ID: 904701649

View in Genome Browser
Species Human (GRCh38)
Location 1:32361758-32361780
Sequence CGAGTCCCAGGACAGCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904701649_904701665 19 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701665 1:32361800-32361822 GGGAGTCTCCGGCCTCAATGGGG 0: 1
1: 0
2: 0
3: 5
4: 77
904701649_904701658 -8 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701658 1:32361773-32361795 GGGACTCGGGGGCGGCGGCAAGG 0: 1
1: 0
2: 5
3: 41
4: 416
904701649_904701659 -2 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701659 1:32361779-32361801 CGGGGGCGGCGGCAAGGCCACGG 0: 1
1: 0
2: 5
3: 54
4: 448
904701649_904701661 8 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701661 1:32361789-32361811 GGCAAGGCCACGGGAGTCTCCGG 0: 1
1: 0
2: 0
3: 19
4: 194
904701649_904701664 18 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701664 1:32361799-32361821 CGGGAGTCTCCGGCCTCAATGGG 0: 1
1: 0
2: 1
3: 0
4: 21
904701649_904701663 17 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701663 1:32361798-32361820 ACGGGAGTCTCCGGCCTCAATGG 0: 1
1: 0
2: 0
3: 4
4: 51
904701649_904701660 -1 Left 904701649 1:32361758-32361780 CCTCCGGGCTGTCCTGGGACTCG 0: 1
1: 0
2: 0
3: 20
4: 168
Right 904701660 1:32361780-32361802 GGGGGCGGCGGCAAGGCCACGGG 0: 1
1: 0
2: 3
3: 31
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904701649 Original CRISPR CGAGTCCCAGGACAGCCCGG AGG (reversed) Exonic
900077139 1:827125-827147 CGAATCCCAGGGCTGCCCTGAGG + Intergenic
900340046 1:2184056-2184078 CGAGTCCCAGGCCCGCCTGCTGG + Intronic
900371355 1:2333555-2333577 GGAGTCCCAGGAGACCCCTGAGG - Intronic
900744964 1:4354853-4354875 TGAGGCCCAGCACAGCCCTGAGG - Intergenic
902656726 1:17874194-17874216 GGAGGCCCAGGAAAGCCCGGTGG - Intergenic
902835788 1:19045976-19045998 CGAGGGCCAGGGCAGCCTGGTGG + Intergenic
903060158 1:20663711-20663733 CCAGTCCCAGCACAGCCCCCAGG + Intergenic
904528897 1:31155261-31155283 CGAGTCCCGGGAGAGGCGGGCGG + Intergenic
904701649 1:32361758-32361780 CGAGTCCCAGGACAGCCCGGAGG - Exonic
908527615 1:65002831-65002853 AGAGTCCCAGGAAAGCGCTGTGG + Intergenic
915216494 1:154343991-154344013 CCTGGCCCAGGACAGCCGGGAGG + Exonic
915556700 1:156664809-156664831 CCAGTCCCAGGAAGGCCCCGTGG + Intergenic
916572694 1:166041181-166041203 AGAGTCCCAGGACAGACCCAAGG - Intergenic
917737309 1:177932761-177932783 AGAGGCCCAGGCCAGCCTGGTGG + Exonic
919847095 1:201649109-201649131 CCAGGCCAAGGGCAGCCCGGCGG + Exonic
920030694 1:203035758-203035780 GGAGCCCCAGGACAGCCACGTGG - Intronic
920559674 1:206930326-206930348 CGAGGCCCAGGACGGCCCCCAGG - Exonic
920924529 1:210329083-210329105 CGCCGCCCGGGACAGCCCGGAGG + Exonic
921584545 1:216931616-216931638 AGAGTCCCAGGAGAACCCTGAGG - Intronic
1062791680 10:310568-310590 AGAGCCCCAGCAGAGCCCGGAGG - Intronic
1064655112 10:17548978-17549000 GGAGTCCAAGGGCAGCCTGGAGG + Intergenic
1067281019 10:44872941-44872963 TGAGTTCCAGGACAGTCTGGAGG + Intergenic
1067533907 10:47094204-47094226 CGAGACCCATGACAACCCAGAGG - Intergenic
1068739581 10:60453268-60453290 CAAGTGCCAGCACAGACCGGGGG + Intronic
1072152571 10:92695773-92695795 CGAGTCCCAGGACCGCGGGTGGG + Intergenic
1072624595 10:97103045-97103067 CAAGTCCCAGGACAGCAGGTTGG + Intronic
1073578175 10:104641887-104641909 CGAGTCCCCGGTCAGCGCGAAGG - Exonic
1076630075 10:131847035-131847057 CCAGCCCCAGGACAGCAGGGAGG + Intergenic
1077103192 11:831124-831146 CAAGTCCCAGGCCCGCCCCGTGG + Intronic
1077208068 11:1353540-1353562 CGACCCACAGGACAGCCTGGGGG + Intergenic
1077242754 11:1519324-1519346 GGAGTCCCAGGGCAGTCCTGGGG - Intergenic
1078011472 11:7576154-7576176 GGAGTTCCAGGAAACCCCGGAGG + Intronic
1079077271 11:17391797-17391819 TGAGTCACAGGTCAGCCAGGTGG - Intergenic
1079163284 11:18013415-18013437 GGAGGCCCACGACAGCCCAGAGG + Intergenic
1084154263 11:67304791-67304813 GCAGTCCCAGGACAGCCCCACGG - Exonic
1084266481 11:68007969-68007991 CAAGGCCCAGGCCAGCCAGGGGG - Intergenic
1085442639 11:76578231-76578253 GGAGTTTCAGGACAGCCCCGTGG - Intergenic
1086113009 11:83219124-83219146 CGAGTCCCAGGACTAACCAGAGG - Intronic
1089292258 11:117444379-117444401 GGGGTCCCAGGAAAGCCCTGAGG + Intronic
1090276386 11:125422671-125422693 TGAGCCCCAGGACACCCCAGAGG + Intronic
1092260793 12:6952325-6952347 CAGGTCCCAGGACAGCAGGGAGG - Intronic
1092262275 12:6959126-6959148 CGCGTCCCCGGACAGCCCATCGG - Intronic
1096073485 12:48788635-48788657 CGAGTTCCAGGCTGGCCCGGAGG - Intronic
1100994524 12:100289153-100289175 CGAGGCACAGGACAGCCAGGAGG - Intronic
1103611104 12:122124510-122124532 CGAGTGCCAGGCCAGCCCTGAGG - Intronic
1104757249 12:131276970-131276992 CGAGTCCCAGGCTAGGCTGGAGG - Intergenic
1105004192 12:132710908-132710930 CGAGCCCCCGGCCAGCCCGCAGG - Exonic
1108438068 13:50420822-50420844 CGAGACCCAAGAAAGCCCTGTGG - Intronic
1110568114 13:76976574-76976596 AAAGTGCCAGGAGAGCCCGGAGG - Intergenic
1112957072 13:105073264-105073286 CGAGTCCCACAACAGACTGGGGG - Intergenic
1113798844 13:113076025-113076047 CCAGTCCCAGGACGGCGCGGAGG + Exonic
1117978282 14:61319511-61319533 CCAGTCCCAGGACAGCTGTGTGG + Intronic
1118339071 14:64879768-64879790 TGAGTCCCAGGAGGGCCCGGCGG - Intronic
1121548687 14:94781735-94781757 CGAGCCCCAGGGCTACCCGGAGG - Intergenic
1121778400 14:96606156-96606178 CATGTCCCAAGACAGCCAGGAGG - Intergenic
1122097602 14:99382979-99383001 CGCATCCCAGGAGAGCCCTGAGG - Intergenic
1122578369 14:102755943-102755965 TGACTCCCAGGACAGGCCAGAGG + Intergenic
1122623839 14:103074272-103074294 CCAGTCCCAGGACAGCACTGGGG - Intergenic
1124575489 15:30904050-30904072 CGAGGCCCCGGCCAGCACGGCGG - Intronic
1128496263 15:68200322-68200344 CGAGTCCAAGGACAGCTTGAGGG - Intronic
1129856040 15:78825932-78825954 GGAGTCCCTGGAGAGCCCAGAGG - Intronic
1130224728 15:82047622-82047644 CGAGCCCCGGGACCGCCCCGCGG - Intergenic
1132631227 16:918640-918662 CGTGACCCAGGACAGCTCCGTGG - Intronic
1132643381 16:988057-988079 CGTGTCCCGGGGCAGCCCAGGGG - Intergenic
1132727341 16:1344711-1344733 CCAGCCCCAGGACAGCACTGAGG - Intronic
1132853288 16:2034313-2034335 TGCGTCCCAGGCCAGCCTGGGGG + Intronic
1132853469 16:2034824-2034846 TGCGTCCCAGGCCAGCCTGGGGG + Intronic
1132879692 16:2156577-2156599 CCAGTCCCAGGACATGCAGGAGG + Intronic
1135147091 16:19972157-19972179 GGAGTCCCAGGGCAGCCCCAGGG + Intergenic
1135255420 16:20937931-20937953 CGAGGCCCAGCCAAGCCCGGAGG + Intronic
1135672707 16:24388862-24388884 CTAGGCCCAGGGCAGCCTGGAGG - Intergenic
1137668560 16:50266155-50266177 TGAGTCCCAGGAAGGCGCGGGGG + Intronic
1137716628 16:50602123-50602145 GGAGGCCCAGGAAAGCCCTGGGG + Intronic
1140111882 16:72011837-72011859 GGAGTCCCAGGACAGCCTTTAGG + Intronic
1142151481 16:88514447-88514469 CGGGCCCCAGGACAGGCCCGTGG - Exonic
1142669601 17:1481927-1481949 AGTGTTCCAGGACAGCACGGAGG - Intronic
1143633451 17:8151473-8151495 CCAGTCCCAGGATGGCTCGGTGG + Intronic
1145278562 17:21452650-21452672 CGAGTCCCAGGGAAGCCCCCTGG - Intergenic
1145828153 17:27893015-27893037 CGAGGTCCGGGGCAGCCCGGAGG - Intronic
1145980324 17:29007253-29007275 TGAGTCACAGGACAGCAAGGGGG + Intronic
1151286998 17:73119393-73119415 TGTGGCCCAGGCCAGCCCGGAGG - Intergenic
1151345590 17:73499431-73499453 GGAGGCCCAGGAGAGCCAGGTGG - Intronic
1151812537 17:76452992-76453014 GGAGTCCGAGGACGGCCCGGAGG + Exonic
1152736496 17:81999912-81999934 ACAGTCCCAGGACAGCCAGGGGG - Intronic
1152923500 17:83077595-83077617 CCAGTCTTAGGACAGCCCGCTGG + Intergenic
1153110762 18:1583592-1583614 CCAGTCCCACGACAACCCTGGGG - Intergenic
1153767154 18:8385564-8385586 TGAGTGCCAGGACAGCAAGGAGG + Intronic
1154332222 18:13439651-13439673 CAAGGCCCAGGATGGCCCGGAGG + Intronic
1155213009 18:23619223-23619245 CACGCCCCAGGACAGCCGGGAGG + Intronic
1155276043 18:24188351-24188373 CAAGCCCCTGGAAAGCCCGGTGG - Intronic
1156445880 18:37236392-37236414 GGGGGCCCAGGACAGCCCAGAGG - Intergenic
1157216160 18:45785452-45785474 CGAGTCTCAGCACAGTCAGGAGG + Intergenic
1157597871 18:48874870-48874892 CGAGCCCCAGCCCAGCCCGGTGG - Intergenic
1158962115 18:62596153-62596175 CGCGTCCCAGGGCAGCACGGAGG - Intergenic
1160024496 18:75207096-75207118 GGAGACCCAGCGCAGCCCGGCGG + Intronic
1160059259 18:75514740-75514762 TGAGTCCAGGGAGAGCCCGGAGG - Intergenic
1160707535 19:536472-536494 CGAGGCCCAGGACCGCCAGCTGG - Intronic
1162324180 19:9989134-9989156 CGAGGTCCAGGATAGCCCGGAGG + Exonic
1162742814 19:12783055-12783077 CGTGACTCAGGCCAGCCCGGGGG + Intronic
1163464714 19:17460617-17460639 CGTGTCCCAGGACTCCACGGAGG - Exonic
1168093781 19:54102936-54102958 TCAGTCCCAGGACCGCCCAGAGG - Intronic
1168283620 19:55319914-55319936 CAAGTCCCAGGAGGGCCGGGCGG + Intronic
931288291 2:60850525-60850547 GGAGTCCCTGGGCAGCCAGGGGG + Intergenic
934783327 2:96986680-96986702 CGTGACCCAGGACTGCCTGGGGG - Intronic
938678047 2:133658498-133658520 CCACTCCCAGGACAGCAGGGGGG - Intergenic
944069937 2:195657350-195657372 CGAGTCCCGGGACGGCGTGGGGG + Intronic
946327883 2:218993994-218994016 CGGGCCCGAGGACACCCCGGGGG - Intergenic
947798964 2:232915106-232915128 CAAATCCCAGGAGAGCCAGGAGG - Intronic
1169119163 20:3084917-3084939 CGCGGCCCATGACAGCCTGGCGG - Intergenic
1170743739 20:19080244-19080266 GGAGTCCTGGGACAGCCTGGAGG + Intergenic
1174074766 20:47925799-47925821 TGATTCACAGGAAAGCCCGGGGG + Intergenic
1175507424 20:59495753-59495775 CGAGTGTGAGGACAGCCCTGGGG - Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1180949387 22:19714399-19714421 CGCGACCCAGGGCGGCCCGGGGG - Intergenic
1181264801 22:21624697-21624719 TGAGTCTCAGGAGAGCCCTGTGG + Intergenic
1184585996 22:45448597-45448619 TGAGTCCCAGGCCCGGCCGGTGG + Intergenic
1184918108 22:47587111-47587133 GGAGCCCCAGGACAGCCAGCAGG - Intergenic
1185246908 22:49777602-49777624 CGGCTTCCAGGACAGCCAGGCGG + Intronic
1185275628 22:49949215-49949237 CCAGGCCCAGGACAGCCTGCAGG - Intergenic
1185319070 22:50192208-50192230 CCAGTCTCAGGACAGCCTGCTGG + Intronic
955329446 3:58034888-58034910 GCAGTCCCAGGAAAGCCCTGAGG + Intronic
960281376 3:115784530-115784552 CGCGTCCCAGGCGAGCACGGAGG - Intergenic
961182286 3:124886731-124886753 GGAGACTCACGACAGCCCGGCGG + Intronic
961378419 3:126482061-126482083 CAAGTCCCAAGCCTGCCCGGGGG - Exonic
962168713 3:133077915-133077937 GTCTTCCCAGGACAGCCCGGGGG + Intronic
962739153 3:138349996-138350018 CGAAGCCCAGGACAGCCACGTGG - Intronic
964680178 3:159329487-159329509 GGAGTCCCAGGGCAGCCTGTTGG - Intronic
968066463 3:195762096-195762118 CGAGTACCAGAACCGCACGGAGG - Exonic
968515966 4:1015776-1015798 TGAGCCCCAGGACAGCCTGGTGG + Intronic
968521696 4:1037231-1037253 CGACTCCCAGGACTGCCGTGTGG + Intergenic
968524589 4:1049506-1049528 GCTGTCCCAGGACAGCCAGGAGG - Intergenic
968748197 4:2372038-2372060 CGAGCCTCAGGTCAGCCCAGTGG + Intronic
969271697 4:6107604-6107626 CGAGTCCCAGTGCAGCCGGGAGG - Intronic
969641604 4:8402124-8402146 TGACTCCCAGGACAGCCTGAGGG + Intronic
969858881 4:10020671-10020693 CGATGCCCAGCACAGCCCAGGGG - Intronic
969880195 4:10167046-10167068 TGAGTTCCAGGAAAGCCAGGAGG - Intergenic
973293321 4:48490693-48490715 CGAGTCCCCGGCCGGCCCCGGGG + Exonic
997302188 5:132814038-132814060 AGAGCCACAGGACACCCCGGGGG + Exonic
1005926733 6:30451329-30451351 CGAGACCCAGCGCAGCCTGGAGG + Intergenic
1005928464 6:30464048-30464070 CGAGGCCCAGGCGAGCCTGGAGG + Intergenic
1011696952 6:89921483-89921505 CCAGTCCCAGCACAGCCTAGTGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1017696510 6:157021433-157021455 CGAGTCACACAGCAGCCCGGCGG + Intronic
1018445575 6:163855153-163855175 CCAGTCTCAGCACAGCCCAGGGG - Intergenic
1019162099 6:170075763-170075785 GCTGTCCCAGGATAGCCCGGAGG + Intergenic
1019554322 7:1621092-1621114 CGAGTCCCAGAAGAGGCCGGTGG - Intergenic
1019989642 7:4682529-4682551 GGAGTCCCCGGATACCCCGGAGG - Exonic
1020010963 7:4805578-4805600 AGGGGCCCAGGACAGCCCCGAGG - Exonic
1020137236 7:5594156-5594178 CGAGCTCCAGGACAGCCGGCGGG - Intronic
1023009632 7:35914476-35914498 TGAGTCCAAAGAAAGCCCGGAGG - Intergenic
1029622501 7:101698874-101698896 CTAGGCCCAGGGCAGCCAGGGGG - Intergenic
1031990247 7:128192782-128192804 GGGGTCCCAGGACAGCCCGCTGG - Intergenic
1034246171 7:149646095-149646117 CGAGTCCAAAGACAGCATGGAGG - Intergenic
1035023046 7:155809916-155809938 CGCGTCCCAGGGCAGGCCGGCGG + Intronic
1035386000 7:158473402-158473424 CCACGCCCAGGACAGCCGGGAGG + Intronic
1035516032 8:232752-232774 CGAATCCCAGGGCTGCCCTGAGG - Intronic
1035690344 8:1555657-1555679 CGAGTCCCAGGACAACTGGGGGG - Intronic
1039750598 8:40474800-40474822 TGAATCCCAGGACACCCCAGTGG + Intergenic
1040290449 8:46121464-46121486 CAATGCCCAGGACAGCCCAGGGG + Intergenic
1040292317 8:46131812-46131834 GAAGGCCCAGGACAGCCCTGGGG + Intergenic
1042484534 8:69336138-69336160 TGAGTCACAGGACTGCCGGGAGG - Intergenic
1049441484 8:142611754-142611776 GAAGTCCCAGGACAGCCCAGAGG - Exonic
1049444324 8:142623088-142623110 TGAGTCTCAGAACAGCCGGGAGG + Intergenic
1050137227 9:2478994-2479016 AGTGTCCCAAGAGAGCCCGGTGG - Intergenic
1050178149 9:2891015-2891037 GGAGGCCCAGGAAAGCCCAGCGG + Intergenic
1057094489 9:92293622-92293644 CGCGTGCCTGGACAGCCCCGCGG + Exonic
1057182039 9:93035526-93035548 CACGGCCCAGGACAGCCCGGGGG + Exonic
1057619022 9:96619127-96619149 GGAGGCCCCGGGCAGCCCGGTGG + Intronic
1060198219 9:121636716-121636738 CCAGTCCCATGTCAGCCTGGAGG + Intronic
1060553995 9:124499058-124499080 CCAGCCCCAGAACAGCCAGGGGG + Intronic
1061117001 9:128620125-128620147 CAAGTCCCAAGGCAGCCCAGAGG + Intronic
1061392580 9:130326025-130326047 AGAGTCCCACGTCAGCCCTGTGG + Intronic
1062481334 9:136753912-136753934 CGTGTCCCAGGCCAGGCGGGAGG + Intergenic
1203761005 EBV:13006-13028 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203761934 EBV:16078-16100 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203762863 EBV:19150-19172 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203763792 EBV:22222-22244 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203764721 EBV:25294-25316 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203765650 EBV:28366-28388 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203766579 EBV:31438-31460 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203767508 EBV:34510-34532 CGGGTCCCAGGCCAGCCGGAGGG + Intergenic
1203792569 EBV:159687-159709 GGCGTCCCGGGAGAGCCCGGAGG - Intergenic
1186082233 X:5945600-5945622 GGATTCCCAGGAAAGCCAGGAGG + Intronic
1186485677 X:9932646-9932668 CCAGCCCCAGGACACCCCGAAGG + Exonic
1187950511 X:24465681-24465703 CGAGCCCCAGGAGAGCCCCCCGG - Intronic
1189556686 X:42152474-42152496 AGAGTCCAAGGACAGCCCCTTGG - Intergenic
1196734639 X:118973642-118973664 CGAATCCCGGCACAGCCCAGTGG - Intergenic
1198213640 X:134537208-134537230 GGAGTCCTAGGACGGCCTGGAGG + Intergenic
1199622993 X:149715635-149715657 GGAGTCCCAGGAGAACCCAGAGG + Exonic