ID: 904685665

View in Genome Browser
Species Human (GRCh38)
Location 1:32258425-32258447
Sequence GTGCTGTACTACTCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4361
Summary {0: 1, 1: 0, 2: 13, 3: 351, 4: 3996}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904685663_904685665 11 Left 904685663 1:32258391-32258413 CCAGAAGTTTCAGGTTGCAGTGA 0: 1
1: 86
2: 1575
3: 13036
4: 77695
Right 904685665 1:32258425-32258447 GTGCTGTACTACTCCAGCCTGGG 0: 1
1: 0
2: 13
3: 351
4: 3996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904685665 Original CRISPR GTGCTGTACTACTCCAGCCT GGG Intronic
Too many off-targets to display for this crispr