ID: 904701809

View in Genome Browser
Species Human (GRCh38)
Location 1:32362285-32362307
Sequence CGTGGACGCCGCCTCGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904701809_904701819 17 Left 904701809 1:32362285-32362307 CCCGCCGCGAGGCGGCGTCCACG 0: 1
1: 0
2: 1
3: 4
4: 99
Right 904701819 1:32362325-32362347 CCCGGTCCACACAGACGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 62
904701809_904701814 -1 Left 904701809 1:32362285-32362307 CCCGCCGCGAGGCGGCGTCCACG 0: 1
1: 0
2: 1
3: 4
4: 99
Right 904701814 1:32362307-32362329 GCCGAGGAGCCGCGCATTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 79
904701809_904701817 14 Left 904701809 1:32362285-32362307 CCCGCCGCGAGGCGGCGTCCACG 0: 1
1: 0
2: 1
3: 4
4: 99
Right 904701817 1:32362322-32362344 ATTCCCGGTCCACACAGACGCGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904701809 Original CRISPR CGTGGACGCCGCCTCGCGGC GGG (reversed) Exonic
900241063 1:1617680-1617702 CTGGGACGCTGCCTCGAGGCTGG + Intronic
902920687 1:19664820-19664842 CGTGCGCCCCGCCTCGCGGTGGG - Intergenic
904701809 1:32362285-32362307 CGTGGACGCCGCCTCGCGGCGGG - Exonic
907038356 1:51236444-51236466 CGTGGCCGCCGCCGCCCCGCGGG + Exonic
923684207 1:236142640-236142662 CGGGGGCGCTGCCGCGCGGCCGG - Exonic
1065099570 10:22320748-22320770 CGCGGCCGCCGCCCCCCGGCCGG - Intronic
1069486614 10:68827782-68827804 GGCGCGCGCCGCCTCGCGGCTGG + Exonic
1069486701 10:68828118-68828140 GGCGCGCGCCGCCTCGCGGCTGG + Intronic
1074819593 10:117168312-117168334 TGTGGGCGCCCCCTGGCGGCAGG + Intergenic
1076821608 10:132942559-132942581 CGTGGCCGGGTCCTCGCGGCTGG - Exonic
1076947953 10:133664851-133664873 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076948943 10:133668161-133668183 CCCGGACGCCTCCGCGCGGCAGG + Exonic
1076949927 10:133671460-133671482 CCCGGACGCCTCCGCGCGGCAGG + Exonic
1076950911 10:133674759-133674781 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076951901 10:133678069-133678091 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076952890 10:133681379-133681401 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076953874 10:133684678-133684700 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076954858 10:133741030-133741052 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076955847 10:133744340-133744362 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076956837 10:133747650-133747672 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076957824 10:133750959-133750981 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076958809 10:133754258-133754280 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076959798 10:133757568-133757590 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1076960782 10:133760867-133760889 CCCGGACGCCTCCGCGCGGCAGG + Intergenic
1077324120 11:1956381-1956403 TGGGGACGCCGCCCCGCCGCGGG - Exonic
1202807106 11_KI270721v1_random:11576-11598 TGGGGACGCCGCCCCGCCGCGGG - Intergenic
1091766370 12:3122689-3122711 AGTGGACGCCACCTCCCTGCAGG - Intronic
1113940276 13:114015219-114015241 CTTGGCCGCCGCCTCCCGGAGGG + Exonic
1122162282 14:99793262-99793284 CGAGGCCGCCCCCTCGCGGGCGG + Intronic
1122781779 14:104146819-104146841 CGTGGAGACCGCCACGGGGCAGG + Intronic
1124291664 15:28457301-28457323 CGTGGACGCCACCCGGCGGGAGG - Intergenic
1132185618 15:99799631-99799653 CGTGGACGACGCCTAGCTGCAGG - Intergenic
1132547798 16:541220-541242 CGTGGATGCCACCTGGAGGCTGG - Intronic
1132903053 16:2268656-2268678 CGTGGACGCGGCCTCCCGGCAGG + Intergenic
1133001382 16:2853278-2853300 GGTGGACGGCGCCTGGCTGCTGG - Exonic
1136707120 16:32200372-32200394 CGTGGACACCACCTGGCGGGAGG + Intergenic
1136760790 16:32729045-32729067 CGTGGACACCACCTGGCGGGAGG - Intergenic
1136807313 16:33141341-33141363 CGTGGACACCACCTGGCGGGAGG + Intergenic
1137673726 16:50293557-50293579 CGGGGAGGCCGCCTGGGGGCCGG - Intronic
1138178711 16:54928798-54928820 CGCGGACGCTCCCTCGTGGCTGG + Intergenic
1141198246 16:81877632-81877654 TGTGGACACCGCCTGGCTGCTGG + Intronic
1142411359 16:89918745-89918767 CCTGCACGCCGCCTGGTGGCAGG + Exonic
1203062942 16_KI270728v1_random:989359-989381 CGTGGACACCACCTGGCGGGAGG - Intergenic
1142631683 17:1229770-1229792 CGTCGGCGGCTCCTCGCGGCGGG + Intergenic
1142643009 17:1295517-1295539 CGTGGACGGCGCCCGGAGGCTGG + Exonic
1143030412 17:3964324-3964346 CGTCGAGGCCGCCTCTCCGCCGG + Intronic
1151857930 17:76736575-76736597 GGAGGACCCCGCCTCGCGACTGG - Exonic
1152663178 17:81552362-81552384 CGGAGCCGCCGCCGCGCGGCCGG - Exonic
1152918061 17:83052078-83052100 CGTAGACGCCGCCGCGGGGAAGG + Intergenic
1157359498 18:46964508-46964530 CGAGGTCGCCGCCTGGCGACCGG - Intronic
1157361092 18:47024027-47024049 CGAGGTCGCCGCCTGGCGACCGG - Intronic
1157362082 18:47029942-47029964 CGAGGTCGCCGCCTGGCGACCGG - Exonic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1161018703 19:1997497-1997519 CGTGGCCGCCACCCCACGGCCGG + Intronic
1163516441 19:17766819-17766841 CGTGGGCGCCGCCCAGCGGCTGG + Intronic
1163662997 19:18589560-18589582 CTTCGCCGCCGCCTCGCGGGAGG + Exonic
1165089203 19:33373857-33373879 AGTGGAGGCCGCCTGGGGGCAGG + Exonic
1167216836 19:48170689-48170711 GGTGGACGCCGCTCCGGGGCGGG + Exonic
1167269384 19:48498935-48498957 CGAGGACGACTCCTCGCTGCGGG - Exonic
936427442 2:112433325-112433347 CGAGGCCGCCGCCGCCCGGCCGG + Intronic
936561312 2:113541876-113541898 CCGGGACTCCGCCTCGCGCCCGG - Intergenic
940640550 2:156341669-156341691 CGTGGACGCCCCCGCCCTGCGGG - Intronic
942292575 2:174487073-174487095 CGGGGGCGGGGCCTCGCGGCCGG - Exonic
945404017 2:209423830-209423852 CGCGGTCCCCGCCTGGCGGCCGG + Intergenic
948931860 2:241137163-241137185 GGTGGTCGCCTCCTCGCTGCTGG + Exonic
1179511815 21:41878804-41878826 CGACGACGCCGCCCGGCGGCGGG + Exonic
1180980500 22:19876100-19876122 CGTGGCCGCCTCCCCCCGGCGGG - Intronic
1183720233 22:39558025-39558047 CCTGGACGACCCCCCGCGGCCGG + Intergenic
1185222844 22:49637516-49637538 CCTGGACGCCTTCTCGCTGCAGG + Intronic
956892335 3:73624842-73624864 CGGGGTCGCCGCCGGGCGGCCGG + Exonic
958980014 3:100709685-100709707 CGCGGCCGCCGCCTCTCCGCAGG - Exonic
959085855 3:101849880-101849902 CGCGGGCGCCGCCTCTCGACCGG - Exonic
961831927 3:129627319-129627341 AGGGGACGCTGCCTCGCGGATGG + Intergenic
968010508 3:195271138-195271160 CATGGCCGCCGCCTGGCGCCGGG - Exonic
968221361 3:196942536-196942558 CGCGGACGCAGCCTCGTGCCGGG - Exonic
968575394 4:1364000-1364022 CGTGGGGGCCACCTCCCGGCAGG + Intronic
968575419 4:1364064-1364086 CGTGGGGGCCACCTCCCGGCAGG + Intronic
968575444 4:1364128-1364150 CGTGGGGGCCACCTCCCGGCAGG + Intronic
968575469 4:1364192-1364214 CGTGGGGGCCACCTCCCGGCAGG + Intronic
985456347 4:190082128-190082150 CCCGGACGCCTCCGCGCGGCAGG + Exonic
997302055 5:132813567-132813589 GGTGGGCGCCGCGTCGCCGCGGG - Exonic
998200367 5:140113877-140113899 GGTGGGCGCCGCCTGGCGGGCGG + Intronic
1001081569 5:168671415-168671437 CGTGGAAGCCGCCTAGAGGCCGG + Exonic
1001928740 5:175658160-175658182 CGCGGCCGCCGCCTCCCCGCGGG + Intronic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1014931684 6:127343568-127343590 AGCGGAGGGCGCCTCGCGGCAGG - Intronic
1019457534 7:1138238-1138260 CGCGGACGCCGCCTTCCGGCAGG + Exonic
1019765191 7:2844457-2844479 CGTCGACCCCGCCCCGAGGCCGG - Intergenic
1020139624 7:5605444-5605466 CGTGGACCCCGCCTCGCTCTGGG + Exonic
1029482911 7:100823799-100823821 CGTGGACGGCGCCCCGCCGTGGG + Exonic
1034428654 7:151028670-151028692 CGTGGACTCCATCTCCCGGCGGG - Intronic
1034885326 7:154794361-154794383 CGTGGCTGCCACCTCGTGGCTGG + Intronic
1034977671 7:155457775-155457797 CGCGGCCGCCGCCCCGCTGCGGG - Intergenic
1037547816 8:19940383-19940405 CGTGCTCGCAGCCGCGCGGCGGG - Intronic
1049372588 8:142274829-142274851 CGAGGACGCAGCCTCAAGGCTGG + Exonic
1049891376 9:73463-73485 CCGGGACTCCGCCTCGCGCCCGG + Intergenic
1053072932 9:35111617-35111639 CGTGGCCGCCGCGGCGCGGGTGG - Intronic
1053732803 9:41074535-41074557 CCGGGACTCCGCCTCGCGCCCGG + Intergenic
1053736809 9:41107427-41107449 CTTAGACACCGCCTCGCGGGGGG - Intergenic
1054691564 9:68323970-68323992 CTTAGACACCGCCTCGCGGGGGG + Intergenic
1054695624 9:68357019-68357041 CCGGGACTCCGCCTCGCGCCCGG - Exonic
1056378241 9:86035064-86035086 AGTGGACGCCCCCTCCTGGCAGG - Intronic
1061060921 9:128250309-128250331 CGTGGACGACTCCTGGCTGCAGG + Exonic
1062596279 9:137301324-137301346 CCTGCCCGCCGCCTCGCGGGTGG - Exonic
1062610478 9:137371328-137371350 CGGGGCCGTCGTCTCGCGGCGGG - Intronic