ID: 904697151

View in Genome Browser
Species Human (GRCh38)
Location 1:32336921-32336943
Sequence CCCCACGTGGGACTTTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904697151_904697161 25 Left 904697151 1:32336921-32336943 CCACTGCAAAGTCCCACGTGGGG 0: 1
1: 0
2: 4
3: 16
4: 113
Right 904697161 1:32336969-32336991 CCATCCCCATTGAAAGGCCAAGG 0: 1
1: 0
2: 1
3: 11
4: 222
904697151_904697156 -4 Left 904697151 1:32336921-32336943 CCACTGCAAAGTCCCACGTGGGG 0: 1
1: 0
2: 4
3: 16
4: 113
Right 904697156 1:32336940-32336962 GGGGGACTTTGTGACCTTGAAGG 0: 1
1: 0
2: 0
3: 22
4: 155
904697151_904697157 -3 Left 904697151 1:32336921-32336943 CCACTGCAAAGTCCCACGTGGGG 0: 1
1: 0
2: 4
3: 16
4: 113
Right 904697157 1:32336941-32336963 GGGGACTTTGTGACCTTGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
904697151_904697159 19 Left 904697151 1:32336921-32336943 CCACTGCAAAGTCCCACGTGGGG 0: 1
1: 0
2: 4
3: 16
4: 113
Right 904697159 1:32336963-32336985 GCATCTCCATCCCCATTGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904697151 Original CRISPR CCCCACGTGGGACTTTGCAG TGG (reversed) Intergenic
900605275 1:3521083-3521105 CCCCGCCTGGGGCTTTGCAGGGG - Intronic
900955970 1:5886716-5886738 TCCCACCTGGGACGTTCCAGGGG - Intronic
902046452 1:13528304-13528326 TCCCACCTGGGGGTTTGCAGAGG + Intergenic
902834499 1:19037900-19037922 CGCCAGGGGGGACTTTGCACGGG + Intergenic
904475873 1:30764260-30764282 CCACACCTGAGACTTTGCTGTGG + Intergenic
904697151 1:32336921-32336943 CCCCACGTGGGACTTTGCAGTGG - Intergenic
905182622 1:36176347-36176369 CCCCACGTGGGGCCGGGCAGGGG + Exonic
910211746 1:84800577-84800599 CCCCACTCTGAACTTTGCAGTGG - Intergenic
920598873 1:207302307-207302329 ACCCAGGCGGGACTTTGAAGAGG + Intergenic
921332947 1:214058107-214058129 GCCCCCGAGGGACTTGGCAGCGG + Intergenic
922355585 1:224772218-224772240 ACCCAAGTGGGAGTTGGCAGCGG + Intergenic
1066253343 10:33655080-33655102 CCCCATGGGGGATTGTGCAGTGG - Intergenic
1067660951 10:48235830-48235852 CCACACATGGGGCTCTGCAGGGG + Intronic
1067706865 10:48612530-48612552 CCACAGGTGGCACTCTGCAGGGG + Intronic
1069178606 10:65326946-65326968 TCCCACAAGAGACTTTGCAGGGG - Intergenic
1069797810 10:71064407-71064429 CCCCACGTGGGGTTGAGCAGAGG + Intergenic
1070702552 10:78614105-78614127 CACCACGTGGGGCCTTCCAGTGG + Intergenic
1072940601 10:99760302-99760324 CCCCAGTGGGGACTCTGCAGGGG + Intergenic
1075757109 10:124821524-124821546 ACCCAGGTGGGAGTGTGCAGTGG - Intronic
1076013770 10:127011649-127011671 CCACACGTGGGACTAGGCAGTGG + Intronic
1077426187 11:2479262-2479284 CCCCAGTGGGGACTTTGCATGGG + Intronic
1077508762 11:2944404-2944426 TGCCATGTGGGTCTTTGCAGGGG - Intergenic
1083689813 11:64400493-64400515 CCTCAAGTGGGAATGTGCAGAGG + Intergenic
1084313041 11:68327563-68327585 CCACAAGTGTGACTTTGCATTGG + Intronic
1087268111 11:96083068-96083090 CCCCACGTGCCACTTCTCAGAGG - Intronic
1087578811 11:100025444-100025466 CCCCAGTGGGGACTCTGCAGGGG - Intronic
1088821454 11:113460851-113460873 CTCCACCTGGGACTTGGCATTGG - Intronic
1095623272 12:44283374-44283396 CCGCCCCTGTGACTTTGCAGTGG - Intronic
1098341897 12:69460324-69460346 CCCATCGCCGGACTTTGCAGTGG + Intergenic
1098487639 12:71040020-71040042 CCCCACTTAGTACTGTGCAGTGG + Intergenic
1101232657 12:102756969-102756991 CCCCCCGGGAGACTTTGCAGGGG - Intergenic
1106612990 13:31301254-31301276 CCCCAGGAGGTACTCTGCAGAGG + Intronic
1114083139 14:19218823-19218845 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1121435953 14:93919666-93919688 ACCCACGTGGGACTTCCCTGGGG - Intronic
1122076557 14:99238613-99238635 CCCTAAGTGGGCATTTGCAGGGG + Intronic
1202894762 14_GL000194v1_random:591-613 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1124631446 15:31339844-31339866 CCCCAGGTGGCACTTTGCTGTGG + Intronic
1128061713 15:64739562-64739584 CCCCAGGTGGGACCTTCCTGGGG - Intergenic
1130321330 15:82844936-82844958 CACCACTTGGGACTCTGCCGTGG + Intronic
1131059378 15:89395265-89395287 GCCCATCTGGGACTTGGCAGGGG + Intergenic
1131863673 15:96682617-96682639 CACCACGAGGGTCTTTCCAGAGG - Intergenic
1132468339 16:88191-88213 ACCCTCATGGGACTTGGCAGGGG - Intronic
1138493309 16:57390865-57390887 CCCACCTTGGGACTCTGCAGAGG + Intergenic
1138535193 16:57656264-57656286 CCCCACATGTGAGTATGCAGGGG + Exonic
1139021686 16:62757913-62757935 CCCCCTATGGTACTTTGCAGGGG - Intergenic
1141133729 16:81452249-81452271 CACCACCTGGGACACTGCAGAGG - Intronic
1142892794 17:2956257-2956279 CCCCACGTGTGAATGTACAGGGG - Intronic
1143353301 17:6305822-6305844 CCACAGTTGGCACTTTGCAGAGG + Intergenic
1144628535 17:16857869-16857891 CCCCAGGTGGGACTTGGCAGGGG - Intergenic
1144654758 17:17028513-17028535 CCCCAGGTGCGACTTGGCAGGGG + Intergenic
1144790521 17:17856051-17856073 CTCTACGTGGGACCTGGCAGTGG + Intronic
1145160122 17:20568440-20568462 CCCCAGGTGGGACTTGGCAGGGG - Intergenic
1150218947 17:63485061-63485083 GCCCAAGTGGGACCATGCAGGGG + Exonic
1150616317 17:66775197-66775219 CCCCACATGGGACTTTGCCACGG - Intronic
1151540941 17:74764228-74764250 AACCTCTTGGGACTTTGCAGTGG + Intronic
1151940018 17:77286529-77286551 TCCCAGGTGGGTGTTTGCAGAGG + Intronic
1152611615 17:81317626-81317648 CCCCACGAGGGCCCGTGCAGGGG - Intronic
1153314977 18:3712424-3712446 CCCCAGGTGAGACTTTCCAGTGG - Intronic
1154499839 18:14990498-14990520 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1163403383 19:17107978-17108000 CACCAAGTGGGACTTGCCAGGGG - Intronic
1163478438 19:17540202-17540224 TCCCACCTGGGTCTTTGTAGGGG - Intronic
1165330828 19:35140425-35140447 CCCCATCTGGGACAGTGCAGAGG + Intronic
1165827106 19:38711737-38711759 CCCCACGAAGGGCTTGGCAGGGG - Intronic
924991260 2:314926-314948 CCACACGGGGGACTTTACGGAGG - Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
933640767 2:84757030-84757052 CCAGACATGGGATTTTGCAGAGG + Intronic
937256627 2:120560565-120560587 GCCCACGTGGGACTCTTCTGAGG + Intergenic
938376173 2:130808230-130808252 CCCCACGTCGCACTTGGGAGAGG + Intergenic
938493441 2:131777812-131777834 CCCCATGAGGGGCTGTGCAGTGG - Intergenic
938499050 2:131820853-131820875 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
939016928 2:136913884-136913906 CCCCACTAGGGACTCTGCATGGG - Intronic
944504875 2:200401071-200401093 CACCAGGTGGGATATTGCAGTGG + Intronic
948236202 2:236393076-236393098 CTCGACGTGGGACTTGGAAGAGG + Intronic
1169879529 20:10331385-10331407 CCCTACTAGGGAGTTTGCAGAGG + Intergenic
1172668057 20:36614334-36614356 CCCTACCTGTGACTGTGCAGAGG - Exonic
1172670318 20:36630503-36630525 CCCCACGTGGGCCTTTCTTGGGG + Intronic
1173720177 20:45251515-45251537 CCCCAAGTAGCACCTTGCAGGGG - Intergenic
1175971643 20:62689530-62689552 CCCTACGGGGGACGTGGCAGAGG + Intergenic
1176614461 21:9016578-9016600 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1176710742 21:10147293-10147315 CCCCACAAGGGGCTGTGCAGTGG - Intergenic
1178921935 21:36744583-36744605 TCCCCAGTGGGACCTTGCAGTGG + Intronic
1178924300 21:36762189-36762211 CACCACGTGTGGCTTTGAAGAGG - Intronic
1180103535 21:45601687-45601709 CCCCACCTGGGACCTGGCAGGGG + Intergenic
1180294834 22:10874444-10874466 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180497640 22:15903858-15903880 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180754382 22:18150173-18150195 CCCGACGTGGAACTCAGCAGCGG + Exonic
1182362093 22:29752613-29752635 CCCCATGTGGGAAGCTGCAGTGG + Intronic
1182598816 22:31443697-31443719 CCCCACGTGGGTCTTTGCACCGG - Intronic
950700665 3:14743559-14743581 CCCCAGTAGGGACTTTGCATGGG + Intronic
953498312 3:43407864-43407886 GCCCACGTGGGGCTTTGCAGGGG + Intronic
957972338 3:87398694-87398716 GGCCACGTGGGACTCAGCAGTGG + Intergenic
962406078 3:135101214-135101236 CCCAGCTTTGGACTTTGCAGGGG - Intronic
963996561 3:151716765-151716787 CCCCAGGAGGGACTCTGCATAGG + Intergenic
965538336 3:169848044-169848066 CCCCACCTGGTGCTTTGCAGGGG + Intronic
978863969 4:113485018-113485040 CCCCACGTGGTTCAGTGCAGTGG + Intronic
980913590 4:139015059-139015081 ACCCACGTGAAACTTTGGAGGGG - Intergenic
981490646 4:145336077-145336099 CGCCACGTGGGCCTTTCCATTGG + Intergenic
981697406 4:147572991-147573013 CACCACTTGGGAGATTGCAGTGG - Intergenic
984755198 4:183319726-183319748 CCCCAGGTGGGAGTTTGGGGAGG - Exonic
984755409 4:183321934-183321956 CCCCAGGTGGGAGTTTGGGGAGG - Exonic
985684947 5:1277127-1277149 CGCCTCGTGGGATTGTGCAGGGG - Intronic
996309656 5:122090799-122090821 CCCCAGATGGGACTGTACAGTGG - Intergenic
1000768279 5:165318842-165318864 CCACCCGTGTGGCTTTGCAGGGG + Intergenic
1002712403 5:181203502-181203524 CCCCCCGTGGGACATTACAGAGG - Intronic
1005214997 6:23515440-23515462 CACACCATGGGACTTTGCAGTGG - Intergenic
1018709273 6:166486153-166486175 TCCCATCTGGGACTTTGCTGAGG + Intronic
1018845001 6:167549492-167549514 CCGCTCGTGGGACGTTTCAGTGG - Intergenic
1023871194 7:44263864-44263886 CCGCACGTGGGGGTTGGCAGAGG - Intronic
1024323865 7:48093694-48093716 TCCTTCATGGGACTTTGCAGTGG + Intronic
1024716830 7:52088486-52088508 CCCAGTGTGGGACTTAGCAGAGG - Intergenic
1026086985 7:67270778-67270800 CCCCACATAGGACAGTGCAGTGG - Intergenic
1026690117 7:72543920-72543942 CCCCACATAGGACAGTGCAGTGG + Intergenic
1029493112 7:100882962-100882984 GCCCACGCGGGACTCCGCAGTGG - Intronic
1031849439 7:126846340-126846362 CCTCAGGTAGGAATTTGCAGTGG - Intronic
1032604044 7:133330184-133330206 GCCCAGTTGGAACTTTGCAGTGG + Intronic
1034468401 7:151243186-151243208 CCCTACTAGGCACTTTGCAGGGG - Intronic
1035868244 8:3108704-3108726 CCCCAGCTGGGAGTTTTCAGTGG - Exonic
1038426778 8:27469024-27469046 CCCCCCGTGGGGCTTTGGGGAGG + Intronic
1040284875 8:46094552-46094574 CCACAGGTGGGCCTGTGCAGGGG + Intergenic
1050543120 9:6687203-6687225 GCCCAGGTCTGACTTTGCAGTGG + Intergenic
1053647725 9:40132989-40133011 CCCCACAAGGGGCTGTGCAGTGG - Intergenic
1053758006 9:41330854-41330876 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1054536854 9:66243181-66243203 CCCCACAAGGGGCTGTGCAGTGG + Intergenic
1058649234 9:107159497-107159519 CCCCACTAGGGACTTTGTATGGG - Intergenic
1061543624 9:131291122-131291144 CCCCACGTGGCACCTGGCACAGG - Intronic
1202795502 9_KI270719v1_random:116281-116303 CCCCACAAGGGGCTGTGCAGTGG - Intergenic
1203794921 EBV:170679-170701 CCCCACGGGGGTCTTTCCTGGGG - Intergenic
1186739770 X:12505310-12505332 CCCCACGTGGCATTTGGCACAGG - Intronic
1188094134 X:26001957-26001979 CCTCACAGGGGACTCTGCAGAGG + Intergenic
1190437685 X:50442597-50442619 CTCTAAGTGGGACCTTGCAGAGG + Intronic
1190473023 X:50801432-50801454 CCCCACCTGGGTCTTAGCAGTGG + Intronic
1196582519 X:117393867-117393889 CCCCAGTGGGGACTCTGCAGGGG + Intergenic
1198030856 X:132752144-132752166 CACCACATGGGATTTAGCAGGGG - Intronic
1200811478 Y:7490045-7490067 CCCCAGATGGGACTGTCCAGTGG - Intergenic