 CTAATCCTGCCTGTCTTCTCTGG - Intronic
908415403 1:63908733-63908755 CTTGTACTACCTCACTCCCCAGG + Intronic
909726579 1:78843370-78843392 TTCGTCCTGCCTCTGTCCTCTGG - Intergenic
909739965 1:79015851-79015873 CTTGTCCTGCCTAACTGCCCTGG + Intergenic
910084835 1:83387801-83387823 CCATTCCTGCCCCCCTCCCCAGG - Intergenic
912466801 1:109880127-109880149 CTACTCCCACCACTCTCCCCTGG - Intergenic
912497111 1:110098734-110098756 CTGGCCCTGCCTCTCCCCTCTGG - Intergenic
914880867 1:151545754-151545776 GTAGGCCTTCCTCTCACCCCTGG - Intronic
915022687 1:152796568-152796590 CCTCACCTGCCTCTCTCCCCAGG - Intronic
915953316 1:160204682-160204704 CTAGCTCTGCCCCTCTGCCCAGG - Intergenic
919841179 1:201610582-201610604 CATGTCCTGCCTCTGTCCGCAGG + Intergenic
920057144 1:203201098-203201120 ACAGACCTGCCTCTCTCCCCGGG - Intergenic
920339840 1:205268928-205268950 CTCTGCCTGCCTCTTTCCCCAGG + Exonic
922692586 1:227706628-227706650 CAAGTCCTGCCACTCTTCCCAGG + Intergenic
923238854 1:232061146-232061168 CTGTTGCTCCCTCTCTCCCCAGG + Intergenic
923448715 1:234096619-234096641 CCAGTCTTGCCTCTCACCACTGG - Intronic
923519046 1:234721909-234721931 CTAGGCCTGCCGCTCCCCCGTGG - Intergenic
923564625 1:235067657-235067679 CTAGTCCTCTCTCTTGCCCCAGG - Intergenic
1063578307 10:7281630-7281652 GTAGTACAGCCTCTCTTCCCAGG + Intronic
1064162582 10:12958906-12958928 TTAGAACTGCGTCTCTCCCCTGG - Intronic
1064352845 10:14592524-14592546 CTAATCCTGCATTTCTACCCAGG + Intronic
1065022242 10:21510054-21510076 CTGGCCCTGCCGCTCGCCCCGGG + Intergenic
1067355382 10:45519801-45519823 TTTGTCCTTCCTCTCTGCCCTGG - Intronic
1067951215 10:50739837-50739859 CTAGTCTTCCAGCTCTCCCCTGG + Intronic
1070432319 10:76353197-76353219 CTTGTCCTGCCTTTATCCTCTGG - Intronic
1070471951 10:76789396-76789418 CTTGTCCTGCATCTTTCTCCCGG - Intergenic
1070729215 10:78813769-78813791 CTTCCCCTTCCTCTCTCCCCTGG + Intergenic
1070785965 10:79162385-79162407 CCAGACCTGCCCCTCTCCCCGGG - Intronic
1070961002 10:80500132-80500154 CTAGTCCTCCCTCAATCTCCTGG + Intronic
1073318574 10:102600003-102600025 TTCTTCCTGCCTCTCTTCCCTGG + Intronic
1073488986 10:103840118-103840140 CCAGTCCTTCCTCTCTTCCCTGG - Intronic
1074559426 10:114521903-114521925 CTAGGCCATCTTCTCTCCCCTGG - Intronic
1074696628 10:116055698-116055720 CTAGTCCTGCCCCTCCCCACGGG + Intergenic
1075092911 10:119453459-119453481 CTGGCCCTGCCCTTCTCCCCGGG - Intronic
1075375358 10:121974573-121974595 CGCGTCCTGCCTCTCCCCACTGG + Intronic
1076150597 10:128159268-128159290 CCAGTCCCCCCTCACTCCCCTGG - Intergenic
1076369308 10:129941467-129941489 CTAGTCTTGGCACTGTCCCCGGG - Intronic
1077095453 11:797198-797220 CCAGGCCTGCCTCTCCGCCCTGG - Intronic
1077830887 11:5868840-5868862 CTTCTCCTGCCTCACTGCCCTGG + Intronic
1078308508 11:10215154-10215176 CATATCCTTCCTCTCTCCCCAGG + Intronic
1078345095 11:10540977-10540999 CTAGCCCCGCCGCCCTCCCCGGG - Intronic
1078579852 11:12530542-12530564 CTAAGCCTCCCTCTCTCCTCCGG + Exonic
1080577093 11:33609727-33609749 CTGAGACTGCCTCTCTCCCCAGG + Exonic
1082659992 11:55897920-55897942 CTTGTCCTGCCTCATTGCCCTGG + Intergenic
1083327214 11:61878847-61878869 CTGACCCTGCCTCTCTCCCCAGG - Exonic
1083801969 11:65052159-65052181 CTTGTCCTCCCTCTTGCCCCTGG + Intronic
1083935624 11:65868427-65868449 CGATTCCAGCCCCTCTCCCCTGG - Intronic
1084062931 11:66687594-66687616 CCGGGTCTGCCTCTCTCCCCGGG + Exonic
1084518484 11:69648939-69648961 CTAGTGGTGCCTCTGTCCCGGGG + Intronic
1084583381 11:70038662-70038684 TAAGTCCTGGCTCTCTCCCTGGG - Intergenic
1084724058 11:70928842-70928864 ATCTTCCTGCCTCTCTCCTCTGG - Intronic
1084824368 11:71718264-71718286 CTTCTCCTGCCTCTATGCCCAGG - Intergenic
1084901880 11:72315829-72315851 CTAGATCTGCCTCACTCTCCTGG + Intronic
1084935009 11:72582249-72582271 CCAGTCCAGCCTCTAGCCCCTGG + Intronic
1087912373 11:103768603-103768625 CATGACCTGCCTCTCTCTCCAGG + Intergenic
1091926131 12:4351355-4351377 CTGGTCCAGCGTCTCTCCTCCGG - Exonic
1092706859 12:11294359-11294381 CTTGTCCTGCCTCGTTGCCCTGG - Intergenic
1093395379 12:18674895-18674917 CTAGTCTTCTCTCTCTCCCCAGG - Intergenic
1093458405 12:19386522-19386544 TTGGCCCTGCCTCTGTCCCCAGG + Intergenic
1095729923 12:45495162-45495184 CTACTGCAGCCTCTCTCTCCTGG - Intergenic
1096463553 12:51836175-51836197 CTAGCCCATCCTCCCTCCCCTGG - Intergenic
1096971055 12:55666743-55666765 CGAGTCCTGCCTCTTACCTCGGG - Intergenic
1097736901 12:63192549-63192571 CTTGTCCTCCATCTGTCCCCTGG - Intergenic
1097950166 12:65418938-65418960 CTGGTGCTGCCCCTCTGCCCGGG + Intronic
1098859712 12:75694418-75694440 ATTGTCCTTCCTCTGTCCCCTGG + Intergenic
1100461172 12:94800727-94800749 TTGGTCCTGCCTCTCTCCTCGGG + Intergenic
1102013090 12:109631052-109631074 CTGTTCCTGCCCCTCTTCCCGGG + Intergenic
1102353911 12:112216291-112216313 TTAGACGTGACTCTCTCCCCCGG - Exonic
1102758514 12:115365091-115365113 CTGCTCCTGCCTCACTCTCCAGG + Intergenic
1103267461 12:119643148-119643170 CTAGTCCAGCATCAGTCCCCAGG + Intergenic
1103465693 12:121140263-121140285 CTGCTCCCTCCTCTCTCCCCAGG - Intronic
1104165965 12:126230050-126230072 CTCGTCCTACATCTCTCCACCGG - Intergenic
1105445125 13:20447382-20447404 CTTTTCCTGCCTCTCCCCCAGGG - Intronic
1105871243 13:24507468-24507490 CTAGGCCTCCCTCTCCCCCTTGG + Intronic
1106835762 13:33633807-33633829 CCAGTCTTGCCTCTCTGCCCAGG + Intergenic
1106837822 13:33654987-33655009 CTAGTCCCGTCCCTCACCCCTGG + Intergenic
1108406080 13:50103655-50103677 CTCCTCTTACCTCTCTCCCCAGG + Intronic
1110706463 13:78605488-78605510 CTAGTCCTTCCTGACACCCCTGG + Intergenic
1111241160 13:85476599-85476621 CTAAGACTGCCTTTCTCCCCAGG + Intergenic
1111497461 13:89070860-89070882 CTATTCCTGCTTCTGTCCCTTGG - Intergenic
1115224067 14:31085359-31085381 CTGCTCTTGCTTCTCTCCCCAGG - Exonic
1116335000 14:43646207-43646229 CAAGTCCTGTCTCTGTCTCCTGG + Intergenic
1118966920 14:70595591-70595613 CTGGTGCTGCCTCTCTGCCCCGG - Intronic
1119442386 14:74637087-74637109 CCCGTCCTGCCTGTCTGCCCTGG - Intergenic
1119442928 14:74640879-74640901 CTAATCCTGGCCCTATCCCCAGG - Intergenic
1121002942 14:90465095-90465117 CTCTTCCTGCCTCTCGCCCTGGG - Intergenic
1121180080 14:91922377-91922399 CTAGGCCTGCCTTCCTCCCTGGG + Intronic
1121551508 14:94806022-94806044 TTAGTCCCTCCTTTCTCCCCTGG - Intergenic
1121552790 14:94814978-94815000 TTACTCCTGTCTCTCTCTCCAGG + Intergenic
1122177967 14:99934984-99935006 CCCTTCCTGCCTCTCTTCCCAGG - Intronic
1122531013 14:102426992-102427014 CTAGTTCTGCCCCCCACCCCGGG - Intronic
1122855110 14:104556406-104556428 CCAGCCCTGCCCCTCACCCCAGG + Intronic
1122884026 14:104702615-104702637 CTACACCTGCCTCTGTCCCCTGG - Intronic
1122936255 14:104957729-104957751 ACAGTCCTGGCTCCCTCCCCCGG - Intronic
1124374102 15:29119873-29119895 CTAGCCAGGGCTCTCTCCCCGGG - Intergenic
1124411396 15:29440652-29440674 CCCGTCCTGCCTCTCACCACAGG + Intronic
1124641281 15:31398062-31398084 CTAGGCCTGCGTCTCTGCTCAGG + Intronic
1125112673 15:36051376-36051398 TTACTGCTCCCTCTCTCCCCTGG - Intergenic
1125684767 15:41557930-41557952 CTGGTCCCTCCTCTCTACCCAGG + Intronic
1126184032 15:45813158-45813180 CATGTCATGCCACTCTCCCCTGG - Intergenic
1127259950 15:57320122-57320144 CTGCTCCTGCCACCCTCCCCTGG - Intergenic
1129393200 15:75230895-75230917 CTCTTCCTGCCTCTGTCCCCAGG + Intergenic
1130383243 15:83390145-83390167 CTTTTCCTGCCTCTCTTCTCTGG + Intergenic
1130682260 15:86006980-86007002 CTAGGCCTCTCTCTCTCCCCTGG + Intergenic
1130979785 15:88804404-88804426 CAGGTTCTGCCACTCTCCCCTGG - Intronic
1131302206 15:91209673-91209695 CTAGCTCTGCCTCTCTCCAGGGG + Intronic
1132198701 15:99933010-99933032 CTATTCCTCCCTCTCTTCTCTGG + Intergenic
1133484481 16:6206167-6206189 CCTCTCTTGCCTCTCTCCCCTGG + Intronic
1133569351 16:7025940-7025962 CTAGACCTGGCTCTCTTTCCAGG - Intronic
1133723040 16:8512723-8512745 CTCCTCCAGCCTCTCACCCCAGG + Intergenic
1134001487 16:10786411-10786433 CAAGTTCTCCCTCTGTCCCCAGG - Intronic
1134068455 16:11245589-11245611 CTAGGCCTTCCTAGCTCCCCAGG - Intergenic
1135016188 16:18926495-18926517 CAGGACCCGCCTCTCTCCCCAGG - Intergenic
1135112933 16:19704774-19704796 CTTGTCCTGCCTTTCTTTCCTGG - Exonic
1135437167 16:22436944-22436966 CAGGACCCGCCTCTCTCCCCAGG + Intronic
1135794732 16:25431016-25431038 CTGTTCTTGCCTCTCTGCCCCGG - Intergenic
1135946645 16:26870764-26870786 CTCGTGCTCCCTCTCTCGCCAGG + Intergenic
1136333280 16:29595428-29595450 CAGGACCCGCCTCTCTCCCCAGG - Intergenic
1136447964 16:30335459-30335481 CAGGACCCGCCTCTCTCCCCAGG - Intergenic
1136537730 16:30910339-30910361 CTGCTCCTGCCCCTCTCCCCAGG - Intergenic
1137675957 16:50304024-50304046 CAAGCCCTGCCTCTCTCCCTGGG + Intronic
1137696454 16:50465206-50465228 ATTGTCTTGCCTGTCTCCCCTGG + Intergenic
1137891098 16:52162725-52162747 TAAGTTCTGCCTCTCTCCCTGGG + Intergenic
1138054332 16:53816294-53816316 CTGGTTCTGCCTCCTTCCCCTGG + Intronic
1138247916 16:55480608-55480630 CCTGGCCTGCCTCTCTCCTCAGG - Intronic
1141466100 16:84206724-84206746 CTAGTCCTGACACTCTCCCAGGG + Intergenic
1141644958 16:85362405-85362427 CCAGTGCTGCTTCTCTCCCAAGG - Intergenic
1141921904 16:87141056-87141078 TTCCTGCTGCCTCTCTCCCCGGG + Intronic
1142903375 17:3026922-3026944 CTCACCCTGCCTCTCTCCTCAGG + Exonic
1143524471 17:7464001-7464023 CTTGTGCTGCCTCCCTCACCAGG + Intronic
1143852348 17:9822261-9822283 CTGGCCCTGCCATTCTCCCCAGG + Intronic
1144589766 17:16514234-16514256 CTTGTCCAGCTTCTCTTCCCAGG + Intergenic
1145042207 17:19585362-19585384 TTAGTCATGCCCCTCTGCCCTGG + Intergenic
1145871354 17:28276268-28276290 CTAGTGCTGTCCCTCTGCCCGGG + Intergenic
1145975476 17:28981571-28981593 GTAGTGCTGGCTATCTCCCCTGG + Exonic
1146271851 17:31489904-31489926 CTAGTCCCGCCCCTCGCCTCCGG - Intronic
1146695988 17:34909498-34909520 CTTGTCCTGCCTGTCTCCCTGGG - Intergenic
1148128563 17:45248951-45248973 CTAGTCCTGCCTCTAGCCAAGGG + Intergenic
1148821210 17:50360732-50360754 CTGGGCCTGCCTCACTCTCCAGG + Exonic
1149671573 17:58417569-58417591 CTAGCTCTGACTCCCTCCCCTGG + Intronic
1151675395 17:75594916-75594938 CCAATGCTGCCTCCCTCCCCTGG - Intergenic
1152022183 17:77785867-77785889 CTCGGCCAGCTTCTCTCCCCTGG - Intergenic
1152704011 17:81833571-81833593 CTAGGCCTGGCTTTGTCCCCAGG - Exonic
1152822762 17:82445606-82445628 CTGCTCCTCCCACTCTCCCCAGG + Intronic
1154063840 18:11088176-11088198 CTATTCATTCCTGTCTCCCCAGG + Intronic
1155415033 18:25588858-25588880 ATAATCCTGTCTCTCTCCCAGGG + Intergenic
1156460096 18:37316780-37316802 CTAGCCCTGCCTCCCTCACCTGG + Intronic
1157325115 18:46663355-46663377 CTCCTCCTGCCTCTCTCACTGGG + Intergenic
1157818486 18:50748499-50748521 CTAGACCTGCCTCCCTCTCCTGG + Intergenic
1157957858 18:52118914-52118936 CTGCTGCTGCCTCTCTCACCAGG + Intergenic
1160024457 18:75206944-75206966 CTGGCTGTGCCTCTCTCCCCAGG + Intronic
1162320243 19:9967287-9967309 ATAGTCCTTGCTCTCCCCCCAGG + Intronic
1162480248 19:10923420-10923442 CTGGCCCTGCCTCTGACCCCAGG - Intronic
1162921590 19:13906377-13906399 CTTGCCCTGCCTCCTTCCCCGGG - Exonic
1163466248 19:17470040-17470062 CTGGTCCTGCCTCTACCCCGTGG - Intronic
1163484274 19:17576942-17576964 CCAGTCCTGCCTCTCAGCCCTGG - Intronic
1163570035 19:18075848-18075870 AGAGTCCTGCCTCTGCCCCCTGG - Exonic
1163728981 19:18939049-18939071 ATAGTCCCTCCTCTCTCCCTAGG - Exonic
1164816922 19:31211491-31211513 CCAGTCCTGCCTTCTTCCCCGGG - Intergenic
1164860666 19:31559850-31559872 CTGGTCCTGCCTTTCTCACTCGG + Intergenic
1165746236 19:38231269-38231291 CGGGTCCTTGCTCTCTCCCCAGG - Intergenic
1165781124 19:38434822-38434844 CTAGCCCCGCCCCTCCCCCCGGG + Intronic
1166049834 19:40252125-40252147 CAACCCCTGCCTCCCTCCCCAGG + Intronic
1166354086 19:42217010-42217032 CTTGTTCCGCCTCCCTCCCCCGG - Exonic
1166684868 19:44790255-44790277 CTCCTCCTGCCTCTTTCCCAGGG + Intronic
1167050475 19:47075006-47075028 CTAGTCCTGCCCCTCTGCCCAGG + Intronic
1167163175 19:47780674-47780696 CCACTTCTCCCTCTCTCCCCTGG + Intronic
1167419240 19:49393550-49393572 CTGGCCCAGCCTCTCTCCCAGGG - Intronic
1167751884 19:51385807-51385829 ATCGTCCTGCCTCTCTCTCAGGG + Intronic
1167791762 19:51687939-51687961 CCACCCCTTCCTCTCTCCCCAGG + Intergenic
1168111523 19:54194281-54194303 AGAGTCCTTCCTTTCTCCCCAGG - Exonic
925130153 2:1488780-1488802 CTGGGCCTTCCTCTGTCCCCTGG + Intronic
925629206 2:5871667-5871689 CAATTCCAACCTCTCTCCCCCGG + Intergenic
926299081 2:11589406-11589428 CCTGGCCTCCCTCTCTCCCCAGG - Intronic
927688670 2:25191650-25191672 CATCTCCTGCCTCTCTCCCTTGG - Intergenic
927786324 2:25977707-25977729 CCAGTCCTGCCTATTTCCCAGGG - Intronic
927998869 2:27506162-27506184 CTGGACCTGCCTCCCTCTCCAGG + Intronic
929320486 2:40538192-40538214 CTAGCCCTGCCTATCTCACAGGG - Intronic
930304912 2:49665666-49665688 GGAGTCCAGCCTCTCTTCCCTGG - Intergenic
930778513 2:55198839-55198861 CATGTCCTGCCACTCTCTCCTGG - Intronic
931425136 2:62163991-62164013 CTGTTCCTGCCTTTCACCCCAGG - Intergenic
931451411 2:62370294-62370316 CTGGCCCTGTCTGTCTCCCCAGG - Intergenic
932309438 2:70727947-70727969 CTTATCCTGTCTCTCTTCCCTGG - Intronic
932440030 2:71728884-71728906 CCAGCCCAGCCCCTCTCCCCAGG + Intergenic
932516143 2:72351720-72351742 CTAGTCTTGCCTCTCTCCTATGG + Intronic
933902443 2:86859729-86859751 CAACTCCTGCATCTCTGCCCTGG - Intronic
934921777 2:98349616-98349638 CCAGGCCTTTCTCTCTCCCCAGG - Intronic
935032744 2:99337790-99337812 CCAGTCGAGCCTCGCTCCCCCGG + Intronic
935117647 2:100150605-100150627 CTATTCCTGGCTCTCTCCGCTGG - Intergenic
935778104 2:106489539-106489561 CAACTCCTGCGTCTCTGCCCTGG + Intergenic
937042114 2:118830694-118830716 CCAGTTCTGAATCTCTCCCCAGG + Intergenic
937096285 2:119237340-119237362 CTCTTACTTCCTCTCTCCCCAGG - Intronic
938997522 2:136696266-136696288 CTCCTCTTGTCTCTCTCCCCTGG - Intergenic
939467905 2:142581823-142581845 CCAGCTCTGCCTCTCTCCCCAGG + Intergenic
940356985 2:152754219-152754241 TTCCTCCTGCCTCTATCCCCTGG + Intronic
941850904 2:170179066-170179088 CCAGTCCTGAGTGTCTCCCCTGG + Intronic
941916205 2:170815624-170815646 GTGGTCCTCCCCCTCTCCCCAGG - Intronic
942427796 2:175877608-175877630 CAAGTGCTTCCACTCTCCCCAGG - Intergenic
942487992 2:176459306-176459328 CTTCTCCTGCCTCTCTCACCTGG - Intergenic
945036045 2:205704812-205704834 CTTGTTCTGCCTCTCCACCCTGG + Intronic
946154206 2:217796486-217796508 CTAGGACTGCTTCTCTCCCATGG + Intergenic
947712569 2:232324492-232324514 CTGGTCCTGCCCCTCTGCCCCGG + Intronic
947731533 2:232434172-232434194 CTGGTCCTGCTCCTCTGCCCCGG + Intergenic
947911379 2:233803071-233803093 CCACTCCTGACTCTCTCCACAGG - Intronic
948098373 2:235354528-235354550 CCAGCCCTGCCTCCCACCCCTGG + Intergenic
948330431 2:237160395-237160417 CTCCTCCTCCCTCACTCCCCTGG - Intergenic
949000465 2:241610229-241610251 CAAGTCCTGCCTCTGCTCCCGGG + Intronic
1169130415 20:3163932-3163954 CTTGTCCTGCCAATCTGCCCAGG + Exonic
1169211880 20:3770343-3770365 CTTGTCCTGCCTCTGTCTCCAGG - Intergenic
1170180997 20:13529990-13530012 CTAGTCCTGCCTCTGCTCTCTGG + Intronic
1171280251 20:23890147-23890169 CTGTTCCTGCAGCTCTCCCCAGG + Intergenic
1172049775 20:32108342-32108364 CTGGGCCTCCCTCTCTCTCCAGG + Intergenic
1172204832 20:33155875-33155897 CCAGTCCTGCCTCCCTCTTCAGG + Intergenic
1172943712 20:38672361-38672383 CCAGTTCTGCCACTCCCCCCAGG + Intergenic
1173789333 20:45817498-45817520 CTTGGGCTGCCTCTTTCCCCTGG + Intergenic
1174152523 20:48495511-48495533 CCAGACTTGCCTCTTTCCCCTGG - Intergenic
1174194081 20:48760636-48760658 CTAGTCCAGCCTCCCTCTCCTGG - Intronic
1175318563 20:58069620-58069642 CAAGTCCTGCCTGTCTGCCCAGG + Intergenic
1175918125 20:62437021-62437043 CTCCTGCTGCCCCTCTCCCCTGG + Intergenic
1176045658 20:63091329-63091351 CGAGGCCTGCCTCTGTCCACAGG - Intergenic
1177387309 21:20425164-20425186 CTGGTGCTGCCCCTCTGCCCAGG + Intergenic
1179801836 21:43814893-43814915 CTACTCCTGCCTCTCGCCTCAGG + Intergenic
1180183724 21:46129388-46129410 CCAGTCCTGCCGCTCTACCCCGG - Intronic
1180710029 22:17833153-17833175 CCTGTCCTGCCTCCCTCCACAGG - Intronic
1181037528 22:20177128-20177150 CCAGGCCTGGCTCCCTCCCCAGG - Intergenic
1181162001 22:20965025-20965047 CTCGGCCTGCCCCTGTCCCCCGG + Intergenic
1181819291 22:25462951-25462973 CTAGTCCTGCCTGACTCCAGGGG - Intergenic
1183443655 22:37838471-37838493 CTACTCCCTCCTCCCTCCCCAGG + Intronic
1183591649 22:38782633-38782655 GCAGTCCTGCCTCCCTCCCCTGG + Intronic
1183947642 22:41335773-41335795 CCTGTCCTGACTCTGTCCCCTGG - Intronic
1183963467 22:41426925-41426947 CTGTTCCTGCCTCTCGCCCTTGG + Intergenic
1184280879 22:43436732-43436754 CGACTCCAGCCTCTCTGCCCTGG - Intronic
1184799944 22:46753077-46753099 CAAGTCCTGCCCCACGCCCCTGG + Intergenic
1185121911 22:48976554-48976576 CCAGAGCTGCCCCTCTCCCCAGG - Intergenic
950572272 3:13808826-13808848 CTAGTCCCGGCTCTCTCCTGAGG + Intergenic
950574059 3:13820641-13820663 CTAGTCTTGCCTCTGGCCCTGGG + Intronic
950660450 3:14463818-14463840 CTACTGCTGCCTCTGCCCCCGGG - Intronic
951347178 3:21560741-21560763 CTATAGCTGCCTCTTTCCCCAGG + Intronic
951748873 3:26011738-26011760 CTAGTCATCTCTCTCTTCCCTGG + Intergenic
952483759 3:33788827-33788849 CTAGTACTGCCACTCTTGCCAGG - Intergenic
952957049 3:38563891-38563913 CTATTCATCCCTCTCTACCCCGG + Intronic
953791163 3:45949407-45949429 CTACTTCTGCCTCTGTCCCTTGG - Intronic
956514665 3:70033677-70033699 CTAGTTCATCCTCTCTCACCTGG - Intergenic
957254985 3:77825420-77825442 CTGGGCATGCCTCTCTCCACAGG - Intergenic
957914948 3:86676546-86676568 CTCTACCTCCCTCTCTCCCCAGG + Intergenic
957965900 3:87322043-87322065 CTATTCCTTCCCCTTTCCCCAGG - Intergenic
958984948 3:100769732-100769754 CTAGTCCTGCTTCTTTCCTTGGG - Intronic
960990066 3:123304427-123304449 GTCTTCCTGCCTCTCTCACCTGG - Intronic
961040746 3:123676313-123676335 ATAGCCCAGCCTCTCTCCCAGGG + Intronic
961324735 3:126103435-126103457 TTCCTCCTGTCTCTCTCCCCAGG + Intergenic
961536798 3:127575609-127575631 CTAGGCCTCCCTCTCACCCAGGG + Intronic
961827334 3:129606038-129606060 CTAGTTCTGCCTCCCGCCGCGGG - Exonic
961960460 3:130849087-130849109 CTAGGGCTGCCTCTCTTTCCAGG + Intergenic
962870127 3:139481273-139481295 CTGTTCCTGCCTCTCTACCAAGG + Intergenic
963203103 3:142604389-142604411 CTTTTCCTTCCCCTCTCCCCAGG + Intronic
966647845 3:182267016-182267038 CCAGTGCTGCCTGTCTCCCATGG + Intergenic
968356524 3:198111788-198111810 CTATTCAGGCCTCTATCCCCAGG - Intergenic
968726359 4:2249689-2249711 GTAGTCCTGCCTGTCTGCACAGG - Exonic
968884907 4:3323147-3323169 CTCGTCCTCCCGCTCGCCCCTGG - Intronic
969892465 4:10272452-10272474 CTGGGCCTGCCTGTCTCCTCTGG + Intergenic
969893403 4:10280367-10280389 CTAGGCCTGCCTGGCTCCTCTGG + Intergenic
970628179 4:17912750-17912772 CTGGTGCTGCCTCTTTGCCCGGG - Intronic
970832351 4:20356283-20356305 CTATTCCTTCCTCTCCACCCAGG + Intronic
971013443 4:22463885-22463907 CTAGTCCAGTCTCTATCACCAGG - Intronic
971331045 4:25681620-25681642 ATACTCCTGTCTGTCTCCCCAGG + Intergenic
971496318 4:27269494-27269516 CTATTGCTTCTTCTCTCCCCTGG - Intergenic
972109689 4:35541777-35541799 CTAGGCATGCCTCCCTCCACAGG + Intergenic
972961579 4:44459695-44459717 CTAGTTCTGCCTCTCTGCCAAGG - Intergenic
973704877 4:53571513-53571535 CTAGTGCTGCCTGTCTTCCTTGG - Intronic
979857312 4:125650742-125650764 TTAGTCCTTACTCACTCCCCTGG + Intergenic
980009515 4:127580019-127580041 CTAGGCGTGCCTCCCTCCACAGG + Intergenic
981813373 4:148801143-148801165 CATGTCTTTCCTCTCTCCCCAGG + Intergenic
986681417 5:10236615-10236637 TAAATCCTGCCTCTCTCCACAGG - Exonic
986718634 5:10542253-10542275 TTAGTCCTGACTCTATCCCCAGG - Intergenic
988238420 5:28575940-28575962 CTAGCCCTCCCTTTCTCCACAGG + Intergenic
988486339 5:31671043-31671065 ACAGTTCTGCCTCTCTCCCTGGG - Intronic
988728379 5:33946088-33946110 CAAATCCTGCCTCTCTCACTTGG - Intronic
989167904 5:38448642-38448664 CCAGTCGTGTCTCTCTCTCCAGG - Intronic
990602108 5:57369411-57369433 CTTCTTCTGCCTCTCTCTCCAGG + Intergenic
991041976 5:62185666-62185688 CTTGCCTTCCCTCTCTCCCCAGG - Intergenic
991345338 5:65659854-65659876 ATTTTCCTGCCTCTCTCCCAAGG - Intronic
992033792 5:72751257-72751279 CTATTCATTCCTCTCTCCCCTGG - Intergenic
993152631 5:84180250-84180272 CTAATGCTGCTTCTCTCCCATGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995023156 5:107389131-107389153 TTGGTCCTCCCTATCTCCCCTGG + Intronic
997469204 5:134107429-134107451 TTAGTCCTGTCTCTGCCCCCAGG + Intergenic
999341762 5:150779045-150779067 CTAGTGCGGCCCCTTTCCCCGGG + Intronic
999715854 5:154359346-154359368 GCAGTCCTGCCTCTGGCCCCAGG + Intronic
1001014493 5:168127971-168127993 CTAGCCCTGTCTCTCACTCCAGG - Intronic
1001102753 5:168827720-168827742 CTTGTCCTGCCTCAGTACCCTGG - Intronic
1002205249 5:177558326-177558348 CTACTTCTTCCTCTCTCCCCAGG + Intergenic
1002859802 6:1070673-1070695 CTGTTCCTGTCTCTCTCCCATGG + Intergenic
1003841981 6:10129978-10130000 CTATCCTTCCCTCTCTCCCCTGG - Intronic
1004484166 6:16049937-16049959 CTGGCCCTGCCTGTTTCCCCAGG + Intergenic
1004644523 6:17546827-17546849 CTTCTCCTGCCTGACTCCCCTGG - Intronic
1005412415 6:25564286-25564308 CTACTCCTGCATCTCTGCTCAGG - Intronic
1005637012 6:27762308-27762330 CTCCCTCTGCCTCTCTCCCCTGG + Intergenic
1006730474 6:36232321-36232343 CCAGTGCTTCCCCTCTCCCCAGG + Exonic
1006913330 6:37578389-37578411 TCCGTCCTGCCACTCTCCCCCGG - Intergenic
1007704129 6:43780880-43780902 GTAACCCTGCCTCCCTCCCCTGG + Intronic
1008425181 6:51348903-51348925 CTATTGCTGCCCCTTTCCCCAGG + Intergenic
1008559852 6:52713247-52713269 CTATTCCTCCCTCTCTTCACAGG - Intergenic
1008590197 6:52986581-52986603 CTATACCGGCATCTCTCCCCAGG - Intronic
1010379213 6:75206696-75206718 CCAGTCCTTTCTCACTCCCCTGG + Intergenic
1012625485 6:101399686-101399708 CCACTCCCGCCTGTCTCCCCCGG + Intronic
1013195167 6:107838326-107838348 CTAACCCTCCCTTTCTCCCCAGG + Intergenic
1014245275 6:119061325-119061347 GTAATCCTGGCTCTCTCCTCAGG - Intronic
1014537429 6:122631617-122631639 TTAATCCTGCCTGTCTCTCCAGG - Intronic
1016629783 6:146214894-146214916 CTAGTCCTGTCACTGTTCCCAGG - Intronic
1017484613 6:154891162-154891184 CTTGTGCTGCCTCTCTTCCTGGG - Intronic
1018449144 6:163890294-163890316 CTCCTCCTCCCTCTCTCTCCAGG - Intergenic
1019013003 6:168857633-168857655 CTTGTCCTCCCTCTATCCCCAGG - Intergenic
1019165779 6:170096773-170096795 TCAGTCCTGCCTTTCTCCCAGGG + Intergenic
1019576628 7:1740704-1740726 CCTGTCCAGCCTCTCCCCCCCGG + Intronic
1019632743 7:2058472-2058494 CCAGCCCTGCTTCTCTCCTCTGG - Intronic
1019632761 7:2058549-2058571 CCAGCCCTGCTTCTCTCCTCTGG - Intronic
1019632782 7:2058626-2058648 CCAGCCCTGCGCCTCTCCCCTGG - Intronic
1019632828 7:2058821-2058843 CCAGCCCTGCTTCTCTCCTCTGG - Intronic
1019632849 7:2058898-2058920 CCAGCCCTGCGCCTCTCCCCTGG - Intronic
1019632870 7:2058975-2058997 CCAGCCCTGCGCCTCTCCCCTGG - Intronic
1019632878 7:2059011-2059033 CCAGCCCTGCTTCTCTCCTCTGG - Intronic
1019632886 7:2059047-2059069 CCAGCCCTGCTTCTCTCCTCTGG - Intronic
1019632919 7:2059194-2059216 CCAGCCCTGCTTCTCTCCTCTGG - Intronic
1020276559 7:6628195-6628217 CTTGTCCTCCCTCTTTCCCTAGG - Intergenic
1022519781 7:30998686-30998708 CTAGTCCTGCCTTGGGCCCCTGG - Intergenic
1022634212 7:32116617-32116639 CTCATCATTCCTCTCTCCCCAGG - Intronic
1022673716 7:32478976-32478998 CTAGCACTGCCTCTCTGCCTTGG - Intergenic
1022691870 7:32663972-32663994 CTACTCCTCCCCCTCACCCCTGG - Intergenic
1022919532 7:34998513-34998535 CTACTCCTCCCCCTCACCCCTGG - Intronic
1024279643 7:47708991-47709013 CTGGTCCTGCCTTGCTGCCCTGG + Intronic
1025099644 7:56123980-56124002 ATAGTCCTGTCTCTTTCCTCAGG - Intergenic
1027301654 7:76843900-76843922 CCATTCCTGCCCCCCTCCCCAGG - Intergenic
1029217029 7:98957862-98957884 CCAGAGCTGCCTCTGTCCCCGGG + Intronic
1029962845 7:104706905-104706927 ATCCTCCTCCCTCTCTCCCCTGG - Intronic
1030707618 7:112710803-112710825 CTAGTCCTCCTTCCCACCCCAGG - Intergenic
1031581165 7:123476739-123476761 ATAGGCCTTCCTATCTCCCCTGG - Intronic
1032550620 7:132780913-132780935 CTGGTCCTGCCCATCTCCCTGGG - Intergenic
1033363022 7:140651251-140651273 CTGGCCCTGCCCCTCCCCCCAGG - Intronic
1034271156 7:149803974-149803996 TCAGGGCTGCCTCTCTCCCCAGG + Intergenic
1034360706 7:150495063-150495085 CTTCTCCTGCCTATTTCCCCTGG - Intergenic
1034945812 7:155261028-155261050 CCAGCCCTGCCTCTGTCCTCTGG - Intergenic
1037062224 8:14528705-14528727 GTTGTCCTCCCTCTCTGCCCTGG + Intronic
1037688220 8:21161780-21161802 CTAGGTCACCCTCTCTCCCCTGG + Intergenic
1038427509 8:27473852-27473874 CTAATCCTCCATCTCTCCCAGGG + Intronic
1038442843 8:27583892-27583914 CTGGCCCTGGCTCACTCCCCAGG - Intergenic
1039414985 8:37386057-37386079 CTAGTCCTGTCTCTATCTCGAGG - Intergenic
1039885988 8:41654137-41654159 CCAGCCCTGTCTCTCTCTCCTGG + Intronic
1040464117 8:47678716-47678738 CTCGCCTTGCCTCACTCCCCAGG - Intronic
1041175579 8:55193331-55193353 CCAGTCCTTCTTCCCTCCCCAGG + Intronic
1041394590 8:57377622-57377644 CTAGGCCTGCCTCCCTCCCAAGG - Intergenic
1042002169 8:64136503-64136525 TTAGTCGTCTCTCTCTCCCCAGG + Intergenic
1044032298 8:87253287-87253309 CTCCTGCTCCCTCTCTCCCCGGG - Intronic
1044608095 8:94064436-94064458 CTAGTCCTTCCTTACTCCACAGG - Intergenic
1045503928 8:102765109-102765131 CTAGTCCTGACTCCTCCCCCAGG + Intergenic
1045535166 8:103020964-103020986 CTAGTCCCGCCCCTCTCCCAAGG + Intergenic
1045695219 8:104801684-104801706 CTATTCATCCCTCTCTCTCCTGG + Intronic
1047771702 8:128035184-128035206 CTAGTCCTGCCTGGGTTCCCAGG + Intergenic
1048872993 8:138814116-138814138 CTGGCCCTGCCTGGCTCCCCAGG + Intronic
1048931623 8:139319837-139319859 CTAGTGCAGCCTCTCCCACCTGG - Intergenic
1049408245 8:142461096-142461118 CTACCCCTGCCACTGTCCCCGGG - Intronic
1051570931 9:18558157-18558179 CTAGTCCTGCATCTCCCAACAGG + Intronic
1051574687 9:18601478-18601500 CTAGGCCAGACTCTCTTCCCTGG - Intronic
1053103421 9:35390448-35390470 CTTGTCCTGCCACTGGCCCCTGG + Intronic
1053424300 9:38000959-38000981 CGTGTCCTGCCTGTCTCGCCAGG + Intronic
1057828574 9:98389957-98389979 CCAGTTATGCCTCTCTTCCCAGG + Intronic
1058536280 9:105963553-105963575 ATAGTTCAGCTTCTCTCCCCAGG + Intergenic
1059408014 9:114113864-114113886 TTAGTCTTGCCTCCCTCCCTTGG + Intergenic
1059734989 9:117091718-117091740 CTTGCCCTGACTCTCTCCCCAGG - Intronic
1060395425 9:123313134-123313156 AGAGTCCTGCCTCTCTCCAGAGG + Intergenic
1060945347 9:127567123-127567145 CCAGCCCACCCTCTCTCCCCTGG - Intronic
1061089258 9:128417679-128417701 CAAGTCCTCCCACCCTCCCCAGG - Intronic
1061809039 9:133151853-133151875 CCATTCCTGCCCCTCTGCCCAGG + Intergenic
1062389424 9:136328013-136328035 CTTCTCCAGCCTCACTCCCCTGG + Intronic
1188225501 X:27592351-27592373 CTGGCCCTGCCATTCTCCCCAGG + Intronic
1188809027 X:34629696-34629718 CAAGTCTTGACTCTCTTCCCAGG + Exonic
1191722640 X:64247365-64247387 CTATTTCTTCCTCTCTCCCAGGG + Intergenic
1192053157 X:67745586-67745608 CTAGTCCTGGTTCTATCACCAGG + Intergenic
1195676214 X:107509009-107509031 CAAGTCCCCCCTCCCTCCCCAGG - Intergenic
1195923328 X:110003054-110003076 CTTGTCCAGCCTCCCGCCCCCGG - Intronic
1196234846 X:113267168-113267190 CTAGTTCTGCCGCTCACTCCAGG + Intergenic
1196442373 X:115728491-115728513 CTAGTCCTGCCTGGTCCCCCAGG + Intergenic
1196443184 X:115732413-115732435 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196443843 X:115735381-115735403 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196445505 X:115844328-115844350 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196446176 X:115847309-115847331 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196446847 X:115850290-115850312 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196447515 X:115853273-115853295 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196448186 X:115856252-115856274 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196448855 X:115859243-115859265 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196449526 X:115862234-115862256 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196450195 X:115865217-115865239 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196450865 X:115868202-115868224 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196451536 X:115871181-115871203 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196452207 X:115874168-115874190 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196452877 X:115877137-115877159 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196453547 X:115880130-115880152 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196454216 X:115883139-115883161 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1196455296 X:115888210-115888232 CTAGTCCTGCCTGGTCCCCCAGG - Intergenic
1197936312 X:131743325-131743347 CTTGTCCTGACTTCCTCCCCAGG + Intergenic
1197937628 X:131755825-131755847 CTTGTCCTGACTCCCTACCCAGG + Intergenic
1197939026 X:131769117-131769139 CTTGTCCTGACTCCCTACCCAGG + Intergenic
1199791623 X:151160858-151160880 CTTGGCCTGCCTCCCTCCACTGG + Intergenic
1200083608 X:153591927-153591949 GTAGCCCTGCCTCTCTTCCCTGG - Intronic
1200166339 X:154038221-154038243 CTAGCCCAGCCTCCCTCCCTTGG - Intronic
1200180159 X:154145113-154145135 CCACTCCTGGCCCTCTCCCCAGG + Intronic
1200185987 X:154183507-154183529 CCACTCCTGGCCCTCTCCCCAGG + Intergenic
1200191639 X:154220645-154220667 CCACTCCTGGCCCTCTCCCCAGG + Intronic
1200197394 X:154258449-154258471 CCACTCCTGGCCCTCTCCCCAGG + Intronic
1200696821 Y:6368305-6368327 TTACTCCTGCCTCTGTTCCCTGG - Intergenic
1201037292 Y:9796394-9796416 TTACTCCTGCCTCTGTTCCCTGG + Intergenic