ID: 904672932

View in Genome Browser
Species Human (GRCh38)
Location 1:32179747-32179769
Sequence GTGGGGAAGCCATCGGACGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904672928_904672932 -6 Left 904672928 1:32179730-32179752 CCGGTGCGAGGCCAGAGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 278
Right 904672932 1:32179747-32179769 GTGGGGAAGCCATCGGACGTCGG 0: 1
1: 0
2: 0
3: 4
4: 41
904672922_904672932 17 Left 904672922 1:32179707-32179729 CCGGCAGCAGTTACTCGGGGTTT 0: 1
1: 0
2: 0
3: 6
4: 73
Right 904672932 1:32179747-32179769 GTGGGGAAGCCATCGGACGTCGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904672932 Original CRISPR GTGGGGAAGCCATCGGACGT CGG Intronic
900411945 1:2516542-2516564 GTGGGGTAGCCACCGGAGGGTGG - Intronic
900543485 1:3215749-3215771 GAGGGGAAACCAGAGGACGTGGG - Intronic
904672932 1:32179747-32179769 GTGGGGAAGCCATCGGACGTCGG + Intronic
923232694 1:232002748-232002770 GAGGGGGAGGCATGGGACGTAGG + Intronic
1071028624 10:81144766-81144788 GTGGGAAAGCCAGCGGACCATGG - Intergenic
1072824316 10:98590685-98590707 GTGGGAAAGCTATTGGAAGTTGG - Intronic
1075342659 10:121659961-121659983 GTTGGGAAGCCATCTGACCCTGG + Intergenic
1082775146 11:57238782-57238804 TTGGGGAAGCCACCTGACGTTGG + Intergenic
1087258695 11:95986127-95986149 GTGGGGAAAGCATAGGAGGTAGG + Intronic
1096461064 12:51821653-51821675 GTGGGGAAGCCATAGGCGGTGGG + Intergenic
1096820632 12:54231340-54231362 GTGGGAAAGCCAGCGGACCATGG + Exonic
1100288186 12:93187576-93187598 GTGGGGCAGCCATGGGATGTGGG - Intergenic
1102237946 12:111306452-111306474 GTGGAGAAGCCATGGGTCTTGGG + Intronic
1105290346 13:19049201-19049223 GTGAGGAAGCCAACGGAGGGAGG + Intergenic
1111562592 13:89970351-89970373 GTGTGGAAGCCAACAGACTTTGG - Intergenic
1122325925 14:100880634-100880656 GCGGGGAGGCCAGGGGACGTCGG + Exonic
1122953073 14:105056554-105056576 GTGGGGGAGCCGTAGGAAGTCGG - Intronic
1123893385 15:24803366-24803388 GTGGGGAAGCCAGCTGCCGGTGG - Intergenic
1137931229 16:52589330-52589352 GTGGGGAAGCCATGAGCCATTGG - Intergenic
1141625079 16:85257026-85257048 GTGGGGAGGACATGGGACATAGG + Intergenic
1145018790 17:19414709-19414731 GTGGGGAAGACATGGGAGGCTGG + Intronic
1147320498 17:39642995-39643017 CTGGGGAAGCCATTGGAGGTTGG + Intronic
1150965448 17:69962789-69962811 GTGGGGAAGCAATCTGACAGTGG - Intergenic
1158950284 18:62488154-62488176 GTGCAGAGGCCATCTGACGTGGG + Intergenic
1160904829 19:1447136-1447158 GTGAGGAGGCCACCGGAGGTGGG - Intronic
1161560794 19:4971494-4971516 CTGGGGAAGCCATCTGTCCTCGG + Intronic
1161723996 19:5918095-5918117 GTGGGGAGGCCATTGGCCCTGGG + Intronic
926603352 2:14870465-14870487 GTGGAGAAGCCATCTAACATAGG + Intergenic
931163476 2:59719525-59719547 GGGGGGAAGCCATAGAAAGTTGG + Intergenic
934983900 2:98870133-98870155 GTTGGCAAGCCATCAGACTTGGG - Intronic
948533668 2:238630456-238630478 GTGGGGAAGCCATCTGTTGATGG - Intergenic
1180596838 22:16981650-16981672 GCGGGGAAGCCATCGGGTCTTGG - Intronic
1180697769 22:17764123-17764145 GTGGGAAAGCCAGCGGACCATGG + Intronic
1184511091 22:44933623-44933645 GTGGGGGAGCCGTCTGAGGTTGG + Intronic
949233041 3:1773976-1773998 CTGGGGCAGCCATTGGAAGTTGG - Intergenic
961504728 3:127362564-127362586 GTGGGGCAGTCATGGGACATGGG - Intergenic
969239440 4:5889082-5889104 GTGGGGAAGGCATTGGAGATGGG - Intronic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
995169528 5:109091238-109091260 CTGGGGAACCCATTGGACCTTGG + Intronic
1007719448 6:43876505-43876527 GTGGGGAAGCCTTGGGTAGTTGG - Intergenic
1013374020 6:109496703-109496725 GTGGGGAAGGCAGCGGGCTTGGG - Intronic
1020097526 7:5377106-5377128 GTGGGGAAGCCAAGGGACAGGGG + Intronic
1021984823 7:26088341-26088363 GTGGGGAAGCCATCAGGTGCTGG - Intergenic
1029920249 7:104254823-104254845 GTGGGGAGGCCATTGCAAGTGGG - Intergenic
1044761268 8:95520227-95520249 GTGTGGCAGCCATAGGATGTGGG + Intergenic
1058551139 9:106116160-106116182 GTGGGGAGGCCAGAGGACATAGG + Intergenic