ID: 904696020

View in Genome Browser
Species Human (GRCh38)
Location 1:32331992-32332014
Sequence GTGTCTCTTGGAGGACACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904696008_904696020 13 Left 904696008 1:32331956-32331978 CCCGAGTTCCTCCCTCTTCTGGT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
904696012_904696020 1 Left 904696012 1:32331968-32331990 CCTCTTCTGGTTCCCTTTCCCTT 0: 1
1: 0
2: 10
3: 148
4: 1175
Right 904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
904696010_904696020 5 Left 904696010 1:32331964-32331986 CCTCCCTCTTCTGGTTCCCTTTC 0: 1
1: 0
2: 1
3: 76
4: 791
Right 904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
904696011_904696020 2 Left 904696011 1:32331967-32331989 CCCTCTTCTGGTTCCCTTTCCCT 0: 1
1: 0
2: 3
3: 71
4: 841
Right 904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
904696009_904696020 12 Left 904696009 1:32331957-32331979 CCGAGTTCCTCCCTCTTCTGGTT 0: 1
1: 0
2: 0
3: 39
4: 354
Right 904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904696020 Original CRISPR GTGTCTCTTGGAGGACACGC AGG Intronic
900614760 1:3560582-3560604 GTTTCTCTTGGAGAACAGGGGGG - Intronic
900983026 1:6057406-6057428 GTGTGTCTTAAAGGACAGGCGGG + Intronic
901132722 1:6972279-6972301 GTGTCACTAGGAGCACACACGGG - Intronic
902415437 1:16236200-16236222 CTGTCTCTGGGATGAGACGCTGG - Intronic
904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG + Intronic
906713900 1:47952832-47952854 CTGTCTCCTGGAGGACACCGAGG + Intronic
913984240 1:143550962-143550984 GTGCCTCTTGGAGGAGAGTCAGG - Intergenic
914988535 1:152479351-152479373 GCCTGTCTTGGAGGACAGGCGGG - Intergenic
920585989 1:207161167-207161189 ATGTCTTTTGGTGTACACGCTGG + Intergenic
921686409 1:218094060-218094082 CTGCCACTTGGAGGACATGCTGG - Intergenic
924598912 1:245470756-245470778 GTGTCTCCTGAAGGACAAGAAGG + Intronic
1067320010 10:45209226-45209248 GTCTCACTTGGGGGACATGCAGG + Intergenic
1068687666 10:59885818-59885840 GTGTTTCTTGGAGGATATGATGG - Intronic
1071521344 10:86332963-86332985 GTGTTTCTGGGAGGCCACCCTGG - Intronic
1074430575 10:113390738-113390760 GTGTCTCTTTGAGGACTACCAGG + Intergenic
1076785167 10:132745904-132745926 GTGTGTCCTGGAGAACAGGCGGG + Intronic
1076909128 10:133378832-133378854 GTCTCCCTTGGAGGAGACACTGG + Intergenic
1078030817 11:7749340-7749362 TTGTCTCTGGGAAGACACTCAGG + Intergenic
1079005131 11:16786190-16786212 ATGTCTCCTGGAGGACATGAAGG + Intronic
1082096677 11:48136339-48136361 CTGTCTCTTGGAGGAGGCACTGG + Intronic
1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG + Intronic
1083378065 11:62242322-62242344 GTGTCTCCTGCTGGTCACGCTGG + Exonic
1089531308 11:119131667-119131689 GTGGCTTCTGGAGGAAACGCTGG + Intronic
1089755352 11:120682197-120682219 GTGTCTCTCAGAGCACAGGCTGG + Intronic
1093432041 12:19095240-19095262 CTGTCTCTTGGAAGACACTTTGG - Intergenic
1094278375 12:28706295-28706317 GTGATTCATGGAGGACACGCAGG + Intergenic
1096476667 12:51913083-51913105 GGGTCTCCTGGAAGACACACCGG - Exonic
1112741994 13:102485765-102485787 GTGTCTTTTGGTGAACACACAGG - Intergenic
1117229732 14:53704024-53704046 GTGTCTCTTGGAGGAGATTTGGG - Intergenic
1119659136 14:76438061-76438083 ATGTCTCTTGGGGGACAGGCAGG + Intronic
1120866353 14:89298745-89298767 CTGCCTCTTGGAGGACAGGATGG - Intronic
1124071045 15:26393442-26393464 GTGTCACTTGGAAGGCAAGCAGG - Intergenic
1127819255 15:62640635-62640657 GTTTCTCTTGGAGGTCACTTAGG - Intronic
1129975178 15:79815824-79815846 GAGTCTCATGGAGGACAAGGGGG + Intergenic
1131526010 15:93153171-93153193 GTGTCTCTTGGAGGACCCCGGGG + Intergenic
1132995288 16:2819474-2819496 ATGTGTGTTGGGGGACACGCAGG - Intronic
1137519542 16:49180249-49180271 GTGGGTCTTGGAGAACACGATGG - Intergenic
1137718084 16:50611130-50611152 GTGACTCCTGGAGGCCATGCAGG - Intronic
1139587149 16:67911369-67911391 GTGACTCTTGAAGGAAATGCTGG - Intronic
1140410073 16:74736078-74736100 GTGGGTCTTAGAGGACACCCTGG - Intronic
1140885145 16:79236363-79236385 GTGGCTCTTGGAGGACGTACAGG - Intergenic
1142607643 17:1090912-1090934 GTGTCCCCTGGAGGACCCCCAGG - Intronic
1146102089 17:29992683-29992705 TTGTCTGTTGGAGGACACTTAGG + Intronic
1148218325 17:45845950-45845972 GTGGCTCCTGCAGGACACACTGG + Exonic
1148850664 17:50553475-50553497 CTGTATCCTGGAGGACAGGCAGG + Intronic
1149661196 17:58334896-58334918 GTGTCTCTTGGGGAGGACGCAGG - Intergenic
1151553682 17:74836080-74836102 GTGGCGCTTGGAGGAGACGGGGG - Exonic
1154992869 18:21612628-21612650 CAATCTCTTGGAAGACACGCGGG - Intronic
1156396437 18:36704049-36704071 ATGTCTCTTTGAGGATACCCTGG + Intronic
1157321557 18:46638799-46638821 GTGGAGCTTGGAGTACACGCTGG + Intronic
1160896176 19:1402940-1402962 GTGTCTCCTAGAGGACACGTGGG - Intergenic
1162376513 19:10308492-10308514 CTGTCTCTTGGAGGAAGCACAGG + Exonic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166740561 19:45112467-45112489 GAGACTCTTGGAGAACAAGCAGG - Intronic
1167339796 19:48908419-48908441 CTGACTCTTGGAGGCCAGGCGGG - Intronic
932655382 2:73606935-73606957 GTGTCTCCTGAAGGCCACTCTGG - Intronic
933897359 2:86824005-86824027 GTGTATGCTGGGGGACACGCAGG + Intronic
938538528 2:132265796-132265818 GAGTCTCTGGAAGGACGCGCGGG - Intergenic
940856327 2:158731065-158731087 CAGCCTCTTGGAGGACACGTAGG - Intergenic
947348854 2:229221725-229221747 CTGTCTCTTGGAAGAAACACAGG + Intronic
947857074 2:233331302-233331324 TAGTCTCTTGGAGGACAGGAAGG + Intronic
1171360334 20:24582507-24582529 GTGCCACTTGGAGGATATGCAGG - Intronic
1172868834 20:38121896-38121918 GTGTCTTTTGGGGGACATACGGG + Intronic
1175871148 20:62210096-62210118 GTTTCCCTTTGAGGACACACAGG - Intergenic
1180193323 21:46179714-46179736 GTGTCCCCTGGAGGACAGCCAGG - Intronic
1180341259 22:11621087-11621109 GAGTCTCTGGAAGGACACACAGG + Intergenic
1180710718 22:17837620-17837642 CTGTCTCCTGGAGGAGACCCTGG - Intronic
1181615344 22:24050360-24050382 GTGTCTGTGAGAGGACACGTAGG + Intronic
1184248182 22:43246119-43246141 GTGCCCCTTGGAGGACAGGGAGG + Intronic
950864178 3:16175616-16175638 GTGCCTCCTGGAGGCCACGTGGG - Exonic
951238145 3:20258812-20258834 TTGTCTCTTGGTTGACACGTGGG + Intergenic
953459746 3:43072887-43072909 GTGTCTCTAGGTGGAAACTCGGG + Intergenic
954579999 3:51698081-51698103 GTGCATCTAGGAGGCCACGCGGG - Intronic
955555674 3:60134670-60134692 GTCTCTCTTGGAGGATTGGCTGG - Intronic
955770553 3:62380805-62380827 GTGTCTCTTTGAGGACTTGAGGG - Intergenic
956021022 3:64933426-64933448 GGGTCTCTAGGAGGACAGGCTGG + Intergenic
960638882 3:119809242-119809264 GTGTCTTTTGTGGGACAGGCAGG + Intronic
961474577 3:127138644-127138666 GTGTCTCAGGGAAGACAGGCGGG - Intergenic
961592297 3:127990158-127990180 GCGTCTCTTGGAAGCCACACTGG + Intergenic
961666323 3:128495443-128495465 GTGTGTCCTGGGTGACACGCGGG + Intergenic
976830072 4:89305821-89305843 GTGTCAATTGGAGGGCAGGCTGG - Intronic
984302841 4:177945499-177945521 GTGTTCCCTGGAGGACTCGCTGG - Intronic
988487920 5:31682171-31682193 GTGTTTCCTGGAGGACCCACGGG + Intronic
994488974 5:100417345-100417367 GTGTTTCATGGAGGACTAGCTGG - Intergenic
996735658 5:126755870-126755892 GTGTGTCCAGGAGGACACACGGG - Intergenic
1001328955 5:170748868-170748890 GTGTCTCTTGGAGCAAAGGTGGG - Intergenic
1003332955 6:5144842-5144864 GTGTTTCTGCGAGGCCACGCTGG + Intronic
1006129586 6:31861248-31861270 GTGTTTCCTGGAGCACACCCCGG - Exonic
1023940779 7:44767336-44767358 GTGCCTCTTTGAGCACATGCAGG + Intronic
1035033428 7:155879734-155879756 GTGTCCCTTGGAGGACGCCTTGG - Intergenic
1035420462 7:158725232-158725254 GTATTTCTTGTAGGGCACGCTGG + Intergenic
1038476475 8:27871937-27871959 GTGTCTGTTGCATGTCACGCTGG + Exonic
1049807937 8:144549331-144549353 CTGTCTCCTGGAGGCCACTCGGG + Intronic
1062065000 9:134521974-134521996 GTGTCTCTTGTAGGAAATTCGGG - Intergenic
1062577180 9:137214222-137214244 GTGCCTCTTGGAGGAACAGCAGG - Exonic
1062642109 9:137524296-137524318 CTGTCTCGTGGAGGCCTCGCAGG + Intronic
1187441953 X:19328635-19328657 CTTTCTCTTGGAGGCCACACTGG - Intergenic
1190745352 X:53319183-53319205 GTGTCTCTTGGAGGCTGGGCTGG - Intronic
1190917968 X:54824300-54824322 GCCTCTCTGGGAGGAGACGCAGG + Intergenic
1192742288 X:73904977-73904999 GTGTCTCTCCCAGGACACGTGGG - Intergenic