ID: 904672060

View in Genome Browser
Species Human (GRCh38)
Location 1:32173425-32173447
Sequence TTGGAGTTCTTAGGGAAAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904672060_904672067 -3 Left 904672060 1:32173425-32173447 CCAGTTTTCCCTAAGAACTCCAA 0: 1
1: 0
2: 0
3: 11
4: 177
Right 904672067 1:32173445-32173467 CAAAGGCTAAAGTCTACTAGGGG 0: 1
1: 1
2: 10
3: 46
4: 227
904672060_904672068 9 Left 904672060 1:32173425-32173447 CCAGTTTTCCCTAAGAACTCCAA 0: 1
1: 0
2: 0
3: 11
4: 177
Right 904672068 1:32173457-32173479 TCTACTAGGGGCAGAGTGTGAGG 0: 1
1: 0
2: 0
3: 16
4: 174
904672060_904672064 -5 Left 904672060 1:32173425-32173447 CCAGTTTTCCCTAAGAACTCCAA 0: 1
1: 0
2: 0
3: 11
4: 177
Right 904672064 1:32173443-32173465 TCCAAAGGCTAAAGTCTACTAGG 0: 1
1: 0
2: 3
3: 12
4: 156
904672060_904672066 -4 Left 904672060 1:32173425-32173447 CCAGTTTTCCCTAAGAACTCCAA 0: 1
1: 0
2: 0
3: 11
4: 177
Right 904672066 1:32173444-32173466 CCAAAGGCTAAAGTCTACTAGGG 0: 1
1: 1
2: 8
3: 56
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904672060 Original CRISPR TTGGAGTTCTTAGGGAAAAC TGG (reversed) Exonic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
905463335 1:38135240-38135262 TTGGGGTTCTTGGAGAAACCTGG + Intergenic
906106044 1:43293234-43293256 TGTGACTTCTTAGGGATAACTGG - Intergenic
908412965 1:63885267-63885289 TTGGGGCTCCTAGGGAAACCAGG + Intronic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
911510986 1:98807289-98807311 TTACTGTTCTTAGGTAAAACAGG + Intergenic
911603844 1:99877998-99878020 TTGCAGTTGTTATGGAATACTGG + Intronic
914423769 1:147555306-147555328 TAGGAGTTCCTAGGGAAATAAGG - Intronic
915028432 1:152855136-152855158 CTGGAGATATTAGGGAAAAGAGG + Intergenic
915440062 1:155940365-155940387 TTGGAGTGCTGAGGGAAGAGAGG - Intergenic
915772616 1:158444481-158444503 ATGGAATTCTCAGGGCAAACGGG - Intergenic
916643788 1:166761728-166761750 TTAGTGTTCTTAGGAAAAGCTGG - Intergenic
917771676 1:178286367-178286389 TTGGACATTTTAGGGAAAACAGG - Intronic
918619893 1:186591045-186591067 TTTGAGTTCTTTTGGAGAACTGG - Intergenic
919719363 1:200815289-200815311 TTGGAGCGCTAAGGGAAAAAAGG - Intronic
922070029 1:222183162-222183184 TGGGAGTTCTGATGGAAACCAGG - Intergenic
922920414 1:229297009-229297031 TTGGATTTCTCAGAGAAAAGGGG + Intronic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1071140429 10:82503331-82503353 TTGGAGATCTCAGGAAAATCTGG + Intronic
1071334998 10:84593458-84593480 TTGGAGTTCCTAGGAAAGTCAGG + Intergenic
1072346089 10:94508168-94508190 TTGGAGTCCAGAAGGAAAACAGG - Intronic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1072597390 10:96887235-96887257 TGGGCATTCTTAGGTAAAACTGG - Intronic
1073273121 10:102283806-102283828 TCGGAGTTCTTTGGAAACACAGG - Intronic
1075059043 10:119241849-119241871 CTGGAGTTCATAGGGAAATGTGG + Intronic
1075668100 10:124244927-124244949 TTGGAGTGTTAAGGGATAACAGG - Intergenic
1075829808 10:125398845-125398867 TTATGGTTCTCAGGGAAAACAGG + Intergenic
1080564025 11:33491669-33491691 TCAGATTTCTTAGAGAAAACAGG - Intergenic
1080650605 11:34219964-34219986 TTGGAGTTCTTTGAGTAAATGGG - Intronic
1080827775 11:35862293-35862315 TTGGAGATCTTAAGGAAAGCAGG - Intergenic
1081280329 11:41201962-41201984 GTGTAGTTTTTAGGGAAAAGTGG + Intronic
1082023579 11:47554540-47554562 ATAGAGTGCTTAGGGAAGACTGG - Intronic
1083396950 11:62398859-62398881 TTGGAATTTCTAGGGAAGACAGG - Intergenic
1083401320 11:62425375-62425397 TCCGAATTCTGAGGGAAAACAGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085589135 11:77741206-77741228 TGGGAGTTTTTAGTGCAAACGGG - Intronic
1088128581 11:106459855-106459877 TTAGAGTCCTAAGTGAAAACAGG + Intergenic
1090688636 11:129154003-129154025 TTGGAGTTCTTTGTGAATTCTGG - Intronic
1092712997 12:11357459-11357481 TTCCAGTTCCTATGGAAAACAGG - Intronic
1093448594 12:19289251-19289273 TTGGATTCCTTAGATAAAACTGG - Intronic
1095296086 12:40529283-40529305 ATGGATTTCTTAGGGAAAATGGG + Intronic
1097839326 12:64305840-64305862 TTGGAGTTCTCAGAGAATAGAGG - Intronic
1099149732 12:79095562-79095584 TTGGAGTTGCTGGTGAAAACAGG - Intronic
1103328834 12:120139732-120139754 TTGCAGTTCTTAGAGAAGATGGG - Intronic
1103824585 12:123727259-123727281 TTGGAATCCAAAGGGAAAACAGG - Intronic
1105973315 13:25451057-25451079 TTGGAGTCCCAAGGGAAAAAGGG - Intronic
1106100352 13:26689955-26689977 TTGTTGTTCATAGGGAAAAAGGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108927640 13:55772446-55772468 TTGGATTTTTTGGGGAAAATAGG + Intergenic
1109198570 13:59406390-59406412 TGGGAGTTCTAAGGGACAATTGG + Intergenic
1109658869 13:65432060-65432082 TTAGTGTTCTGAAGGAAAACAGG + Intergenic
1109994873 13:70109516-70109538 TTGGAGTCCTTAGGCAAAGTTGG + Intergenic
1110839812 13:80128955-80128977 TTGGAAATCTTAGGGGAAAATGG + Intergenic
1110954302 13:81534703-81534725 TTAGAGTTAATAGGAAAAACAGG - Intergenic
1111282015 13:86038913-86038935 TTGGAATTCTTCTGGAAAAAAGG + Intergenic
1111933871 13:94539039-94539061 TTGGAGTTCTTTGGAAATGCAGG - Intergenic
1116928371 14:50665482-50665504 TTGGAGTTCTAAGGAAACTCTGG + Exonic
1117545663 14:56793144-56793166 TTGTAGTTCTTGGTGACAACTGG - Intergenic
1118342596 14:64907527-64907549 TTGGAATTTTTAGAGAAACCGGG - Intergenic
1125258807 15:37798601-37798623 TAGGAGTTCTTAGAGAGTACAGG - Intergenic
1125300286 15:38247577-38247599 TTGCCGTCCTTAGGGAAAAAAGG + Intergenic
1125878360 15:43169222-43169244 TTGGTGTTCTGAGGGGAAAGGGG + Intronic
1127593486 15:60452520-60452542 TTTAAGGTCTGAGGGAAAACAGG + Intronic
1128507069 15:68280478-68280500 TTGGACTACTGAGAGAAAACAGG + Intronic
1129752425 15:78075716-78075738 TTGGTTTTCTTTGGGGAAACAGG + Intronic
1132902679 16:2267070-2267092 TTGGAGTGCTTAAGAATAACTGG - Intronic
1137482177 16:48861700-48861722 TTGGAGCTCTTAGAGAAAGGTGG + Intergenic
1137518357 16:49170431-49170453 TTGGAGTTGTTAGGCAACACAGG - Intergenic
1137855814 16:51793604-51793626 TTGAATTGCTTTGGGAAAACTGG - Intergenic
1139531369 16:67544284-67544306 TTGGAGGCCTGAGGGAAAAATGG - Exonic
1146083059 17:29800245-29800267 TTGTAGGTCTTAGGGTAAAATGG + Intronic
1147359968 17:39924308-39924330 CTGGAGTTCTCAGGGAAACAAGG - Intronic
1149165088 17:53741757-53741779 TTGGAGTTATGGGGGAAAAAAGG + Intergenic
1150720012 17:67606449-67606471 TTGGAGCTCTTTGGAAAAGCTGG - Intronic
1154272115 18:12929325-12929347 TGGGAGTTCTCTGGGAACACTGG - Intronic
1158269451 18:55697127-55697149 ATGGAGTTTTGAGGGACAACTGG + Intergenic
1158317495 18:56227696-56227718 TAGGAAGTCTAAGGGAAAACTGG - Intergenic
1161497154 19:4592923-4592945 TTGAGTTTCTTGGGGAAAACTGG + Intergenic
1162811020 19:13164347-13164369 TTGGGGTTCTTAAGTAAAACTGG - Intergenic
1164848684 19:31460774-31460796 TTGGAGCGCTTAGGGAGAAATGG - Intergenic
1164954041 19:32365737-32365759 TTGTATTTCTAAGGGAAAATGGG - Intronic
1167450588 19:49566191-49566213 TTGTATTTTTTAGTGAAAACGGG + Intronic
927580286 2:24237720-24237742 ACGGAGTTCTGAGGGAAAATTGG - Intronic
927585229 2:24297451-24297473 TTGTAGTTCTTAGCTAATACTGG - Intronic
928353645 2:30586982-30587004 TTGAAGTTATTAGGGAATAAGGG - Intronic
928611117 2:32993353-32993375 TTAGAGTTCTCAGGAAAAAACGG + Intronic
928870384 2:35969897-35969919 TTGGAGTGTTTAGGGACAATGGG + Intergenic
930282016 2:49380695-49380717 TTGGAGCTCTGAGAGAATACAGG - Intergenic
934792942 2:97078252-97078274 GTGGCGTTCTAAGGGAAAATGGG - Intergenic
934813245 2:97302235-97302257 GTGGCGTTCTAAGGGAAAATGGG + Intergenic
934824450 2:97406245-97406267 GTGGCGTTCTAAGGGAAAATGGG - Intergenic
935348732 2:102134858-102134880 TTCGTGTTCTTAGGAAAACCTGG + Intronic
940200845 2:151148720-151148742 GTGGAGTTCTTTGGGGAAGCTGG - Intergenic
943762873 2:191628947-191628969 TTGGAGTACTTAGGAAATAATGG + Intergenic
944108094 2:196101236-196101258 GTTCATTTCTTAGGGAAAACAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1169575232 20:6952493-6952515 TAGGAGTTCTCAGCAAAAACTGG + Intergenic
1169932365 20:10848165-10848187 TGGAAGATCTTAAGGAAAACTGG - Intergenic
1170770627 20:19329199-19329221 TAGTAGTTCATAGGGAAAATGGG + Intronic
1172556634 20:35847851-35847873 TTGGAGTTGCTAGTGGAAACTGG + Intronic
1173081169 20:39868969-39868991 TTGGAGTTGTTTGGGAAATTAGG + Intergenic
1173108298 20:40159466-40159488 TTGCAATTCTTATAGAAAACAGG - Intergenic
1178158173 21:29879260-29879282 CTGGAGTTCTTAGGGAAGTCAGG + Intronic
1179233812 21:39527937-39527959 TTGGGATTCTTTGGGGAAACTGG - Intergenic
1182719917 22:32389069-32389091 TAGGAGTGCCTAGGGAGAACGGG - Intronic
951037265 3:17947560-17947582 TTTAAGTTCTTTGGGAAAAAAGG + Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
955540759 3:59973548-59973570 TAGGATATCTTAGGGAAAACTGG - Intronic
957329168 3:78737951-78737973 TTTAACTTCTTAGGGAAAAGGGG + Intronic
957915266 3:86680834-86680856 GTAGAGGTCTTAGGTAAAACTGG + Intergenic
962269129 3:133965317-133965339 GGGGAGTCCTCAGGGAAAACTGG + Intronic
962445338 3:135458691-135458713 TTGGTGCTCTCATGGAAAACTGG + Intergenic
962625193 3:137219199-137219221 ATGGAATTCTTAGGGGCAACTGG + Intergenic
964320779 3:155494770-155494792 ATTGAATTCTTAGGGAGAACAGG - Intronic
967162090 3:186747907-186747929 TCAGAGCTTTTAGGGAAAACTGG - Intergenic
967480964 3:189973065-189973087 TTGGAGGTCGTAAGAAAAACAGG + Intronic
968191372 3:196670297-196670319 TTGGAGGTCTGTGGGAAGACTGG - Intronic
970001497 4:11369615-11369637 TTGGAGTGCTTAAGAATAACTGG + Intergenic
971775230 4:30955186-30955208 TTGGTGCTCTTAAGGAAGACAGG + Intronic
971952280 4:33368321-33368343 TTGGAGTGCTGAGGGAAACAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972453435 4:39228256-39228278 AAGGTGTTCTTTGGGAAAACTGG + Exonic
973550917 4:52035418-52035440 CTGGAGTTGTTAGGGAAATGGGG + Intronic
974969388 4:68805388-68805410 TTTTAGGTCTTAAGGAAAACCGG - Intergenic
976383353 4:84426374-84426396 TTTATGTTCTTAGGGAAATCAGG + Intergenic
977720387 4:100233007-100233029 TTGGCTTGCTTAGGAAAAACCGG - Intergenic
978411199 4:108427856-108427878 GTCAAGTGCTTAGGGAAAACTGG + Intergenic
980421720 4:132569499-132569521 TTTGAGTTCTTATGAAAAACTGG - Intergenic
981366614 4:143911819-143911841 TTGGAGTTCTAAGGAAACTCTGG + Intergenic
985196974 4:187442129-187442151 TTGGAGTTCTGAGAGATTACTGG + Intergenic
986674925 5:10175703-10175725 TTAGTTTTCTTAGGAAAAACTGG - Intergenic
987729064 5:21744200-21744222 TGGAAGTTGTTAGGGGAAACTGG + Intergenic
989246175 5:39257693-39257715 TTGGAATTCTAAGCGAAAATTGG - Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991245173 5:64502891-64502913 TTGGAGAACTAAGGGAAAAGGGG - Intergenic
992294783 5:75317144-75317166 TGGGAGTTATTAAGGAATACTGG + Intergenic
993044445 5:82851638-82851660 TTGGAATGCTTAGAAAAAACTGG - Intergenic
993356608 5:86916989-86917011 TTGGAGTTGGTAGAGAAAGCAGG + Intergenic
993873200 5:93275646-93275668 TTCAAGGTCTTTGGGAAAACAGG - Intergenic
993913306 5:93710310-93710332 TTTAACTTCTTTGGGAAAACCGG + Intronic
994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG + Intergenic
994761133 5:103855851-103855873 TTTGAATTCATAGAGAAAACAGG + Intergenic
995871954 5:116752768-116752790 TTTGAATTCCTAGGGAAAAGGGG + Intergenic
996146281 5:119980979-119981001 ATGGAGGTCATAGGGAAAATGGG + Intergenic
996980142 5:129481856-129481878 CTGGAGATCTTAGGGCAAAAAGG - Intronic
999585778 5:153088095-153088117 TTGGAGTTGTTAGGAAATTCAGG + Intergenic
1000319482 5:160122756-160122778 TTGAAGTTCTGAGGCAAAAGAGG + Intergenic
1004356878 6:14937362-14937384 TTTGAGTTCTTTGTAAAAACTGG + Intergenic
1004518103 6:16337578-16337600 TTGGAGTTTTTAAGAAAAGCTGG + Intronic
1005341326 6:24846249-24846271 GTGGAGTTTTCAGGGAAAATGGG - Intronic
1007070181 6:39031030-39031052 TTGGAGTTGGGAGGGAAAGCTGG - Intergenic
1009775116 6:68195689-68195711 TTGGTGTTTTGTGGGAAAACTGG - Intergenic
1013302594 6:108818415-108818437 TTGGGGTTTTTAGGGAACCCTGG + Intergenic
1017039695 6:150297793-150297815 TTGCAGTTCCCAGGGAACACTGG + Intergenic
1017609903 6:156174327-156174349 TTGGAGTTCTTAGGATAATTTGG - Intergenic
1020987946 7:15159544-15159566 TTGCCTTTCCTAGGGAAAACAGG + Intergenic
1022021285 7:26401291-26401313 TTGGGGTTTTTAGTAAAAACAGG - Intergenic
1024419416 7:49145037-49145059 TTTGAGTGCTTAGGAAAAACAGG - Intergenic
1024532092 7:50401616-50401638 TTGGATTTCTTCAGGAAAAGAGG - Exonic
1026292688 7:69022451-69022473 TTGTATTTCACAGGGAAAACTGG + Intergenic
1026377271 7:69764490-69764512 TAGCAGTTCTTAGAGACAACTGG + Intronic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1028859601 7:95633859-95633881 TTGGAATTCTCATGGAAATCTGG + Intergenic
1028906315 7:96157893-96157915 TTGGAGTACTTAGAGAAAATGGG - Intronic
1028912245 7:96221798-96221820 TTGGTGTGCTTTGGGAAAATGGG - Intronic
1030646694 7:112069468-112069490 TTGGAAGACTTAGAGAAAACTGG + Intronic
1031579723 7:123457318-123457340 TTGGAATTATTAGCGATAACTGG - Intronic
1032438539 7:131922429-131922451 GCCGACTTCTTAGGGAAAACAGG + Intergenic
1033726682 7:144126025-144126047 TTGGAGGTCTCAGGGATAAAAGG + Intergenic
1033913740 7:146298091-146298113 TTGGTTTTCTTACAGAAAACAGG + Intronic
1037457616 8:19079782-19079804 TTACCTTTCTTAGGGAAAACTGG - Intronic
1038321576 8:26531944-26531966 TTGGTGTCCTTTGGGAAGACAGG + Intronic
1040870928 8:52100091-52100113 GAGGTGTTCTTAAGGAAAACTGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1047083527 8:121491514-121491536 TTTGAATTTTTAGTGAAAACAGG + Intergenic
1047979986 8:130171139-130171161 TTGGAGTTTTTAAGGGAAAATGG - Intronic
1048980416 8:139700831-139700853 ATGCATTTCTTAAGGAAAACTGG + Intronic
1049117063 8:140698056-140698078 TTGGAATTTTTAGGGCAGACAGG - Intronic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1057481802 9:95450544-95450566 TTGGAGCTATTTGGTAAAACTGG - Intronic
1059570874 9:115434060-115434082 CTTGAGTCCTTAGGGAAAAATGG - Intergenic
1185823882 X:3230486-3230508 TTGGAGATATTCAGGAAAACAGG + Intergenic
1187527760 X:20069537-20069559 ATGGAGTTCAAAGGTAAAACTGG - Intronic
1188256382 X:27966221-27966243 TTGGAGATGGTAGGCAAAACTGG + Intergenic
1190414998 X:50172313-50172335 TTGGAGTTCAGAGGAAAGACTGG - Intergenic
1191844423 X:65535838-65535860 TTGGAGTTCTGGGAGAAAAGCGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1201733330 Y:17229712-17229734 TTGAAGTTTTTAGGGATAATTGG + Intergenic