ID: 904676592

View in Genome Browser
Species Human (GRCh38)
Location 1:32202439-32202461
Sequence TTGGGGGCCCTGGAGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904676582_904676592 6 Left 904676582 1:32202410-32202432 CCTGAAAGGTTTCAGGAACCACA 0: 1
1: 0
2: 1
3: 12
4: 184
Right 904676592 1:32202439-32202461 TTGGGGGCCCTGGAGTATCAGGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904676592 Original CRISPR TTGGGGGCCCTGGAGTATCA GGG Intronic
900012808 1:131384-131406 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
900042872 1:487371-487393 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
900064309 1:722368-722390 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
900801917 1:4742521-4742543 TTGGGGCCCCTGGGGAATCAGGG + Intronic
902427668 1:16337271-16337293 TTTGGGGACCTTGAGTATCAAGG + Intronic
903280430 1:22247097-22247119 GTTGGGGCCCTGGAGCTTCAGGG - Intergenic
904676592 1:32202439-32202461 TTGGGGGCCCTGGAGTATCAGGG + Intronic
905849808 1:41265309-41265331 CTGGGGGCCCTGGACTCTCCCGG + Intergenic
906124743 1:43420839-43420861 CTGAGGGCCCTCGAGTAACACGG + Exonic
908094404 1:60721745-60721767 TTTGGGGTCCTGGAGGATGATGG - Intergenic
912238527 1:107880165-107880187 TTGAGAGCCCTAGGGTATCAGGG + Intronic
914687628 1:149995223-149995245 TTGGGGATCCAGGAGTATCTGGG - Intronic
914880855 1:151545718-151545740 TTGAGGGACCTGGATCATCAAGG - Intronic
918878268 1:190080065-190080087 TTAGGGGCACTGAATTATCAAGG - Intergenic
920656485 1:207879378-207879400 TGGGGGACCCTGGAGTATCAAGG - Intergenic
922099209 1:222468380-222468402 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
922261246 1:223947874-223947896 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
922735826 1:227977866-227977888 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1064420559 10:15187022-15187044 TTGGGGTTCCAGGAGTAGCAAGG + Intergenic
1066734064 10:38455501-38455523 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1067162594 10:43840007-43840029 TTGGGGGCTCTGGTGTGTGAGGG + Intergenic
1067837271 10:49649390-49649412 TTTGCGGCCATGGAGTTTCAGGG - Intronic
1071571936 10:86701994-86702016 ATGTGGGCCCTGGAGTTGCATGG + Intronic
1072407475 10:95168605-95168627 GTGGGGGGCCTGGAGGAGCAGGG + Intergenic
1076476666 10:130758432-130758454 CTGGGTGACCTGGAGTAGCAAGG - Intergenic
1076969144 11:123588-123610 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
1077361549 11:2142872-2142894 TGGGGGGACCTGGAGAATCCTGG + Intronic
1081774784 11:45669764-45669786 TTGGGGGCCCTGGAGCCCAAGGG - Intergenic
1081867062 11:46365955-46365977 TAGGGAGCCCTGGAGTCCCAGGG - Intronic
1084437330 11:69151563-69151585 TTCAGAGCCCTGGAGCATCATGG + Intergenic
1085830176 11:79891875-79891897 CTGGGGACCCTGGAATATCATGG - Intergenic
1089255617 11:117192449-117192471 TTGGGGGCCCTGGAGTCACTGGG + Intronic
1089383829 11:118055268-118055290 TTGGAGGCCCTGGAATTTGAGGG - Intergenic
1089618482 11:119708890-119708912 GTGGGGGCCCTGGGGTCCCACGG + Intronic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1094499128 12:31007380-31007402 TTGGGGGCCCTGGGGTTTCTGGG - Intergenic
1103620732 12:122185720-122185742 TTGGTGGCCCTGGAGAAGCGAGG + Intronic
1103904171 12:124319049-124319071 GTGGGGGCCCAGGAGTGTCTGGG - Intergenic
1110565144 13:76950183-76950205 TTAGGGGACCTGGGGTATCTGGG - Intronic
1113556479 13:111239653-111239675 TGAGGGGCCCTGAGGTATCAGGG + Intronic
1113950770 13:114069861-114069883 TTGGGGGGCCAGGAGACTCAGGG + Intronic
1118260325 14:64240408-64240430 GTGGAGGCCCTGGAGGATAAGGG - Intronic
1118839442 14:69500018-69500040 TTGGGGGCCCTGGACTCACATGG - Intronic
1119137094 14:72231080-72231102 CTGGGGTCACTGGAGTCTCAAGG + Intronic
1119192688 14:72693963-72693985 TTGGCTGCCCTGGGGCATCAGGG - Intronic
1124221677 15:27854892-27854914 GTGGGGGCATTGCAGTATCAAGG + Intronic
1128742399 15:70093017-70093039 CTGGGGGCCCAGGTGTTTCAAGG - Intronic
1129698972 15:77756839-77756861 TGGGGGGCGGTGGAGTATCAGGG - Intronic
1131026370 15:89145515-89145537 ATGTGGGCCGTGGGGTATCAGGG + Intronic
1135609764 16:23856095-23856117 TTGCTGGCACTGGAATATCATGG + Intronic
1141015657 16:80446849-80446871 TTGGGGCCCTTGGAGAACCAGGG - Intergenic
1142451530 16:90175534-90175556 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1142519820 17:497112-497134 CAAGGGGCCCTGGAGTACCATGG - Intergenic
1143117793 17:4590537-4590559 CTGGGGCACCTGGAGCATCAGGG - Intronic
1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG + Intronic
1147649301 17:42053081-42053103 TTGGGGGCTCTGGAGAATGTGGG - Intronic
1153773710 18:8435053-8435075 TTGGGGGGCATGGTGTGTCAGGG - Intergenic
1155213401 18:23621390-23621412 TTGGGAGCCCAGGAGGATCTGGG + Intronic
1160645950 19:193514-193536 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
1161241768 19:3226945-3226967 TTGGGGTCCCTGGGGTACCTCGG + Intronic
1161933346 19:7355839-7355861 CAGGGGGCCCTGGAGAATCAGGG - Intronic
1165404627 19:35622136-35622158 TTGGGGGCACTGGAGAACCTTGG + Intronic
1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG + Intergenic
1167706166 19:51082483-51082505 TTGGGGCCCCTGGATGCTCATGG - Intronic
1167756270 19:51415503-51415525 TTGGGGGCCCAGGAGTCTGGAGG - Intronic
931126279 2:59281181-59281203 TTGAGGGCCCTGGTGTCTCAAGG - Intergenic
932282011 2:70501567-70501589 TTCGGTACCCTGGAGTAACAGGG - Intronic
934592049 2:95562413-95562435 TAGAGGGCCCTGGAACATCAGGG - Intergenic
937979821 2:127608408-127608430 TGGGGGTCCCTGGAGTTTGAAGG + Intronic
938310532 2:130285933-130285955 TTGGGCCCCCTGGAGGAGCAGGG + Intergenic
942689985 2:178574941-178574963 TAGGTGGCCCTGGGATATCATGG + Exonic
946337935 2:219050724-219050746 TGGGAGGACCTGGAGTGTCAGGG - Intergenic
949060463 2:241953659-241953681 CTGGGGTCCCTGCAGCATCACGG - Intergenic
1169425277 20:5491959-5491981 TCTTGGGCCCTGGAGTGTCAGGG - Intergenic
1171232440 20:23498463-23498485 TTTGAGGCCTTGGAGTTTCATGG - Intergenic
1172177059 20:32978848-32978870 TTGGGGGCCAGTGGGTATCATGG + Intergenic
1173165356 20:40683630-40683652 TTGTGGGCTCTGGGGCATCACGG + Intergenic
1175480247 20:59305545-59305567 TTGGGGGCCATGGACTTTTATGG + Intronic
1175773960 20:61641445-61641467 TTGAGGGCTCTGGGGTAGCAGGG - Intronic
1176279556 20:64292702-64292724 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1176669767 21:9722341-9722363 TTGGGGAACATGGAGTCTCATGG + Intergenic
1179595626 21:42441409-42441431 TTCGGGGGCCTGGTTTATCAGGG + Intronic
1180159078 21:45991051-45991073 TTGCGGCCCCTGGAGGACCAGGG + Intronic
1183036423 22:35144186-35144208 TTAGGGGACCTGGAGCATCCTGG - Intergenic
1183115648 22:35690635-35690657 TTGGGGGCCTTAGAATTTCAAGG + Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
954292152 3:49655394-49655416 TTGGGGGCTCAGGAGGCTCAGGG - Exonic
954457333 3:50607026-50607048 TTGGGGTCTCTGGACTACCAGGG + Exonic
956633314 3:71337657-71337679 TTGGGGTCCCTGCTGTGTCATGG - Intronic
959578552 3:107961162-107961184 TTGAGGGCCCTGAAATATCAAGG - Intergenic
960365286 3:116763393-116763415 TTGATGGCACTGTAGTATCAAGG + Intronic
961189683 3:124948104-124948126 ATGGGGGGCTTGGAGTATGATGG + Intronic
962219198 3:133549486-133549508 TGGTAGGCCCTGGAGGATCATGG - Intergenic
963286587 3:143439702-143439724 TTGGGTGCTCTGGAGAATGAGGG - Intronic
965607062 3:170508185-170508207 TTGTGGGCCTTATAGTATCATGG + Intronic
968371731 3:198226012-198226034 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
968612510 4:1563641-1563663 GTGGGGGCACTGGAGGAGCAAGG + Intergenic
979260419 4:118638490-118638512 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
983115886 4:163815575-163815597 TTTGGGGACCTGGTATATCAGGG - Intronic
985405016 4:189629179-189629201 TTGGGGAACATGGAGTCTCATGG - Intergenic
985708384 5:1414474-1414496 GTGGGGGGCCTGGAGGGTCAGGG + Intronic
991180135 5:63741201-63741223 TTGTGGGTTCTGGAGTACCAAGG + Intergenic
996001455 5:118369110-118369132 TTGTGGGCCCTGGGCTATAAGGG - Intergenic
997210941 5:132076377-132076399 GTGGGAGCCCTGGAGCATCCCGG - Intergenic
999138466 5:149340132-149340154 TTGGGTGCCCTGGAGAACGAGGG - Exonic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1002644402 5:180646092-180646114 TTGGGAGCACTTGAGTATGATGG - Intronic
1002730971 5:181331558-181331580 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1002753562 6:142546-142568 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic
1003044083 6:2716954-2716976 GTCTGGGCCCTGGGGTATCAAGG + Intronic
1004070032 6:12289411-12289433 TTGGGGGCCGAGGAGGGTCAAGG - Intergenic
1005987420 6:30883711-30883733 TTGGGAGCCCAGGGGAATCAGGG + Intronic
1006092651 6:31637097-31637119 TTGGGGGACCTGGATCATCACGG + Exonic
1006446273 6:34081478-34081500 TTGGGGAACATGGAATATCAAGG + Intronic
1009253966 6:61351949-61351971 TTGGGGGCCCTCGAGTCTTATGG + Intergenic
1009253997 6:61352292-61352314 TTGGGGGCCCTCGAGTCTTATGG + Intergenic
1009258652 6:61453770-61453792 TTGGGGGCCCTCGAGTCTTATGG + Intergenic
1009258683 6:61454113-61454135 TTGGGGGCCCTCGAGTCTTATGG + Intergenic
1009616797 6:66019274-66019296 ATGGGGACCCTGGGGCATCAAGG + Intergenic
1019476122 7:1245282-1245304 CTGGAGGCCCTGGCGTTTCAGGG - Intergenic
1019914844 7:4126111-4126133 ATGGGGGCCCTGAAGTATGGCGG + Intronic
1019978471 7:4603320-4603342 TGGGGAGCCCTGGAGTTTTAGGG - Intergenic
1029105364 7:98170839-98170861 TGGGGAGCCCTGCAGTGTCATGG + Intronic
1032052649 7:128658483-128658505 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1032116847 7:129124781-129124803 TTTGGGGCCCTGGAGTGCCTTGG - Intergenic
1037754006 8:21699923-21699945 CTGGGGGCCCTGGCCTAGCAGGG + Intronic
1039213416 8:35240655-35240677 TTGTGGGCCCTGGAGTCAGATGG - Intronic
1042932038 8:74023259-74023281 GTGGGTGCCCTGCAGTATCTTGG + Intronic
1043542794 8:81281363-81281385 TCGGGGGCCCTGGTGTTCCATGG - Intronic
1048876166 8:138838248-138838270 GTGGGGTCCCTGGAGGCTCATGG + Intronic
1049312520 8:141940840-141940862 TTGGAGGGCCTGGTGGATCACGG - Intergenic
1049791420 8:144474372-144474394 CTGGGGGCCCTCGGGTTTCAGGG + Exonic
1051123474 9:13777353-13777375 TTGGGGGCCCACAAGTATGAGGG - Intergenic
1054748747 9:68882806-68882828 TTTGGGACCCTGGAATATAAAGG - Intronic
1056309369 9:85323368-85323390 TTGGGGGCCCTGGTGGCCCATGG - Intergenic
1057024000 9:91722259-91722281 CTGGGGGCCCTGGAGCAGCAGGG - Intronic
1059455901 9:114400029-114400051 TTGGGGGGAATGGAGTCTCAGGG - Intergenic
1059799054 9:117731036-117731058 TTGGGGGCCCCTGACCATCAAGG - Intergenic
1060555421 9:124505119-124505141 CTGGGGGGCCTGGAGGATGAGGG - Intronic
1061446329 9:130640299-130640321 TTGGGGGCTCTGGGACATCATGG - Intergenic
1061508909 9:131048775-131048797 ATGGGGGCCCTGGGACATCAGGG - Intronic
1061508948 9:131048925-131048947 GTGGGGGCCCTGGGGTAGGAGGG - Intronic
1061574819 9:131499599-131499621 TTGGTGGCCCTGGTGGAGCATGG - Exonic
1061847417 9:133395437-133395459 TTGGGGCCCCTGGGGTCTCTGGG + Intronic
1062471640 9:136708505-136708527 TAGGGGGCCCTGGTGGATCGAGG - Intergenic
1062755377 9:138284065-138284087 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1203579290 Un_KI270745v1:28237-28259 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1186801160 X:13093438-13093460 TGGGGGCCCCAGGAGTCTCAGGG - Intergenic
1187017885 X:15348595-15348617 TGGGAGGCACTGGAATATCAGGG - Intronic
1190382734 X:49855363-49855385 TTGGTGGCCCTGGGGAAGCATGG + Intergenic
1194196875 X:90904947-90904969 TTTGGGGCCTTGGAATTTCAAGG + Intergenic
1198306161 X:135385148-135385170 TTGGGTGACATGGAGTACCAAGG + Intergenic
1198373672 X:136016263-136016285 TTGGGGGAGCTGGAGGATGAGGG + Intronic
1200542724 Y:4479153-4479175 TTTGGGGCCTTGGAATTTCAAGG + Intergenic
1202381897 Y:24280859-24280881 TTGCGGGCCCTGGGCTTTCAGGG + Intergenic
1202488887 Y:25389266-25389288 TTGCGGGCCCTGGGCTTTCAGGG - Intergenic