ID: 904676310

View in Genome Browser
Species Human (GRCh38)
Location 1:32201169-32201191
Sequence ACAGGCGCAGCCTTTGTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904676304_904676310 -5 Left 904676304 1:32201151-32201173 CCTCGGAGCAGCCCAGCCACAGG 0: 1
1: 0
2: 3
3: 36
4: 311
Right 904676310 1:32201169-32201191 ACAGGCGCAGCCTTTGTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
904676297_904676310 28 Left 904676297 1:32201118-32201140 CCGGAGGCTTGGGGGGCGCTGCT 0: 1
1: 1
2: 2
3: 13
4: 204
Right 904676310 1:32201169-32201191 ACAGGCGCAGCCTTTGTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
904676303_904676310 2 Left 904676303 1:32201144-32201166 CCGGGGACCTCGGAGCAGCCCAG 0: 1
1: 0
2: 1
3: 31
4: 280
Right 904676310 1:32201169-32201191 ACAGGCGCAGCCTTTGTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904676310 Original CRISPR ACAGGCGCAGCCTTTGTCGG AGG Intronic
904676310 1:32201169-32201191 ACAGGCGCAGCCTTTGTCGGAGG + Intronic
905927545 1:41762624-41762646 ACAGGAGCAGGCTTTGTGTGGGG - Intronic
906207442 1:43994770-43994792 ACAGGGGTAGCCTGTGTCAGAGG + Intronic
911136015 1:94441414-94441436 AGAGGTGCAGCCTTTGTGGAGGG + Intronic
1063112510 10:3048912-3048934 AGAGGCCCAGCCCTTGTGGGCGG + Intergenic
1075196185 10:120361267-120361289 ACAGGTGAAGCCTGTGTAGGAGG + Intergenic
1088818899 11:113440494-113440516 AAAGGCGCAGCCTTTTTCCCAGG - Intronic
1090972333 11:131654314-131654336 ACCGGCCCTGCCTTTGGCGGTGG - Intronic
1101837187 12:108303840-108303862 ACAGGAGAAGCCTTTGGAGGCGG + Intronic
1119256174 14:73199670-73199692 ACAGGCACAGCTTTTTTAGGAGG - Intronic
1119856417 14:77904522-77904544 CCAGGCGCAGCCTGTTTCGTGGG + Intronic
1123043334 14:105499482-105499504 CCAGGCACAGCCTTGGCCGGAGG - Intronic
1135276114 16:21114198-21114220 ACAGGCGTCCCCTTTGTCTGCGG - Intronic
1137379372 16:47983255-47983277 ACATGGGCAGCCTCTGTGGGAGG + Intergenic
1141827858 16:86493619-86493641 ACAGTCGCAGCTTTGGTGGGTGG - Intergenic
1142377101 16:89711848-89711870 ACGGGCCCAGGCTTTGTAGGAGG - Intronic
1147504290 17:40999770-40999792 ACAGCGGCAGGATTTGTCGGAGG + Exonic
1167528731 19:50001618-50001640 ACTGGAGCAGGCTCTGTCGGGGG - Intronic
926469153 2:13231446-13231468 ACTGGCGGAGCCTTTGTCCAAGG + Intergenic
927981571 2:27378085-27378107 ACAGGCAAAGCCTTTGTCACTGG + Exonic
929590165 2:43140368-43140390 ACAGGCCCAGCCTCTGTCCAGGG + Intergenic
932715971 2:74100995-74101017 ACAGGCTCAGCCTGGGTCAGCGG - Exonic
942588294 2:177510966-177510988 ACAGGTGCAGCCATTGTGGTAGG - Intronic
948658500 2:239491809-239491831 GCAGGGGCAGCATTTGTGGGTGG + Intergenic
1175319216 20:58073483-58073505 CCAGGTGCAGGCTTTGTCGCAGG + Intergenic
1175927536 20:62478216-62478238 ACACGTGCAGACTTTGTCTGTGG + Intergenic
1180194982 21:46188488-46188510 ACCGGTGCAGCCTCTGTCTGAGG - Exonic
1183279895 22:36926348-36926370 ACAGGAGAAGCCTTTGTCAGGGG - Intronic
951862734 3:27272209-27272231 AAAGTCCCAGCCTTTGTCTGGGG + Intronic
955526642 3:59827138-59827160 ACAGGCACAGCCTTAGTGGGTGG - Intronic
968562604 4:1292543-1292565 GCTGGAGGAGCCTTTGTCGGTGG + Intronic
968673893 4:1866684-1866706 AGAGGCACAGCCTTTGGCGCTGG - Intergenic
978323233 4:107521572-107521594 ACAGGCTCTGCCCTTGTGGGTGG + Intergenic
1007367758 6:41406831-41406853 ACATTCGCCGCCTATGTCGGGGG + Intergenic
1007817019 6:44531749-44531771 ACAGGAGCAGCCTGGGTCAGGGG + Intergenic
1018929722 6:168233095-168233117 ACAGACGCAGCCGGTGTCAGGGG - Intergenic
1027000566 7:74650594-74650616 ACAGGCACTGCATTTGTGGGTGG + Intergenic
1027025520 7:74849295-74849317 ACAGGCACTGCATTTGTGGGTGG - Intronic
1027062244 7:75094824-75094846 ACAGGCACTGCATTTGTGGGTGG + Intronic
1034174709 7:149091164-149091186 ACAGACGAAGCCTGTCTCGGGGG - Intergenic
1035739493 8:1915477-1915499 CCAGGCCCAGCCTCTGTCTGGGG + Intronic
1039374576 8:37020450-37020472 ACAGGCGCAGCAGATGTCAGGGG + Intergenic
1040555461 8:48474056-48474078 CCAGGCACAGCCTTTGCAGGAGG + Intergenic
1049422074 8:142521428-142521450 GCAGGTGCAGCCTTTGGCTGGGG + Intronic
1050555181 9:6783687-6783709 CCAGGCACAGCTTTTGTGGGTGG - Intronic
1056928963 9:90858761-90858783 ACAGGCCCAGCATCTGTAGGTGG - Intronic
1060481438 9:124018628-124018650 ACAGGCGCAGCTTGTGGCGAGGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062583425 9:137238094-137238116 AGACGCCCAGCCTTTGTGGGAGG - Intergenic
1200210747 X:154345688-154345710 ACATGCTCACCCTTTGTTGGGGG + Intergenic
1200220105 X:154386404-154386426 ACATGCTCACCCTTTGTTGGGGG - Intergenic
1201017025 Y:9615122-9615144 ACAGGAGCAGATTTTGTAGGAGG + Intergenic