ID: 904670493

View in Genome Browser
Species Human (GRCh38)
Location 1:32161261-32161283
Sequence CTAGTCCTGCCTCTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904670493_904670501 29 Left 904670493 1:32161261-32161283 CCAGGGGAGAGAGGCAGGACTAG 0: 1
1: 0
2: 1
3: 40
4: 380
Right 904670501 1:32161313-32161335 AAAATGCATTGATTTGTTATGGG 0: 1
1: 0
2: 1
3: 54
4: 533
904670493_904670500 28 Left 904670493 1:32161261-32161283 CCAGGGGAGAGAGGCAGGACTAG 0: 1
1: 0
2: 1
3: 40
4: 380
Right 904670500 1:32161312-32161334 CAAAATGCATTGATTTGTTATGG 0: 1
1: 0
2: 3
3: 55
4: 578
904670493_904670502 30 Left 904670493 1:32161261-32161283 CCAGGGGAGAGAGGCAGGACTAG 0: 1
1: 0
2: 1
3: 40
4: 380
Right 904670502 1:32161314-32161336 AAATGCATTGATTTGTTATGGGG 0: 1
1: 0
2: 3
3: 34
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904670493 Original CRISPR CTAGTCCTGCCTCTCTCCCC TGG (reversed) Intronic