ID: 904698091

View in Genome Browser
Species Human (GRCh38)
Location 1:32341758-32341780
Sequence TTGGTCACTGTCTGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904698091_904698097 -7 Left 904698091 1:32341758-32341780 CCTGCCATCCAGACAGTGACCAA No data
Right 904698097 1:32341774-32341796 TGACCAAATCATAAGGACAGGGG No data
904698091_904698099 21 Left 904698091 1:32341758-32341780 CCTGCCATCCAGACAGTGACCAA No data
Right 904698099 1:32341802-32341824 AAGTTCCCTTTCAGAATTCTAGG No data
904698091_904698096 -8 Left 904698091 1:32341758-32341780 CCTGCCATCCAGACAGTGACCAA No data
Right 904698096 1:32341773-32341795 GTGACCAAATCATAAGGACAGGG No data
904698091_904698095 -9 Left 904698091 1:32341758-32341780 CCTGCCATCCAGACAGTGACCAA No data
Right 904698095 1:32341772-32341794 AGTGACCAAATCATAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904698091 Original CRISPR TTGGTCACTGTCTGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr