ID: 904696704

View in Genome Browser
Species Human (GRCh38)
Location 1:32335488-32335510
Sequence ACTTACACAAAGCGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904696704_904696709 -4 Left 904696704 1:32335488-32335510 CCAGCCTCCCGCTTTGTGTAAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 904696709 1:32335507-32335529 AAGTGGCCCCCACCCACCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 320
904696704_904696717 12 Left 904696704 1:32335488-32335510 CCAGCCTCCCGCTTTGTGTAAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 904696717 1:32335523-32335545 CCCCAGGCTCTCCCGCATCTCGG 0: 1
1: 0
2: 2
3: 21
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904696704 Original CRISPR ACTTACACAAAGCGGGAGGC TGG (reversed) Intronic