ID: 904688180

View in Genome Browser
Species Human (GRCh38)
Location 1:32275304-32275326
Sequence CCACCTCCGTGGCGCAGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904688180 Original CRISPR CCACCTCCGTGGCGCAGGAG CGG Exonic
900645928 1:3708755-3708777 CCCCCTCCTCGGTGCAGGAGGGG - Intronic
901065119 1:6490701-6490723 CCACCTCCCTGGCTCCGGCGCGG - Intronic
901435518 1:9245183-9245205 CCATGTCCTTGGGGCAGGAGAGG - Exonic
904614989 1:31744726-31744748 CCACCTCCGTGTTCCAGGTGAGG - Exonic
904688180 1:32275304-32275326 CCACCTCCGTGGCGCAGGAGCGG + Exonic
904923806 1:34029943-34029965 CCACCTGCCTGGCACAGGTGAGG - Intronic
905206278 1:36344433-36344455 CCCTCTCCTTGGGGCAGGAGAGG - Intronic
905913932 1:41672202-41672224 CCACCTCCCTGGCACATGTGGGG + Intronic
907053358 1:51344522-51344544 CCACATCCGAGGAGCAGGTGGGG - Intronic
911417827 1:97597757-97597779 CCAACTCCTTAGCGCAGGACAGG - Intronic
913091463 1:115479213-115479235 CCACCTCCCTGCTCCAGGAGCGG + Intergenic
914916454 1:151822280-151822302 CCACCACAGGGGAGCAGGAGCGG + Intronic
917491605 1:175503078-175503100 CCGCCGCAGTGGCGCATGAGTGG + Intronic
919747776 1:201019530-201019552 CCACCTCCCTGGCCCAGGCCTGG + Intronic
922525888 1:226303521-226303543 CTGCCTTCGTGGAGCAGGAGTGG - Intronic
1067769048 10:49110347-49110369 CCACTTCTGTGGCTCAGGACAGG + Intronic
1070302187 10:75211326-75211348 CCACCTCCTCTGCGGAGGAGGGG + Intronic
1072221924 10:93333980-93334002 CCACACCCCTGGCGGAGGAGGGG - Intronic
1073501779 10:103945874-103945896 CCACCTCCCAGGAGCCGGAGTGG - Intergenic
1074363403 10:112839829-112839851 CCATCTCCATGGGGCAGGGGTGG + Intergenic
1076633836 10:131870013-131870035 CCACCTCCCTGCCGAAGGATTGG - Intergenic
1080655199 11:34252854-34252876 CCACCTGGGTTGGGCAGGAGAGG - Intronic
1083276470 11:61599807-61599829 CCTCCTCTGAGGGGCAGGAGGGG + Intergenic
1083365559 11:62139720-62139742 CCAGCTGCATGGCCCAGGAGGGG + Intronic
1083902339 11:65649740-65649762 CCACTTCTGTGGCACAGGACAGG + Exonic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084530944 11:69727464-69727486 CCACCCCCTGGGAGCAGGAGGGG - Intergenic
1084637248 11:70399910-70399932 CCAAGGCCGTGGCGCAGGAGGGG + Intronic
1084652936 11:70499678-70499700 CCACATCCTCGGCGCAGCAGTGG + Intronic
1086120231 11:83298133-83298155 CCACCACAGTGGAGTAGGAGGGG - Intergenic
1087362807 11:97182030-97182052 CCACCTCCGAGGTTCAAGAGAGG - Intergenic
1088810333 11:113387713-113387735 CCACCTTTGCGGGGCAGGAGCGG + Intergenic
1095145360 12:38720873-38720895 CCTGCTCCATGGAGCAGGAGTGG - Intronic
1097966771 12:65590090-65590112 CCACCTCCTTGACACAGGTGGGG + Intergenic
1103493630 12:121343813-121343835 CCACCTCCTTAGGGCAGGTGGGG + Intronic
1105214052 13:18274106-18274128 CCACCTCCGAGGAGGAGCAGAGG + Intergenic
1105471917 13:20703134-20703156 CCTCCTGCGTGGCGCAGCACAGG + Intronic
1105799969 13:23894524-23894546 CCAAGTCCTTGTCGCAGGAGAGG - Intronic
1105849066 13:24318475-24318497 CCAAGTCCTTGTCGCAGGAGAGG + Intronic
1107549095 13:41458211-41458233 CCACCTCCCAGGGCCAGGAGGGG - Intronic
1114577698 14:23728782-23728804 CCACCTCCCTGGCCCATCAGAGG - Intergenic
1115265420 14:31494934-31494956 CCACCTCCCTGGGACAGAAGGGG + Intronic
1121114536 14:91334536-91334558 ACACCTCTGTGGCCCAGGCGTGG - Intronic
1121277834 14:92679675-92679697 CAACCTCTGTGGTGCAGGTGGGG + Intronic
1122529445 14:102415602-102415624 CCTCCTCCTTGGCATAGGAGGGG - Intronic
1122809892 14:104282613-104282635 CCAGGACCGTGGGGCAGGAGTGG + Intergenic
1124555280 15:30719498-30719520 CCAGCGCCGTGGAGGAGGAGGGG - Intronic
1126711284 15:51459450-51459472 CCACTTCAGTGGCACAGGGGAGG - Intronic
1129238459 15:74237722-74237744 CCAGCTCTGTGGGGCAGGTGGGG - Intronic
1129333367 15:74838891-74838913 CCAGCTCTGTGTTGCAGGAGAGG + Intronic
1130900074 15:88200397-88200419 CCATATCAGTGGTGCAGGAGGGG - Intronic
1132954878 16:2586349-2586371 CCACCTCCGGGGGGCAGCACTGG + Intronic
1133131117 16:3676548-3676570 CCATCTCCGAAGCACAGGAGGGG + Intronic
1134202706 16:12212089-12212111 CCACCACCGAGGCCCAGGAGAGG - Intronic
1135297394 16:21294218-21294240 CTCCCTCCCTGGCACAGGAGTGG + Intronic
1138229034 16:55324390-55324412 CCTCCTCCGGGCCGCAGGGGAGG + Exonic
1141085971 16:81096020-81096042 CCGCCCCGGTGGCTCAGGAGCGG + Intronic
1141665848 16:85464741-85464763 CCACCTGCGTGGAGCTGGAAGGG + Intergenic
1142156999 16:88537220-88537242 CCACACCTGTGCCGCAGGAGTGG + Intergenic
1151399528 17:73846856-73846878 CCACCTCCATGGAGCACCAGGGG - Intergenic
1151876755 17:76871229-76871251 CCACGGCCATGGCACAGGAGAGG - Intronic
1152257391 17:79248127-79248149 CTACCTCCGGGGCACAGGAGAGG + Intronic
1152652186 17:81499804-81499826 CCACCTCCGAGGCCCAACAGAGG - Intergenic
1152795382 17:82303844-82303866 CCACTTCTGTGGGGCAGGGGAGG + Intergenic
1153810948 18:8750996-8751018 CCTCCTCCTTGGAGCACGAGAGG - Intronic
1157616681 18:48991447-48991469 CCACCTCCCTGACACTGGAGAGG + Intergenic
1160964431 19:1740209-1740231 CGGCTTCCGTGGCTCAGGAGTGG + Intergenic
1162142204 19:8591796-8591818 TCACATCCGTGTTGCAGGAGCGG + Exonic
1163796008 19:19338302-19338324 CCAACTCTGTGGCCCAGGGGAGG - Intronic
1164305707 19:24002823-24002845 CCACCTCCAAGGAGGAGGAGGGG + Intergenic
1164921112 19:32089328-32089350 CCACCTTCGTGGCCCTGGAGCGG + Intergenic
1165318527 19:35072324-35072346 CCACCTCCGAGGGGCAGGGCTGG + Intergenic
1166231702 19:41428437-41428459 CCAGCCCCTTGGGGCAGGAGGGG + Intronic
1166809877 19:45508523-45508545 CCACCTGCGCGGCCCTGGAGAGG + Intronic
925207911 2:2022959-2022981 TCACCTACATGGCCCAGGAGAGG + Intronic
930346195 2:50184955-50184977 CCACCTACGTGGCGCTAAAGAGG - Intronic
931223622 2:60310349-60310371 CCTCCTCCATGGGGCTGGAGAGG + Intergenic
932819742 2:74889362-74889384 CCAGCTCTGTGGCGCAGGCATGG + Exonic
934300267 2:91772644-91772666 CCACCTCCGAGGAGGAGCAGAGG - Intergenic
935032466 2:99336150-99336172 CCACATCCGGAGCGGAGGAGGGG - Intronic
935600774 2:104919421-104919443 CCACTTCAGAGGCCCAGGAGTGG + Intergenic
943162334 2:184270084-184270106 ACAGGTCCGTGGCCCAGGAGTGG + Intergenic
948293201 2:236842647-236842669 CCACCTCGGTGGCCCACGTGTGG + Intergenic
948352351 2:237351185-237351207 CCGCTTCCCTGGAGCAGGAGGGG + Exonic
948823723 2:240564251-240564273 CCACCTCAGTGGCCCTGAAGTGG + Intronic
1170295914 20:14825227-14825249 GCATCTCTGTGGCACAGGAGCGG - Intronic
1171459659 20:25291459-25291481 CAAGCTCCGTGGTGCAGGGGGGG + Intronic
1171720899 20:28562487-28562509 CCTCCTCCGAGGCTAAGGAGGGG + Intergenic
1173539056 20:43838025-43838047 CCCCCTTCTTGGGGCAGGAGTGG - Intergenic
1175754882 20:61523142-61523164 CCACCTCTGTGGCTAGGGAGAGG - Intronic
1181270818 22:21657619-21657641 CCACGGCCGCGGCGCAGGTGCGG - Intronic
1181698623 22:24607774-24607796 CCACCTCCGAGGAGGAGCAGAGG - Intronic
1181878013 22:25955240-25955262 CCACCTCCGAGTCCCAGCAGCGG + Exonic
1182605148 22:31497007-31497029 CCGGCTCCGTGGCCCAGGAGCGG + Intronic
1183952379 22:41358851-41358873 CCACATCATTGGCACAGGAGTGG + Exonic
950405772 3:12803640-12803662 CAGCCTCGGTGGAGCAGGAGAGG + Intronic
950701948 3:14756997-14757019 CCACATCCGTGGGGGTGGAGGGG + Intronic
953850665 3:46463711-46463733 CCACCTGGGAGGGGCAGGAGAGG - Intronic
969534335 4:7746765-7746787 CCACCAGCGTGTTGCAGGAGGGG - Intergenic
972686945 4:41360908-41360930 CCTTCTCCGAGGCGCAGAAGTGG + Exonic
975249317 4:72159842-72159864 GGACCTCCGTGGCCCAGGGGTGG - Intergenic
978269925 4:106876671-106876693 CTACCACAGTGGAGCAGGAGAGG - Intergenic
985665977 5:1181707-1181729 CCACCACCCAGGCGCAGGTGCGG - Intergenic
986758438 5:10858387-10858409 GCCCCTCCCTGCCGCAGGAGAGG - Intergenic
992897031 5:81254507-81254529 CCAGCTTCGTGGGGAAGGAGAGG - Intronic
993020521 5:82585257-82585279 CCACCTCCCTGGGGTGGGAGAGG + Intergenic
995417588 5:111927183-111927205 AGGCCTCAGTGGCGCAGGAGAGG - Intronic
997337191 5:133116718-133116740 CCACCTCCAGGGCCCAGGAGGGG - Intergenic
1001832660 5:174802467-174802489 CCTCCTCCTTGGCCCAGGGGAGG - Intergenic
1003131128 6:3396260-3396282 CCATCTCCGGGGCACAGGATGGG - Intronic
1003180384 6:3785938-3785960 ACAACTCCGTGAAGCAGGAGAGG - Intergenic
1009558226 6:65202857-65202879 CCAGCTCTGTGGTGCAGGAGAGG + Intronic
1019586943 7:1810156-1810178 TCACCCCCGTGGGGAAGGAGGGG - Intergenic
1020189686 7:5985900-5985922 AGACCTCCTTGGAGCAGGAGTGG + Intronic
1020293234 7:6738768-6738790 AGACCTCCTTGGAGCAGGAGTGG - Intergenic
1022108336 7:27212789-27212811 CCACCTCGGAGGGGCAGAAGTGG - Intergenic
1028677141 7:93478465-93478487 CCAACTCCTGGGCTCAGGAGAGG - Intronic
1031974307 7:128084281-128084303 CCACCTCTGTGGCCCAGGCCAGG + Intronic
1032255689 7:130295408-130295430 ACACCTGTGTGGAGCAGGAGGGG + Intronic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG + Intronic
1042837863 8:73093377-73093399 GGACCTCCGGGGCGCGGGAGCGG + Intronic
1048255669 8:132903388-132903410 GCACCTGCATGGGGCAGGAGTGG - Intronic
1053575585 9:39355641-39355663 CCACCTCTGTGACGCAGGCCTGG + Intergenic
1053840104 9:42183598-42183620 CCACCTCTGTGACGCAGGCCTGG + Intergenic
1054097155 9:60914346-60914368 CCACCTCTGTGACGCAGGCCTGG + Intergenic
1054118561 9:61189975-61189997 CCACCTCTGTGACGCAGGCCTGG + Intergenic
1054589196 9:66992589-66992611 CCACCTCTGTGACGCAGGCCTGG - Intergenic
1058467630 9:105244888-105244910 CCTCCTCCGCCGCGCAGGTGAGG + Exonic
1059432784 9:114260065-114260087 CCAGCTTCCTGGGGCAGGAGGGG - Intronic
1060224492 9:121782849-121782871 CCCCCTCCCTGGCACAGGTGTGG - Intronic
1060395399 9:123312970-123312992 CCACCTCCATGGCCCAGATGGGG + Intergenic
1060765687 9:126293731-126293753 CCCCCTGCTGGGCGCAGGAGTGG + Intergenic