ID: 904678986

View in Genome Browser
Species Human (GRCh38)
Location 1:32215785-32215807
Sequence TGCCCTCTGCAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 398}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904678986_904678995 22 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678995 1:32215830-32215852 TGTCCCTGGAAAACCAGCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 241
904678986_904678992 8 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678992 1:32215816-32215838 AGTGGAAGAGGCCTTGTCCCTGG 0: 1
1: 0
2: 6
3: 18
4: 223
904678986_904678990 -10 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678990 1:32215798-32215820 GCAGAGGGCAGCACAGATAGTGG 0: 1
1: 1
2: 2
3: 37
4: 336
904678986_904679001 29 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904679001 1:32215837-32215859 GGAAAACCAGCCTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 52
4: 520
904678986_904679000 28 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904679000 1:32215836-32215858 TGGAAAACCAGCCTGGGGCTGGG 0: 1
1: 1
2: 2
3: 38
4: 349
904678986_904678999 27 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678999 1:32215835-32215857 CTGGAAAACCAGCCTGGGGCTGG 0: 1
1: 0
2: 5
3: 29
4: 337
904678986_904678996 23 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678996 1:32215831-32215853 GTCCCTGGAAAACCAGCCTGGGG 0: 1
1: 0
2: 2
3: 19
4: 207
904678986_904678991 -4 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678991 1:32215804-32215826 GGCAGCACAGATAGTGGAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 226
904678986_904678994 21 Left 904678986 1:32215785-32215807 CCTTCCACCTCCTGCAGAGGGCA 0: 1
1: 0
2: 2
3: 25
4: 398
Right 904678994 1:32215829-32215851 TTGTCCCTGGAAAACCAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904678986 Original CRISPR TGCCCTCTGCAGGAGGTGGA AGG (reversed) Exonic
900416134 1:2535573-2535595 TGCCCTCGCCAGAGGGTGGAGGG - Intergenic
901194746 1:7434050-7434072 GGGACTCTCCAGGAGGTGGAAGG - Intronic
902584052 1:17427248-17427270 TGCCCTCTGCTGAGGGCGGAGGG - Intronic
903547708 1:24137034-24137056 TCCCCTCTGGAGTGGGTGGAGGG - Intronic
904473320 1:30748938-30748960 CACCCACTCCAGGAGGTGGATGG - Intronic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
904916710 1:33975686-33975708 TCCCCTCTGTAGCAGGTGAAGGG + Intronic
905673474 1:39808341-39808363 TGCCCCGTCCAGGAGGTGGGGGG + Intergenic
905876233 1:41433503-41433525 TGCCCTCTCCAAGAGCTGCAAGG - Intergenic
906117509 1:43366413-43366435 TGTACTGTGCAGGGGGTGGAGGG + Intronic
906129237 1:43446198-43446220 TGCCCGCTGCAGGTGGTAGGTGG - Exonic
906151618 1:43591103-43591125 GGCCCCTTTCAGGAGGTGGATGG + Exonic
906740182 1:48174511-48174533 TGCCCTGTCCCGGAGGTGGGGGG + Intergenic
907369580 1:53992245-53992267 TGCCCCCTGCAGGAGACTGAGGG - Intergenic
910216313 1:84848159-84848181 TGAGCTCTGCAGTGGGTGGAAGG - Intronic
910566333 1:88647256-88647278 TTTCCTCTGCAGGAGGTTGTGGG + Intergenic
910673396 1:89795314-89795336 AGCCCTCTCCATGAGGTGAAGGG - Intronic
911046335 1:93631805-93631827 TGCCCTCTGGAGGTGCTGAAAGG - Intronic
911100491 1:94092205-94092227 TGGCCTCTGCAGGCTATGGAAGG + Intronic
912355804 1:109053496-109053518 TGCCCCGTCCAGGAGGTGGGGGG + Intergenic
912655061 1:111478548-111478570 TGACCTCTGGAGAAGGTGGCAGG - Intergenic
914348626 1:146821010-146821032 TGGTCTCTGCAGGAGCTGAAGGG + Intergenic
914875813 1:151512038-151512060 TGCCTTCGGCCGGAGGTGAAGGG - Intronic
914912969 1:151801709-151801731 TGCCACATCCAGGAGGTGGAAGG + Exonic
915264169 1:154703670-154703692 TGCACTCTGGAGGAGGAGGAAGG + Exonic
915515289 1:156409197-156409219 AGCACTGTGCAGGAGATGGAAGG + Intronic
915594334 1:156887753-156887775 CTCCCTCAGCAGGAGGTTGAAGG - Intergenic
915861601 1:159450005-159450027 TGCCCTGTCCGGGAGGTGGGGGG + Intergenic
916674540 1:167054573-167054595 TGTCCTCTGCAGCTGGTGGGTGG - Intronic
917977967 1:180252181-180252203 TGCCCTCTGAAAGAGGTGCCTGG - Intronic
918172499 1:182011035-182011057 TGCCCCGTCCAGGAGGTGGGGGG + Intergenic
918224911 1:182472483-182472505 GGCCCTCAGCATGAGGAGGAGGG - Exonic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920658078 1:207891185-207891207 TGCACTCAGCAGGTGGAGGAAGG - Intronic
920965686 1:210698870-210698892 TGGCCTCTGCAGGAGGATGCAGG - Intronic
922160784 1:223078063-223078085 TGCCCTGGCCATGAGGTGGAGGG + Intergenic
1063323008 10:5069896-5069918 TGCCCTGCGCAGAAGGCGGAAGG - Intronic
1063352034 10:5364924-5364946 TGTCGTCTGCATGACGTGGACGG + Intergenic
1063484151 10:6403413-6403435 TGGGCTCTGCAGGTGTTGGATGG - Intergenic
1064730051 10:18321232-18321254 TGCCATCAGTTGGAGGTGGAGGG - Intronic
1066194539 10:33086165-33086187 TGCCTTCTGGAAGAGGTGGCTGG + Intergenic
1067281825 10:44879192-44879214 TGCCCTCTCCAGGCTGAGGAGGG - Intergenic
1067298636 10:44990565-44990587 TGCCCTCTCCAGGCTGAGGAGGG + Intronic
1067426851 10:46217177-46217199 GGGCCACTGCAGGATGTGGAGGG + Intergenic
1068114638 10:52723893-52723915 TACCCTTTGAAGGAGGTGGATGG + Intergenic
1069903215 10:71717665-71717687 GGCCCTCTCAAGGAAGTGGAGGG + Intronic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070153469 10:73819388-73819410 TGGCCTCTGCTGGGGGTGGGGGG - Intronic
1070971335 10:80569890-80569912 TTCTCTCTGCTGGAGATGGAAGG + Intronic
1071286880 10:84157016-84157038 AGCTCTCTGTAGAAGGTGGAAGG - Intergenic
1072641039 10:97211474-97211496 CGCCCACTGCGGGAAGTGGAGGG - Intronic
1072693496 10:97586735-97586757 TGCCCTCTGCAAGAGTGGGTGGG - Intronic
1073451328 10:103611178-103611200 TGCCCAGTGGAGGTGGTGGATGG - Intronic
1075118041 10:119643586-119643608 TACGCCCTGCTGGAGGTGGAAGG - Intergenic
1075596735 10:123736971-123736993 TGCCCACTGCGGAAGGTGGGAGG - Intronic
1076577457 10:131479101-131479123 TGCCCTGTTCAGGAGGCCGAGGG - Intergenic
1076674889 10:132142612-132142634 TGCCCTCTGCGGGCCGTGGAGGG + Intronic
1076735864 10:132458668-132458690 TGCCCTCTGCTGGTGGAGGTGGG - Intergenic
1077404237 11:2375759-2375781 TGTCCTCAGCAGGGGGTGGTAGG - Intergenic
1078205801 11:9228353-9228375 TCCTCTCTGCAGGTGGTGGTGGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079591860 11:22192402-22192424 TGCCCTCTACAGGTGGGGGAAGG - Intergenic
1080640280 11:34154621-34154643 TTCCCTCTGAAGGGGGTGAATGG + Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1083745409 11:64733448-64733470 TGGGGCCTGCAGGAGGTGGAGGG + Intronic
1084389976 11:68868971-68868993 TGCCCTCTTCTGGTGTTGGATGG + Intergenic
1084548445 11:69826119-69826141 TGAGCTCTGGAGCAGGTGGACGG + Intergenic
1084768464 11:71327329-71327351 TGCCACCTGCACCAGGTGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085595054 11:77801784-77801806 CGCTCTCTGGAGGAAGTGGATGG - Intronic
1085601844 11:77862483-77862505 TGCCCTCTCCAAGTGGTGGGAGG - Intronic
1086045290 11:82524976-82524998 AGGCCCCTGAAGGAGGTGGAGGG - Intergenic
1086369344 11:86141043-86141065 GGCCCTCTGCATGAGAGGGATGG - Intergenic
1087609934 11:100422317-100422339 GGCCCTTTGAAGGAGGTGGATGG + Intergenic
1088761703 11:112935560-112935582 TGCCCTCTCCTGAAGGTGGTTGG + Intergenic
1088983629 11:114886887-114886909 TTCCCTCTGGAGGAGGTGTCAGG - Intergenic
1089556521 11:119318333-119318355 TGCTCGCTGGGGGAGGTGGAGGG + Intronic
1089691380 11:120188861-120188883 TGCCCAGGGCAGGAGGTGGTGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091699207 12:2648919-2648941 TGCTCTAGGCAGGAGATGGAAGG + Intronic
1092117943 12:6022763-6022785 TGCCCTGTGCAGTGTGTGGAGGG - Exonic
1092199346 12:6570442-6570464 CGCCATCTGCAGGAGCTGGCGGG - Exonic
1092257254 12:6934159-6934181 TGACATCTACAGGAGGAGGAAGG - Exonic
1092289588 12:7151135-7151157 TGTCCTCTCCCAGAGGTGGAGGG - Intronic
1093963122 12:25297379-25297401 TGCCCTCAGCCAGAGGTAGAAGG + Intergenic
1094524759 12:31224099-31224121 TGACCACTGCACGGGGTGGATGG - Intergenic
1095678623 12:44948934-44948956 TGCCCTCTGGAGGCCGTGAAAGG + Intergenic
1096197738 12:49659336-49659358 TAGCCTCTGCAGGAGTTGAATGG + Intronic
1101013619 12:100476316-100476338 TGCCCTATGCAGGAGGTTTCAGG - Intronic
1101441444 12:104707000-104707022 TGGCCTTGGCAGGAGGTGGGAGG - Intronic
1101602695 12:106224295-106224317 TGCCCTCTTCTGGTAGTGGATGG + Intergenic
1102551401 12:113694718-113694740 TGACCCCTGCAGGAGGGGCATGG - Intergenic
1102633099 12:114299379-114299401 TGCCTCCTGCAGGATGAGGATGG + Intergenic
1102998141 12:117365157-117365179 AGCCCTGGGCAGGAGGAGGAAGG + Intronic
1103458861 12:121088216-121088238 TGACCTCAGCTGGAGGAGGAGGG - Intergenic
1103936494 12:124480208-124480230 CTCCCGCTGCAGGAGGAGGATGG + Intronic
1104493181 12:129212410-129212432 TGCCTTTTCCAGGAGGTGAATGG + Intronic
1104645800 12:130496533-130496555 TCCCTCCTGCAGGAAGTGGATGG - Intronic
1105242419 13:18620114-18620136 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1106119457 13:26847434-26847456 TCACCTCTGCTGGAGGGGGAGGG + Intergenic
1106435503 13:29720202-29720224 TGGCCTCTGCAGGAGGAGGGAGG + Intergenic
1106436075 13:29723878-29723900 AGCCATTTGCAGGGGGTGGAGGG + Intergenic
1107412021 13:40166699-40166721 TGCCCTGTTCACAAGGTGGAAGG - Intergenic
1108503433 13:51088070-51088092 TGCTTTCTGCAAGAGGTGAAGGG + Intergenic
1108713690 13:53058453-53058475 TGCCCAGTGCAGGAGAAGGAGGG - Intergenic
1110552829 13:76827738-76827760 TGCCCACTTCTGGAGTTGGAAGG - Intergenic
1113792426 13:113036002-113036024 TGGCCTCAGCAGGTGGAGGATGG + Intronic
1113795556 13:113055786-113055808 TGCTCCCTGCAGAAGGTGAATGG + Intronic
1113814878 13:113162992-113163014 AGCCGCCTGCAGGAGGAGGATGG - Exonic
1114696926 14:24634113-24634135 TGCCCTGGGCAGCAGGAGGAAGG + Exonic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115089665 14:29558759-29558781 TGCCCTGTGCAGTATGTCGAGGG - Intergenic
1115882331 14:37933415-37933437 TCCCCTCTTCTGGTGGTGGAGGG - Intronic
1119028180 14:71170194-71170216 GGCCCTCTCCAGGAGGTGAGCGG + Intergenic
1121333284 14:93061357-93061379 TGGGCTCTGGAGGAGGTGGGTGG - Intronic
1121336992 14:93083630-93083652 TGCCCTCTGCAGGCAGGGAAAGG - Intronic
1122204849 14:100143254-100143276 TGACCCCTGCAGGAGCTGGGAGG + Intronic
1122314543 14:100818002-100818024 GGCTCTCTGCAGGAGGAGGGAGG + Intergenic
1122996635 14:105268756-105268778 TGCCGTCAGCAGGACGTGGAGGG - Intronic
1123488880 15:20764478-20764500 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1123505788 15:20940897-20940919 TGCCCTCAGCAGCGGGTGGGGGG + Intergenic
1123545379 15:21333565-21333587 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1123563023 15:21514603-21514625 TGCCCTCAGCAGCGGGTGGGGGG + Intergenic
1123599270 15:21951886-21951908 TGCCCTCAGCAGCGGGTGGGGGG + Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1125424532 15:39535737-39535759 TCCCCTCTCCAGGCAGTGGAGGG + Intergenic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1128758071 15:70196545-70196567 TGCCCACTGCCCGAGGTGAAAGG - Intergenic
1129172898 15:73818595-73818617 TGCTCTCTGCAGCAGCTGCAGGG - Intergenic
1129325592 15:74798770-74798792 TTCCCTCTGCAGGGGGAGGTGGG + Intronic
1131401119 15:92126313-92126335 CTCCCTCTGCAGTAGGTTGAGGG + Intronic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1202953724 15_KI270727v1_random:60836-60858 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1202971374 15_KI270727v1_random:241738-241760 TGCCCTCAGCAGCGGGTGGGGGG + Intergenic
1132927365 16:2437940-2437962 GGCCCTCTGCAGGGGAGGGAGGG + Intronic
1133178227 16:4032363-4032385 GGCCCCCTGCGGCAGGTGGAGGG + Intronic
1133200351 16:4200421-4200443 TGGCCTATACAGGAGGTGGGAGG + Intronic
1134079582 16:11315765-11315787 GGCCCCCAGCAGGAGGGGGAAGG + Intronic
1135854650 16:25996263-25996285 GGCCCTCTGGTGGAGGAGGAAGG - Intronic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1136716905 16:32288810-32288832 TTCCCTCTGCAGGCAGGGGAGGG - Intergenic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1137618660 16:49861411-49861433 AGCCCTATGGAGGAGGAGGAAGG + Intergenic
1137673580 16:50292903-50292925 TGCCATGTGCATGAGGTGCATGG + Intronic
1138150445 16:54651625-54651647 TGCCTTTTGGAGGAGGAGGATGG + Intergenic
1139444525 16:66988747-66988769 TGCCCACAGCAGGAGCTGGCTGG + Exonic
1139677674 16:68536266-68536288 TGCCTTCCGCACTAGGTGGAAGG + Intronic
1139985412 16:70894538-70894560 TGGTCTCTGCAGGAGCTGAAGGG - Exonic
1141042597 16:80684764-80684786 AGCCCTCTTCAGGAGGTGACAGG - Exonic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1142317994 16:89361230-89361252 GGCCCTCTGCGGGAGGAAGAAGG - Intronic
1203145453 16_KI270728v1_random:1795376-1795398 TTCCCTCTGCAGGCAGGGGAGGG - Intergenic
1142749002 17:1976436-1976458 TTCTCTCTGCATGAGGTTGAGGG + Intronic
1143560011 17:7688177-7688199 CGCCCTCTGCAGGCGGCGGGGGG + Exonic
1144159528 17:12543999-12544021 TGCTCTCTCCAGGAGGTGACAGG - Intergenic
1144511671 17:15882241-15882263 TGCCCCCTGGAGGTGGTGGCCGG + Intergenic
1146096701 17:29937121-29937143 TGGCCTGTGAAGAAGGTGGATGG - Intronic
1146269744 17:31477022-31477044 TGCCCTGTGGAGAAGGTGGTGGG - Intronic
1146934563 17:36804737-36804759 TGCCCTCTGGGGTAGCTGGATGG - Intergenic
1148078353 17:44953016-44953038 TGCCCTGAGTAGGGGGTGGAGGG + Intergenic
1148469133 17:47882690-47882712 TGGCCTCTGAAGGAGTTGGGAGG + Intergenic
1148533436 17:48417267-48417289 TTTCCTCTACAGGAGGTAGAAGG - Intronic
1148587839 17:48793620-48793642 TGCCCTGTCCATGAAGTGGATGG + Intronic
1149539571 17:57458826-57458848 TGCCCTGTGCAGGCCGTGGGAGG + Intronic
1150894609 17:69196198-69196220 CGCCCCCTCCAGGAGGTGGGGGG - Intronic
1150897760 17:69234043-69234065 TGCCTTCTGCAGGAGATCCAAGG - Intronic
1151232664 17:72695864-72695886 TGCTCTCTGCAGGCTCTGGAAGG - Intronic
1151346587 17:73506356-73506378 TCCCCTCTGCAGGAGGGGAGGGG + Intronic
1151415175 17:73957341-73957363 TGCCCTAGACAGGTGGTGGAGGG - Intergenic
1152790079 17:82273946-82273968 TGCCCTTTGCAGGAGGGGACAGG + Intergenic
1153468621 18:5417386-5417408 TTTCCTCTGCAGGTGGCGGAGGG + Intronic
1153955836 18:10095365-10095387 TGGCCTGTGCAGAAGGTAGATGG + Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154446530 18:14439764-14439786 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1155965907 18:32035099-32035121 TGCCTTCAGCAGGAGTTGGTAGG + Intronic
1157221048 18:45828725-45828747 TGCCCACTGCAGGAGGGTGCGGG - Intronic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1157470458 18:47984258-47984280 GGCCAACTGCAGGAGGAGGAAGG + Intergenic
1157857714 18:51117269-51117291 TGCCCTGTCCGGGAGGTGGGGGG - Intergenic
1158445010 18:57511929-57511951 TGCCCTCTGCAGGGAATGGTAGG - Intergenic
1158836286 18:61334224-61334246 TCCCCTCTGCAGGCGGAGGGAGG - Intronic
1160030073 18:75250126-75250148 TGACCCCTGCAGTAGGTGGGGGG + Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160425166 18:78774151-78774173 TGCACTCGGCAGGACGTGGGGGG - Intergenic
1160558167 18:79739575-79739597 TCCCAGCTGCAGGAGGTGGTTGG + Intronic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1161381030 19:3964986-3965008 TGGCCGCTGGAGGAGGGGGAGGG + Exonic
1161962140 19:7528809-7528831 TGCCTTCTGCAGGAGTTTGTGGG + Exonic
1162255135 19:9483471-9483493 TGCCCTGTCCAGGAGGTGGGGGG + Intronic
1163945152 19:20529672-20529694 TGCCCTGTCCAGGAGGTGAGGGG - Intergenic
1164012111 19:21212588-21212610 CGCCCTGTCCAGGAGGTGGGGGG - Intergenic
1164168508 19:22703001-22703023 TGCCCTGTCCGGGAGGTGGGGGG - Intergenic
1164239276 19:23369411-23369433 TGCCCCGTCCGGGAGGTGGAGGG + Intronic
1164244702 19:23419462-23419484 TGCCCCGTCCAGGAGGTGGGGGG + Intergenic
1165069052 19:33245019-33245041 TGGCCTCTGCTGGAGATGGGTGG - Intergenic
1165124541 19:33584343-33584365 TGGCCTCAGCAGGAGGTGAGTGG - Intergenic
1166270981 19:41713891-41713913 TGCCCTCTGCAAGGGGAGAAGGG + Intronic
1166466027 19:43031692-43031714 GGCCCTCCACAAGAGGTGGAGGG + Intronic
1166866096 19:45838359-45838381 GGTACTCTGGAGGAGGTGGATGG + Intronic
1167370036 19:49075203-49075225 GGCCCTCCACAAGAGGTGGAGGG - Intergenic
925023297 2:588312-588334 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925654660 2:6133244-6133266 TGCCCTGTGACGGAGGGGGAGGG + Intergenic
925654670 2:6133273-6133295 TGCCCTGTGACGGAGGGGGAGGG + Intergenic
928486544 2:31738119-31738141 TGGCATCTGGAGGAGCTGGAGGG - Intergenic
928610651 2:32988716-32988738 GGACCTCTGCAGCATGTGGAAGG - Intronic
929046137 2:37792455-37792477 TGCCCTGTCTAGGAGTTGGAAGG - Intergenic
929057211 2:37888699-37888721 TGCACTTTGCAGGTGGAGGAAGG + Intergenic
929248862 2:39731223-39731245 TGCCCTCTTCACAAGGGGGAGGG + Intergenic
929804261 2:45130854-45130876 TACACTCTGGAGGAGGAGGAAGG + Intergenic
929868324 2:45737004-45737026 TGCCGCCTTCAGGAGATGGACGG + Intronic
930727921 2:54699219-54699241 TGCCCCGTCCCGGAGGTGGAGGG + Intergenic
930902375 2:56522990-56523012 TGGCCTGGGCAGGAGCTGGAAGG + Intergenic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
931239360 2:60438777-60438799 TTCACTCTTCAGGAGGTGGCTGG + Intergenic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
932718966 2:74124107-74124129 TGCCCGGTCCAGGAGGTGGGGGG + Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
935982168 2:108638358-108638380 TGCCCTCTGCAGGCAGTCTAGGG + Intronic
937332406 2:121039821-121039843 TTCGTTCTGCAGGAAGTGGAAGG - Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
938483430 2:131680469-131680491 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
939696482 2:145331490-145331512 TGCCCTCTGAAGGAGGTGCTGGG - Intergenic
940276645 2:151947142-151947164 TGCCTTCTGCAGGCTGTGGAGGG - Intronic
940643731 2:156369406-156369428 CGCCCTATGCAGGAGGTGAGGGG + Intergenic
940739594 2:157492368-157492390 TGCCCTCTGCTGGATTTGGCGGG - Intergenic
941183580 2:162291633-162291655 TGACCTCTGGAGGAGGAGGAAGG + Intronic
942681021 2:178478653-178478675 AGCCCGCTGCGGGAGGCGGAGGG - Intergenic
943564067 2:189496769-189496791 GCCCCTCTCCAGAAGGTGGAAGG - Intergenic
944605036 2:201345179-201345201 AGCCCTCTGCAGGAAGAGAATGG - Intronic
945745379 2:213714142-213714164 AGCTCTCTCCAAGAGGTGGATGG + Intronic
945947498 2:216008579-216008601 TGCCCTCTGCAGGCAATGAATGG + Intronic
946351773 2:219160233-219160255 TGCCCTCTGCAGGGCGTCGGAGG - Intronic
946421634 2:219568282-219568304 CGGCCCCTGCAGGACGTGGAGGG - Exonic
946956901 2:224940776-224940798 TGCTCTCTGTAGGAGGTGCCTGG + Intronic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
948541286 2:238692963-238692985 TGCTGTCTGCAGCAGGTGCATGG + Intergenic
948824986 2:240569697-240569719 TCCCCACTGGTGGAGGTGGAGGG - Intronic
948908548 2:240991629-240991651 TGCTCTCTGCCGGAGGGGAAGGG - Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1170728028 20:18947290-18947312 TGTGCTTTGCAGGAGGTGGTGGG - Intergenic
1171018987 20:21568027-21568049 TGACATCTGAAGGAGGTAGAGGG - Intergenic
1171904960 20:30893215-30893237 TGCCTTCTGCAAGGGGTGGGGGG - Intergenic
1172524716 20:35592417-35592439 TGCCCTTAGAAGGAGGTGGTAGG + Intergenic
1175240747 20:57546465-57546487 TGGCCTCTGCAGGTTGAGGAGGG + Intergenic
1176265443 20:64206787-64206809 TCCCCTCCGAAGTAGGTGGATGG + Intronic
1176449452 21:6850079-6850101 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1176827622 21:13715103-13715125 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1177148323 21:17430091-17430113 TGCTCACTGCAGGGTGTGGATGG + Intergenic
1178038147 21:28608557-28608579 GACCCTTTGAAGGAGGTGGATGG + Intergenic
1178417459 21:32415363-32415385 TGCCCTGTGAAGGAGGAGGGAGG + Intronic
1178424351 21:32467512-32467534 AGCCCTCTGCAGGAAGCGGGTGG - Intronic
1178873134 21:36392555-36392577 TGCCCCGTCCAGGAGGTGGGGGG - Intronic
1179898125 21:44374780-44374802 TGCTCACAGCAGGAGGTGGGTGG - Intronic
1180156585 21:45981278-45981300 GGTCCTCTGCAGGAGGCGGTTGG + Intergenic
1180217180 21:46332497-46332519 TGTCCTCTTAAGGAAGTGGATGG + Intronic
1180569378 22:16701177-16701199 TGCCCTGTGCAGTGTGTGGAGGG - Intergenic
1180872340 22:19153501-19153523 TGACCCGTGCAGGGGGTGGATGG - Intergenic
1180950717 22:19719285-19719307 TGCCCTCTGCCCGAGGAGGGAGG + Intronic
1180982228 22:19884216-19884238 TGGCCTCTGCAGGAGGTGGCAGG + Intronic
1181043568 22:20204212-20204234 TGTCCCCGGCAGGAAGTGGAGGG - Intergenic
1182069116 22:27450978-27451000 TGCCCTTTAAAGGGGGTGGAAGG + Intergenic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1182563992 22:31184104-31184126 TGCCCCGTCCAGGAGGTGGTGGG - Intronic
1183321213 22:37166270-37166292 TCCTCTCGGCAGGAGGTGGGGGG - Intronic
1183741461 22:39670786-39670808 GGGCCTCTGCAGGTGGTGCAGGG - Exonic
1184091339 22:42294531-42294553 TGCCCTCTCCCGGAGCTGGGAGG - Intronic
1184595168 22:45509500-45509522 TGGCCTCTGCAGGAGGAAGCAGG - Intronic
1184718004 22:46292865-46292887 GGCTCACTGCATGAGGTGGACGG - Exonic
1184967486 22:47991371-47991393 TCCCCTTTGCAGCAGGTGCAAGG + Intergenic
950383185 3:12634800-12634822 TCCCCTTTGGAGGAGGTGAATGG + Intronic
950491134 3:13305740-13305762 TGCCCTCAGCAGGAGGGAGGTGG - Intergenic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
952301892 3:32110735-32110757 TGCCCACTGCCGCAGGTGCAGGG + Intronic
953375605 3:42425928-42425950 TGACCTCTGCAGGAGGAGAGAGG - Intergenic
954442014 3:50527129-50527151 TGGCTCCTGCTGGAGGTGGAAGG + Intergenic
954604169 3:51895700-51895722 TGACTTCTCCAGTAGGTGGAAGG - Intronic
954675518 3:52313374-52313396 TTCCCTTTACAGGAGGAGGAGGG - Intergenic
955670052 3:61393575-61393597 CGCCCAGTGCAGGAGGTGGGGGG - Intergenic
955702884 3:61699599-61699621 TGCCTTCTACAGCAGGGGGAAGG - Intronic
957053183 3:75425862-75425884 TGCAGTCTGCAGGAGCTCGAGGG + Intergenic
959311230 3:104740278-104740300 TGGCCTCTGGAGGAGATGAATGG + Intergenic
961075355 3:123977049-123977071 TTCCCTCAGAAGAAGGTGGAAGG - Intronic
961225530 3:125241957-125241979 TTATCTCAGCAGGAGGTGGATGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962788022 3:138785261-138785283 CGCCCCCTCCAGGAGGTGGGGGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
965676986 3:171207899-171207921 TTCCCTCTGCAGCATTTGGAAGG - Intronic
966254251 3:177899450-177899472 TGCCCTCTGCTGGTGCTGGGTGG + Intergenic
966617203 3:181925936-181925958 TGCCCCGTCCAGGAGGTGGGGGG - Intergenic
966912726 3:184568608-184568630 TGCCTTCGGCAGGAGGTGAGGGG - Intronic
968641147 4:1715705-1715727 GGCCCTCTGCAGGAGCAGGGTGG - Intergenic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
969349730 4:6591472-6591494 CGTCCTCTGCAGGAGTCGGAGGG - Intronic
969455375 4:7297139-7297161 TCTCCTCTGCATTAGGTGGAGGG + Intronic
970515741 4:16828397-16828419 AGCACACTGGAGGAGGTGGAAGG - Intronic
972104282 4:35462472-35462494 TGCCATCTGGAGGTGGGGGAGGG + Intergenic
972121798 4:35712769-35712791 ACCCCTCTGCAGGAGTTGGTGGG - Intergenic
972614896 4:40688536-40688558 TTCCTTCTGCAGGATGTGAATGG - Intergenic
972691959 4:41407623-41407645 TGCCCTCTGCGGAAGGTGCCAGG + Intronic
973168923 4:47114232-47114254 TGACCTGTGCAGGAAGTAGATGG - Intronic
973639517 4:52888895-52888917 TGTCGTCTGCAGGAGCTGGGTGG - Intronic
973644192 4:52933570-52933592 TTCCTTCTGCAGGATGGGGATGG + Intronic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
975522713 4:75317823-75317845 TGCCCCATCCAGGAGGTGGGGGG + Intergenic
979425034 4:120553497-120553519 AGCCCCCTGCATGAGGTGGTTGG - Intergenic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
985491405 5:181831-181853 TGCCCTCTGCAGGATGAGTGAGG - Intronic
985613315 5:903091-903113 GGCCCTCCACAAGAGGTGGAGGG + Intronic
985998644 5:3612828-3612850 TGAGCCCTTCAGGAGGTGGAAGG - Intergenic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
988157872 5:27477697-27477719 TGCACACTGGAGGAAGTGGATGG + Intergenic
988615672 5:32772444-32772466 GACCCTCTGCAAGAGGTGGAGGG - Intronic
989585946 5:43074029-43074051 TGCCCTCTTCAGGAAGTAGCAGG - Intronic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
991550226 5:67827316-67827338 AGCCCCCTTCAGGGGGTGGATGG - Intergenic
992894307 5:81233342-81233364 TGCGCTCAGCAGGACGTGGGAGG + Exonic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
994666266 5:102709145-102709167 TGACCTCTGCAGAAGCTTGAAGG - Intergenic
995145359 5:108782367-108782389 TGGTCTATGCAGGAGGTTGAAGG - Intronic
997856348 5:137376289-137376311 TGCTGTCTGCAGGAGGAGGGTGG - Intronic
998158567 5:139800038-139800060 AGCCCACTGCAGGGGATGGATGG + Intronic
999398139 5:151243879-151243901 TTCTCTCAGCAGGAGGTGGCAGG + Intronic
1000170298 5:158695690-158695712 TGCCCTCTGCCGGCGGTAGCTGG - Intergenic
1000578443 5:163006150-163006172 TGCCCTCTGCTGGTAATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001303753 5:170556517-170556539 TCTCCTCTCCAGGAGGTGGGGGG + Intronic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002046406 5:176543814-176543836 TACCTTCTTCAGGAGGAGGATGG + Intronic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002299412 5:178248892-178248914 TGCCATCTGAGGCAGGTGGAAGG + Intronic
1003831222 6:10014143-10014165 TGATGTCTGCAGGGGGTGGAGGG - Intronic
1004152507 6:13134143-13134165 CGCCCCCTCCAGGAGGTGGGGGG + Intronic
1004263800 6:14131685-14131707 TGCACTCTGCAGGACCCGGATGG + Exonic
1004324810 6:14665070-14665092 TGTCCTGTACAGAAGGTGGAAGG - Intergenic
1004449170 6:15728853-15728875 TGAGCTCTGCAGGAGAGGGAAGG - Intergenic
1006016437 6:31085021-31085043 TGCCCTTTGAAGGAACTGGATGG + Intergenic
1006293235 6:33157012-33157034 TGCCTTTTGGTGGAGGTGGAGGG - Intergenic
1006419831 6:33925949-33925971 TGCTGTCTTCAGGAGGAGGAGGG + Intergenic
1006636926 6:35467903-35467925 TCCCCTCTGCAGGCGTTGAAAGG + Intergenic
1006875284 6:37290169-37290191 GGCCCTCTCAAGCAGGTGGAAGG - Intronic
1006910346 6:37559386-37559408 TGCCCTGTGCAGGGGATGAAGGG - Intergenic
1007424098 6:41735617-41735639 TGCCCTCTGCCGGGCGCGGAGGG - Intronic
1007630360 6:43269958-43269980 TGCCCCCTCCAGGAGGGGGGGGG - Intronic
1007651515 6:43425355-43425377 TGCCCCGTCCAGGAGGTGGGGGG + Intergenic
1007651535 6:43425399-43425421 TGCCCTGTCCTGGAGGTGGGGGG + Intergenic
1008106280 6:47443943-47443965 TGCCCCGTCCAGGAGGTGGGGGG - Intergenic
1009913722 6:69966176-69966198 TGCCCCGTGCGGGAGGTGGGGGG + Intronic
1011095765 6:83660178-83660200 TGACCTCTGCAGTAGGTCCATGG - Intronic
1013589482 6:111608136-111608158 GGCCCTCCACAAGAGGTGGAGGG - Intergenic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1015171442 6:130259309-130259331 TGCCCTCTACAGTGAGTGGAAGG - Intronic
1016322032 6:142856841-142856863 AGCCCACAGCAGGAAGTGGAGGG + Intronic
1016885960 6:148959884-148959906 TGCCCACTGCAGGGGGTGTGAGG + Intronic
1017056042 6:150436340-150436362 TGCTCTGTGAAGGAGGAGGAAGG + Intergenic
1019062340 6:169265481-169265503 TGCCAGCTTCAGGAGGAGGAGGG - Intergenic
1019892385 7:3956630-3956652 TGGCCCCTGCAGGCGGTGGCAGG + Intronic
1020122155 7:5510784-5510806 TGCCCTTTCCTGGTGGTGGAGGG - Intronic
1022747804 7:33190388-33190410 TGGCCTCTGCAGGAAATGGGAGG - Intronic
1025033207 7:55573354-55573376 TGCGCAGTACAGGAGGTGGAAGG + Intergenic
1025775190 7:64554395-64554417 TGCCCCGTCCAGGAGGTGGGGGG + Intronic
1026494822 7:70893134-70893156 TGCCTGCTGCAGGAGTTGGCAGG + Intergenic
1027400360 7:77799449-77799471 CGCGCGCTGGAGGAGGTGGAAGG + Intronic
1027417901 7:77991785-77991807 TGCCCTCTGCATGAGAAAGATGG + Intergenic
1028305379 7:89256800-89256822 TTTCCTCTGGAGGAGGAGGATGG + Intronic
1029639741 7:101813589-101813611 TGCTCTCTGCAGGGGGTGGTGGG - Intergenic
1032521102 7:132545859-132545881 TGGACCCTGCAGGAGGTGGCTGG + Intronic
1033472228 7:141660368-141660390 GGCCCTCTGCATGAGCAGGAGGG + Exonic
1034530809 7:151695354-151695376 CTCCCCCTGCAGGAAGTGGATGG - Intronic
1034683327 7:152947700-152947722 GACCCTCTGAAGGAAGTGGATGG - Intergenic
1034742250 7:153487149-153487171 TGGCCTTTTCAGGATGTGGATGG - Intergenic
1034814310 7:154158827-154158849 TTCCCTGGGCAAGAGGTGGAGGG - Intronic
1036029812 8:4956827-4956849 TGACTTCTGCAGGAGGTGCGTGG - Intronic
1037662730 8:20941332-20941354 TGCCCTCTGCATCTGCTGGAAGG - Intergenic
1037689520 8:21170546-21170568 TCCCCTCTGCAGGATGTGAACGG + Intergenic
1037890790 8:22622832-22622854 AGCCTTCTGCAGGAGGAGGTAGG - Intronic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038488929 8:27955639-27955661 TTCAGTCTTCAGGAGGTGGAGGG - Intronic
1039557688 8:38488416-38488438 TGACCTCTGTAGGAGGAGGAAGG + Intergenic
1039753143 8:40496414-40496436 TGCCCTGTCCGGGAGGTGGGGGG - Intergenic
1040275428 8:46011373-46011395 TGCCCACTGCAGGGGGTGCTGGG + Intergenic
1040416904 8:47203347-47203369 TGCCCTCTGCTGGAGGAAGGAGG - Intergenic
1043989545 8:86735609-86735631 TGCTCTCTGGAGGTGGAGGAAGG - Intronic
1045475634 8:102550086-102550108 TGAGCTCTGAATGAGGTGGAAGG + Intergenic
1049321979 8:142001471-142001493 TGCCCTCTGGAGGAGTGGGTGGG + Intergenic
1049328003 8:142034086-142034108 ACCGCCCTGCAGGAGGTGGATGG - Intergenic
1049586715 8:143435787-143435809 GGGCCACTGCGGGAGGTGGATGG - Intergenic
1049931356 9:459973-459995 TGCCCCCATCAAGAGGTGGATGG - Intronic
1050308999 9:4333962-4333984 TGACCTCTGCAGGAGAGGAAAGG + Intronic
1050388314 9:5112340-5112362 AGCCCACTGCAGGAGTCGGAAGG - Intronic
1050528008 9:6562992-6563014 TTCACTCTGCAGGAGGGAGAGGG - Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1053321000 9:37098743-37098765 GCCCCTCTGAAAGAGGTGGAGGG - Intergenic
1053589150 9:39493191-39493213 TGCCCCCTGCAGGGAGGGGAAGG + Intergenic
1054577148 9:66872104-66872126 TGCCCCCTGCAGGGAGGGGAAGG - Intronic
1055941994 9:81659287-81659309 TAGCCTTTGCAAGAGGTGGAAGG - Intronic
1056381672 9:86062342-86062364 TGCCCTGTGCAGGAGATGCTGGG - Intronic
1056827102 9:89884027-89884049 TGCCCACTGCAGGAGGGTGCTGG + Intergenic
1057230363 9:93317926-93317948 TGCCCACAGCAGGCGGTGGGGGG - Exonic
1057716166 9:97498080-97498102 CGCCCCCTCCAGGAGGTGGGGGG - Intergenic
1057753448 9:97810438-97810460 TGCCCTGTGCAGGAGGTTGGTGG - Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059530398 9:115030257-115030279 TGACCTCTGATGGGGGTGGATGG - Exonic
1059879903 9:118678156-118678178 CGCCCTGTCCAGGAGGTGGGGGG - Intergenic
1062645486 9:137545969-137545991 GGCCCTCCACAGGAGGTGGAGGG - Intronic
1203519735 Un_GL000213v1:34438-34460 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1185933736 X:4232330-4232352 TGACCTCTACAGTAGGTTGAGGG + Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1189722408 X:43933628-43933650 TGCCCTCTGCAGAATGTGCCAGG - Intergenic
1190159084 X:48017160-48017182 CGCCCTGTCCAGGAGGTGGGGGG + Intronic
1190161180 X:48032547-48032569 TGCACTCTCCAGGAGGCAGAAGG - Intronic
1192766527 X:74146063-74146085 TCCCCTCTGCAGGAGTTGTTAGG - Intergenic
1193600138 X:83501318-83501340 TTCCCTCTGTTGGAGGCGGAGGG - Intergenic
1197044334 X:121977590-121977612 TGGCCTGTGCAGAAGATGGATGG + Intergenic
1199540482 X:148952975-148952997 TGCCCTTTGAAGGAGCTGGGGGG + Intronic
1199541392 X:148961222-148961244 TGGCATCTACAGGAGGTGAATGG - Intronic
1199979335 X:152912305-152912327 TGCCCTCTGCAGGGGACGGATGG + Intergenic
1200941679 Y:8789040-8789062 TGCCATCTACAGGAGATGGTGGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202604072 Y:26624060-26624082 TGCACTCTGCAGGGTGAGGACGG + Intergenic