ID: 904681924

View in Genome Browser
Species Human (GRCh38)
Location 1:32235110-32235132
Sequence CCCTCTGGGCGGTGGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904681910_904681924 21 Left 904681910 1:32235066-32235088 CCACAGGCCTCCACCAGGCGCAT 0: 1
1: 0
2: 0
3: 15
4: 203
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681911_904681924 14 Left 904681911 1:32235073-32235095 CCTCCACCAGGCGCATGAAGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681909_904681924 22 Left 904681909 1:32235065-32235087 CCCACAGGCCTCCACCAGGCGCA 0: 1
1: 0
2: 1
3: 14
4: 132
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681919_904681924 -10 Left 904681919 1:32235097-32235119 CCTGCAGGGGACGCCCTCTGGGC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681908_904681924 23 Left 904681908 1:32235064-32235086 CCCCACAGGCCTCCACCAGGCGC 0: 1
1: 0
2: 2
3: 28
4: 247
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681912_904681924 11 Left 904681912 1:32235076-32235098 CCACCAGGCGCATGAAGCTCTCC 0: 1
1: 0
2: 0
3: 11
4: 107
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681913_904681924 8 Left 904681913 1:32235079-32235101 CCAGGCGCATGAAGCTCTCCTGC 0: 1
1: 0
2: 1
3: 22
4: 419
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188
904681906_904681924 29 Left 904681906 1:32235058-32235080 CCGAGTCCCCACAGGCCTCCACC 0: 1
1: 0
2: 2
3: 84
4: 377
Right 904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904681924 Original CRISPR CCCTCTGGGCGGTGGGAGTC TGG Intergenic
900370387 1:2329569-2329591 CCCACTGGGCAGTGGGTCTCAGG - Intronic
900394869 1:2449142-2449164 ACCTCTGGGTGGTGGGGGGCGGG - Intronic
900458330 1:2787911-2787933 CCCTGTGGGAGGTGGGATTGTGG + Intronic
900625799 1:3608010-3608032 CCCTGTGGGCGGCGGGGGTGAGG + Intronic
900651955 1:3734184-3734206 CTTTCTAGGCGGTGGCAGTCAGG + Exonic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901771297 1:11531649-11531671 CCCACGGGGCAGTGGGCGTCAGG + Exonic
903325263 1:22565545-22565567 CCATCGAGGCGCTGGGAGTCAGG + Intronic
903586162 1:24416778-24416800 CCCTCAGCTGGGTGGGAGTCCGG - Intronic
903761181 1:25699838-25699860 CTCTCTGGAAGGTGGGAGCCAGG + Intronic
904340988 1:29834426-29834448 CCCTCTTGGAGGTGAGAGTCTGG + Intergenic
904681924 1:32235110-32235132 CCCTCTGGGCGGTGGGAGTCTGG + Intergenic
904839744 1:33364644-33364666 CCATATGGGAGGTGGGAGTGGGG + Intronic
905031281 1:34885859-34885881 GCCTCTTGAGGGTGGGAGTCGGG - Intronic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
906518295 1:46452478-46452500 CCCTCTGGACCATGGGAGGCAGG - Intergenic
906566180 1:46802806-46802828 CCCTCTCGGCGTGGGGAGTCAGG + Intronic
907319716 1:53594724-53594746 CCCTCGGGGAGGTGGGTCTCGGG + Exonic
912082510 1:105954094-105954116 CCTGCTGGGTGGTGGGAGTAGGG - Intergenic
912911007 1:113759202-113759224 CCCTCAGGGCGCTGGGCGGCCGG - Exonic
915019938 1:152769640-152769662 TCTTCTGGGGTGTGGGAGTCAGG + Intronic
915451200 1:156006666-156006688 ACCTATGGGCGGGGGGAGTGGGG - Intronic
916218515 1:162419908-162419930 CCCTCTGGGTGGTGTGGGGCTGG + Intergenic
916741242 1:167648974-167648996 CCCTCAGGGAGGTTGCAGTCTGG + Intronic
918487710 1:185046156-185046178 CCTTCTGGGGGGTCGGAGTCGGG + Intronic
920564348 1:206961514-206961536 CCTGCTGGGCGGTGGGCCTCTGG - Intronic
921766464 1:218978439-218978461 CTCTCTGGGCTGTGGGATTATGG - Intergenic
922937834 1:229434755-229434777 CCCTCTGTGCGGTGGGGGAAGGG - Intergenic
923283639 1:232469031-232469053 CCCTCTGTAGGGTGGGAGTGTGG + Intronic
1063023066 10:2148559-2148581 ACCTGTGGGTGGTGGGAATCTGG - Intergenic
1070552421 10:77501349-77501371 ACCTCTGGGTGTTGGGAGGCAGG - Intronic
1070963675 10:80516542-80516564 CCCTCTGGGCGGGGGCAGGCTGG + Intronic
1071568182 10:86682199-86682221 CCCTCTGGGAGCTCGGAGGCAGG + Intronic
1072418932 10:95273208-95273230 CCCTGTGGGCACTGGGAGCCTGG - Intronic
1073491365 10:103855395-103855417 ACCTGTGGGCGCCGGGAGTCCGG - Exonic
1075741493 10:124698950-124698972 CCCACTGGGTGGTGTGAGTGAGG - Intronic
1076336111 10:129707395-129707417 CCCTCTGGAGCGTGGGAATCAGG + Intronic
1077152183 11:1077364-1077386 CCCTCTGGGCGGCGGGGTCCCGG + Intergenic
1077359964 11:2136499-2136521 CCCACTCGGGGGTGGGAGGCCGG + Intronic
1077836869 11:5933792-5933814 CCATCTTGGCTGGGGGAGTCAGG - Intronic
1080138411 11:28885516-28885538 GCCTGTGGGGGGTGGGAGGCTGG + Intergenic
1080745707 11:35106763-35106785 TCCTCTGGGCCCTGGGAGACTGG + Intergenic
1083743704 11:64723745-64723767 CCCTCCGGACGGTGGGAGGTGGG - Intergenic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1085475766 11:76788026-76788048 CCCTCAGGGCTCCGGGAGTCTGG + Intronic
1085764643 11:79272127-79272149 CCCTCTGGGAGGTGGGATGTGGG - Intronic
1088847707 11:113681919-113681941 CCCTGTGGGCTCTGGCAGTCTGG + Intergenic
1090453597 11:126828232-126828254 CCCTCTAGGGGGTGGGCGTTGGG - Intronic
1094168825 12:27469575-27469597 CCCTCAGGGTGCTGGGAGCCAGG + Intronic
1096525977 12:52210740-52210762 CTCTCTGGGCCCTGGGTGTCAGG + Intergenic
1098387549 12:69934921-69934943 CACTCTGGGCTGTGGGTTTCAGG + Intronic
1102003553 12:109573793-109573815 CGCTCTGGGTTGTGGGAGTTGGG + Exonic
1103951571 12:124554376-124554398 CCAGCTGGGTGGTGGGAGGCTGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1109453984 13:62559025-62559047 CCCTCTGTGCTGTGAGATTCCGG + Intergenic
1121091228 14:91184143-91184165 CTGTCTGGGCCCTGGGAGTCTGG - Intronic
1122313016 14:100809185-100809207 CCCTCAGGGCGGAGGGGGCCAGG - Intergenic
1122862224 14:104587794-104587816 GCCTCTGGGCGGTGGTGCTCCGG - Exonic
1123025624 14:105422322-105422344 CGCTCGGGGAGGTGGGCGTCTGG + Intronic
1124157420 15:27238305-27238327 TCCTCTGGCCGGTGGGCGTTAGG - Intronic
1125920537 15:43522979-43523001 CCTTCTGGGCTGGGGGTGTCTGG - Exonic
1127923756 15:63517658-63517680 CCCTCTGGGAGGTGGGCACCTGG + Intronic
1127998620 15:64170615-64170637 CCCTCTGGCAGGTGGAAGGCAGG + Exonic
1130230354 15:82092263-82092285 CACTGTGGGGTGTGGGAGTCCGG - Intergenic
1132064429 15:98718850-98718872 ACCTCTGGGAGGTGGGGGTGGGG - Intronic
1132723792 16:1330158-1330180 CCCTCAGGCTGGTGGGAGGCGGG + Intergenic
1133774827 16:8888115-8888137 CCCTCTGGATGGTGGAAGCCCGG - Intergenic
1134286678 16:12867999-12868021 CCCTATGGGAGGTGGGAGGCTGG - Intergenic
1135425273 16:22329762-22329784 ACCTCTGAGGGGTGGCAGTCAGG - Intronic
1136405533 16:30044241-30044263 CACTCTGGGAGGTGTGAGGCAGG - Intronic
1136731460 16:32417528-32417550 CCATCTGCGAGGTGGCAGTCTGG - Intergenic
1138489194 16:57366311-57366333 CCCTGTGAGTGGTGGGAGTCAGG + Intergenic
1139609044 16:68041490-68041512 GCCTCTGGGCTGTAGGACTCTGG - Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1142265989 16:89064145-89064167 GCCTCTGGGCTGCGGGAGCCGGG + Intergenic
1202994932 16_KI270728v1_random:99742-99764 CCATCTGCGAGGTGGCAGTCTGG + Intergenic
1203021619 16_KI270728v1_random:412084-412106 CCATCTGCGAGGTGGCAGTCTGG + Intergenic
1143631996 17:8144882-8144904 CCCACTGGACGGTAGGCGTCTGG + Exonic
1145014396 17:19387195-19387217 AACTCTGGGCGGTTGCAGTCTGG - Intronic
1145371579 17:22310926-22310948 GCCTCTGGGCTGTGAGAGGCTGG + Intergenic
1147627372 17:41908890-41908912 CCCTCTGGCAAGTGGGAGTCTGG + Intronic
1148000561 17:44384911-44384933 CCCTCGGGGTGCTGGAAGTCTGG + Intronic
1148615113 17:48996047-48996069 CCGTCTGGGCGGTGGGGGAGGGG - Intergenic
1150283869 17:63944860-63944882 CCCTCAGGGCTGTGGGGGGCAGG - Intronic
1151180646 17:72325189-72325211 CCCTCTGGTGTGTGGTAGTCTGG - Intergenic
1151884243 17:76914245-76914267 CCCAGTGGGCTGTGGGAGTGTGG + Intronic
1152594036 17:81229560-81229582 CCCTCTGGGTGGAGGGACTGAGG - Intronic
1161340725 19:3740581-3740603 CCCAGAGGGCCGTGGGAGTCGGG + Exonic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1161685944 19:5702464-5702486 CCCTCTGGGAGGGAGGAGTGGGG + Intronic
1161846316 19:6713677-6713699 CCATGTGGGGGGTGGGAGTGGGG - Intronic
1165117986 19:33540629-33540651 TCCTCTGGGAGGTGGGAATGAGG - Intergenic
1165256623 19:34580256-34580278 CGCACTGGGAGGTGGGAGCCAGG + Intergenic
1165265967 19:34664134-34664156 CGCACTGGGAGGTGGGAGCCAGG - Intronic
1165273593 19:34731150-34731172 CACACTGGGAGGTGGGAGCCAGG - Intergenic
1165316543 19:35059813-35059835 CCCTCGGAGGGGTGGGAGCCGGG + Intronic
1166367408 19:42284483-42284505 CCCCCCGGGCGGCGGGAGGCAGG + Intronic
1166864169 19:45826075-45826097 ACCTGGGGGCTGTGGGAGTCAGG - Intronic
1167038570 19:47008687-47008709 CCATCTTGGCTGGGGGAGTCAGG - Intergenic
1167244682 19:48365800-48365822 GCCACTGGGAGGTGGGAGCCAGG - Exonic
1168289967 19:55352843-55352865 TCCTCTGGGTGCTGGCAGTCTGG + Intronic
925394023 2:3519408-3519430 CCCACTGGGCGGCCGGGGTCGGG + Exonic
927921507 2:26975585-26975607 ACCTCTGGGAGGTGGGATTTGGG + Intronic
927941235 2:27104190-27104212 CCCTCTGGGAGGCAGGAGACTGG - Intronic
928212323 2:29332536-29332558 GCCTCTGGGTGGTGGGATTCTGG - Intronic
934738011 2:96699733-96699755 CCGTCTGGGGGAAGGGAGTCAGG + Intergenic
934761571 2:96859654-96859676 CTCTCTGGGTGGAGGGAGGCTGG - Intergenic
934981959 2:98850184-98850206 CCCATTGGGCGGTGGGGATCAGG - Intronic
937296392 2:120812288-120812310 CCCTCACTGCGTTGGGAGTCCGG + Intronic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
941541030 2:166784654-166784676 CCCTCTGGGGGGTGGGGGGCGGG - Intergenic
941720466 2:168807148-168807170 CTCTCTGGTGGGTGGGAGTGTGG + Intronic
943984598 2:194603631-194603653 CCCACTGGGCGGTCGAAGGCTGG - Intergenic
946246965 2:218393313-218393335 CCATCTGGGGGGTGGGAGGGGGG - Intronic
946566051 2:220966922-220966944 CCCTCTGGGTGGTAGGAGGAAGG + Intergenic
946905382 2:224411021-224411043 CCCTGTGGCAGGTGGGAGCCTGG + Intergenic
947713066 2:232326732-232326754 CCCTCCTGGGGCTGGGAGTCAGG - Intronic
948798499 2:240419431-240419453 TGCTCTGGGAGGTGGGGGTCGGG - Intergenic
1169132265 20:3172555-3172577 CCCTCTGGGGGGTGGAGATCAGG - Intronic
1169262692 20:4149483-4149505 CCCTCTGGGCTCCGGGCGTCCGG + Intronic
1169265032 20:4162249-4162271 CGCCCTGGGAGTTGGGAGTCGGG - Intronic
1171527969 20:25830657-25830679 ACCTCTGGGCTGTGAGAGGCTGG - Intronic
1171548857 20:26025223-26025245 ACCTCTGGGCTGTGAGAGGCTGG + Intergenic
1173135968 20:40439337-40439359 TCCCCTGGGCAGTGGGAGTGGGG + Intergenic
1173443389 20:43096808-43096830 CCCTCTGGGATGTGGGTGGCAGG + Intronic
1173966272 20:47115177-47115199 CCCTCTGGCAGGTGGGAGAAGGG - Intronic
1174141409 20:48416793-48416815 ACCTGTGGGCGGTGGGAGAAGGG - Intergenic
1178621449 21:34180576-34180598 CCCTTTGGGTGGTAAGAGTCAGG - Intergenic
1180787147 22:18553480-18553502 CCCTCTGGGTGGGGGGTGTGAGG + Intergenic
1180867323 22:19127023-19127045 CCCACTGGGCAGTGGGAGCCAGG - Intergenic
1180874739 22:19169913-19169935 CCCTGTGGTCGCTGGGAGCCAGG - Intergenic
1181234593 22:21441826-21441848 CCCTCTGGGTGGGGGGTGTGAGG - Intronic
1181244056 22:21493005-21493027 CCCTCTGGGTGGGGGGTGTGAGG + Intergenic
1181316580 22:21974556-21974578 CCCTCTGGGAGGTGGCATCCGGG - Intronic
1181512352 22:23394594-23394616 GCCTACGGGCGGTGGCAGTCAGG - Intergenic
1183619520 22:38964511-38964533 CCCTCTGGGCTGTAGGGGTCGGG + Intronic
1185246089 22:49774047-49774069 CCGTCTGGGCGCTGTGAGTGGGG - Exonic
950658176 3:14450259-14450281 CCCTCTGGAAGGTGTGAGTGAGG - Intronic
953371092 3:42389109-42389131 TCCCCTGGGTGGTGGGAGCCAGG + Intergenic
953848434 3:46447255-46447277 CCCTCTGGGTCATGGGAGTGGGG - Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
954921524 3:54195133-54195155 ACCTCTGGGAGGCGGGACTCTGG - Intronic
961170840 3:124796731-124796753 CCCTGCGGCCGGTGGGATTCCGG - Exonic
961321243 3:126078038-126078060 CCTTCAGGGAGGTGGGAGGCAGG - Intronic
968731030 4:2269295-2269317 CCCTCTGGCCTGTGGGGGGCAGG - Intergenic
969529065 4:7719812-7719834 CCCCCTGGGCGGTGGTAGACTGG - Intronic
971907685 4:32748368-32748390 GCCCCTGGGCGGCGGGACTCCGG + Intergenic
972314790 4:37916160-37916182 CCCTCTAGGAGATGGGAGTCAGG - Intronic
974012732 4:56622656-56622678 CCCTCTCTGTGGTGGGAGTTTGG + Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
978403008 4:108350382-108350404 GCCTCTGGGCTGTGGGCGCCAGG + Intergenic
983843232 4:172482289-172482311 CTCTCTGGGCTGTCGGAGGCTGG - Intronic
985526509 5:405626-405648 CCTTCAGGTCGGTGGGAGTGAGG + Intronic
985861312 5:2472867-2472889 AACTCTGGGCAGTGGGAGTGCGG - Intergenic
990695355 5:58410074-58410096 CCCTCTAGGTGGTGGGTGTAGGG - Intergenic
995760653 5:115557859-115557881 CGCTCTGGGAGGTGGGGGTGGGG + Intergenic
997800961 5:136861634-136861656 CTCCCTGGGTGGTGGGAGTGAGG + Intergenic
1000041410 5:157487681-157487703 GCCTCTGGGAGGTGAGAGTGGGG - Intronic
1001382294 5:171312479-171312501 CCACCTGGGGGGTGGGAGGCAGG + Intergenic
1001635360 5:173206178-173206200 CCATCTGGTTGGTGGGAGTTGGG + Intergenic
1002321900 5:178381319-178381341 CCCTGTGGAAGGTGGGAGTAGGG - Intronic
1002350035 5:178577127-178577149 CCCGCTGGGCCTTGGGAGTTGGG - Intronic
1003145443 6:3506348-3506370 CCCTCCAGGCGGTGGCAGACAGG - Intergenic
1004647843 6:17580380-17580402 CCCTTTGGGAGGCGGGAGGCGGG - Intergenic
1005504367 6:26457320-26457342 CCCTCAGGGAGGTGGCATTCTGG - Intergenic
1005894295 6:30164435-30164457 CCCTCTGCGCCCTGGCAGTCAGG - Intronic
1006124220 6:31827397-31827419 CGCTCTGGGCGGTGCGAGATTGG - Intergenic
1007867362 6:44987248-44987270 CACACTGGGCATTGGGAGTCAGG + Intronic
1008132054 6:47729741-47729763 CCGTCTGGGCTCTGGGAGTTGGG + Intergenic
1015149172 6:130019598-130019620 GCGTGTGCGCGGTGGGAGTCGGG - Intronic
1015183839 6:130391121-130391143 CCCTCTAGGGGCTGGCAGTCTGG - Intronic
1019414747 7:922120-922142 CCTCCAGGGCTGTGGGAGTCGGG - Intronic
1021033966 7:15774286-15774308 CACTTTGGGCGGTGGGTTTCCGG - Intergenic
1023024032 7:36035196-36035218 CCCTCTGGGAGCTAGGAGTGTGG + Intergenic
1024059606 7:45687940-45687962 CCCTCTGGGCTGTGCCTGTCTGG - Intronic
1024262187 7:47581391-47581413 CCCTTTGGTGGGTGGGAGGCAGG - Intronic
1025297670 7:57789226-57789248 ACCTCTGGGCTGTGAGAGGCTGG + Intergenic
1026205545 7:68254491-68254513 CACTCTGGGCAGTGGCAGACAGG + Intergenic
1026266741 7:68801925-68801947 ATCTCTGGGTGGTGGGAGTTGGG - Intergenic
1026678874 7:72450403-72450425 CCCACTGGGCGCTGGGGGTCGGG - Intergenic
1026882914 7:73919041-73919063 CCCTGTGGGTGGTGGTGGTCAGG + Intergenic
1027267605 7:76502877-76502899 CCCACTGGGAGGTGGGAGCCAGG + Intronic
1027319415 7:77002742-77002764 CCCACTGGGAGGTGGGAGCCAGG + Intergenic
1034116508 7:148588614-148588636 CCCTGGCGGGGGTGGGAGTCGGG + Intergenic
1034391659 7:150792015-150792037 GCCTCTGGGCAGCGTGAGTCTGG - Intronic
1034835995 7:154351925-154351947 CCCTCTGGAAGGTGGGAGTGAGG + Intronic
1040097937 8:43466333-43466355 TCTTCAGGGCGGTGGGACTCTGG + Intergenic
1040787065 8:51178604-51178626 CCCTCTGGGTGGTGTGGGGCTGG - Intergenic
1041301024 8:56411551-56411573 GGCTCTGGGAGGTGGGAATCAGG - Intergenic
1041467324 8:58169692-58169714 CCCCCTGGGCTGTGGGTATCTGG + Intronic
1046577339 8:116047286-116047308 CCCACTGGCCTGTGGGATTCAGG + Intergenic
1047859885 8:128954226-128954248 GCCTATCGGGGGTGGGAGTCTGG - Intergenic
1049275643 8:141718809-141718831 CCTCCTGGGCTGTGGGGGTCTGG + Intergenic
1049629857 8:143647861-143647883 CCCTGTAGGCTGTGGGCGTCTGG + Intronic
1050596616 9:7210960-7210982 CCTTTTGGGAGGTGGGAGGCAGG - Intergenic
1053282102 9:36827047-36827069 CCCACTGGGCAGTGGGAGGGTGG + Intergenic
1053392246 9:37744377-37744399 ATCTCTGGGCCCTGGGAGTCAGG - Exonic
1053795933 9:41726805-41726827 ACCTCTGGGCTGTGAGAGGCTGG - Intergenic
1054149247 9:61588068-61588090 ACCTCTGGGCTGTGAGAGGCTGG + Intergenic
1054184339 9:61938876-61938898 ACCTCTGGGCTGTGAGAGGCTGG - Intergenic
1054654166 9:67649619-67649641 ACCTCTGGGCTGTGAGAGGCTGG + Intergenic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1057141051 9:92727051-92727073 CCCTCTGGTCGGTGGGAGGAGGG - Intronic
1061187587 9:129063688-129063710 CCCTCTGGCAGGTGGGGTTCAGG - Intronic
1061397073 9:130349088-130349110 CCCTCTGGGCGGTGCCAGCCTGG - Intronic
1061417881 9:130457728-130457750 CCCTGTTGGGGGTGGGAGTAGGG - Intronic
1061917737 9:133763935-133763957 CCCTGTGGGCAGTGGAAGACTGG + Exonic
1062625952 9:137441576-137441598 CCCCCGGGGGGGTGGGAGGCAGG + Intronic
1185588739 X:1259833-1259855 CCCTCTGGGCCATGGGATTTTGG + Intergenic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic