ID: 904702493

View in Genome Browser
Species Human (GRCh38)
Location 1:32366193-32366215
Sequence CTGTCCATACATAAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904702493_904702495 12 Left 904702493 1:32366193-32366215 CCTGCCTGCTTATGTATGGACAG 0: 1
1: 0
2: 0
3: 8
4: 185
Right 904702495 1:32366228-32366250 CAGCTTCCTCCGAGAGAGACTGG 0: 1
1: 0
2: 1
3: 11
4: 147
904702493_904702496 15 Left 904702493 1:32366193-32366215 CCTGCCTGCTTATGTATGGACAG 0: 1
1: 0
2: 0
3: 8
4: 185
Right 904702496 1:32366231-32366253 CTTCCTCCGAGAGAGACTGGTGG 0: 1
1: 0
2: 2
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904702493 Original CRISPR CTGTCCATACATAAGCAGGC AGG (reversed) Intronic
901904649 1:12397659-12397681 CTGCCAATAAATATGCAGGCAGG + Intronic
902425577 1:16318949-16318971 CTGTCCATCTGTAAGGAGGCTGG - Intronic
902792190 1:18776959-18776981 CTCTCCATTCACAACCAGGCTGG + Intergenic
903395288 1:22997337-22997359 AAGTCCATACATCAGCAGGCAGG - Intergenic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
906904336 1:49873119-49873141 AAGTCCATACATCAGTAGGCAGG - Intronic
911158801 1:94662076-94662098 AAGTCCATACATCAGTAGGCAGG + Intergenic
911662601 1:100519476-100519498 CAGTCCATTCTTAAGCAGCCTGG - Intronic
913487310 1:119343444-119343466 AAGTCCATACATTAGTAGGCAGG + Intergenic
914893181 1:151646435-151646457 CTATCCATCCAAAAGAAGGCAGG - Intronic
915652806 1:157331252-157331274 AAGTCCATACATTAGTAGGCAGG - Intergenic
915721525 1:157989275-157989297 CTGCCCCAACAGAAGCAGGCAGG - Intergenic
916115506 1:161481945-161481967 CTGTCCATCCAGAAGGAGGTTGG - Intergenic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
921300240 1:213745003-213745025 CTGTCCAAACACAAACACGCTGG + Intergenic
921482493 1:215679067-215679089 CTGTCCACATGTAGGCAGGCTGG + Intronic
924618565 1:245637943-245637965 CTGACCAAAAATAACCAGGCTGG - Intronic
1063687932 10:8256463-8256485 CTGTCCCTCCCTAAGCAGCCTGG - Intergenic
1071369338 10:84935273-84935295 CTGGACATACATGAGGAGGCTGG + Intergenic
1072932679 10:99680478-99680500 CCGTCCATACTTACGTAGGCCGG + Intronic
1073259838 10:102181102-102181124 AAGTCCATACATTAGTAGGCAGG + Intergenic
1075329908 10:121566521-121566543 CTGTCCCTACAGAAGAAGCCTGG - Intronic
1077534677 11:3117887-3117909 AAGTCCATACATCAGTAGGCAGG - Intronic
1078051553 11:7969343-7969365 AAGTCCATACATCAGTAGGCAGG + Intergenic
1078607463 11:12789703-12789725 CTCTCCATACATATCCATGCTGG - Intronic
1079347340 11:19664441-19664463 CTGACCAGTCATAACCAGGCTGG - Intronic
1083624610 11:64065833-64065855 CTCTCCATGCACAGGCAGGCAGG + Intronic
1083731023 11:64652763-64652785 CTGCCCATAAATATGCAGGATGG + Intronic
1084528540 11:69712773-69712795 CTGGCCAGAGATCAGCAGGCCGG + Intergenic
1085464727 11:76715982-76716004 CTCACCTTACCTAAGCAGGCAGG + Intergenic
1088360713 11:108986077-108986099 CTGGTAATACAAAAGCAGGCAGG - Intergenic
1090100329 11:123788593-123788615 AAGTCCATACATCAGTAGGCAGG + Intergenic
1091966498 12:4746652-4746674 CTGTGAGTACAGAAGCAGGCTGG - Intronic
1092576290 12:9786941-9786963 ATGTCCACACATCAGGAGGCAGG - Intergenic
1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG + Intronic
1093708472 12:22302388-22302410 AAGTCCATACATCAGTAGGCAGG - Intronic
1095553964 12:43477667-43477689 CTCTCAATACACAAGCATGCAGG + Intronic
1096910120 12:54974718-54974740 CTGACCATTCAAAAGCAGGGAGG + Intronic
1097253587 12:57655442-57655464 AAGTCCATACATAAGTAGGCAGG - Intergenic
1097995367 12:65882244-65882266 CTGTTCATACTGAAGCAGCCAGG + Intronic
1098256334 12:68619923-68619945 CTGTCTATAGATGAGCAGTCAGG - Intronic
1103717376 12:122952914-122952936 CTGTCCACACAGTAGAAGGCAGG + Intronic
1104030336 12:125060539-125060561 AAGTCCATACATCAGTAGGCAGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105757605 13:23483411-23483433 AAGTCCATACATTAGTAGGCAGG + Intergenic
1106748147 13:32726185-32726207 ATGTGCATACATATGCAGACAGG - Intronic
1112413269 13:99181740-99181762 AAGTCCATACATTAGTAGGCAGG + Intergenic
1113024613 13:105926895-105926917 CTGTCAGTACACAAGCAGTCTGG - Intergenic
1115092488 14:29594966-29594988 CTGTTCATACATCAGCAGCTAGG + Intronic
1116568714 14:46487340-46487362 CTGTCCACTCAGAGGCAGGCTGG - Intergenic
1117187459 14:53255063-53255085 AAGTCCATACATCAGTAGGCAGG + Intergenic
1118358299 14:65034203-65034225 CTGTCCAGACTGAAGCAGGAGGG - Intronic
1118631403 14:67707018-67707040 TAGTCCATACATCAGTAGGCAGG + Intronic
1120408944 14:84126517-84126539 CTGTACTTAGATAAGCAGGTTGG + Intergenic
1124875965 15:33593505-33593527 AAGTCCATACATTAGTAGGCAGG + Intronic
1128289251 15:66464358-66464380 AAGTCCATACATCAGTAGGCAGG + Intronic
1130823748 15:87522179-87522201 ATGTCCTTACTCAAGCAGGCAGG + Intergenic
1131462106 15:92624739-92624761 CTTTCCACACATAAGAAGCCGGG + Intronic
1132294404 15:100725046-100725068 AAGTCCATACAAAAACAGGCAGG + Intergenic
1140419935 16:74810973-74810995 TAGTCCATACATCAGTAGGCAGG - Intergenic
1141508176 16:84494572-84494594 AAGTCCATATATCAGCAGGCAGG - Intronic
1143244990 17:5476825-5476847 CTGCCCAAACATTAGCAGGATGG + Intronic
1145195844 17:20894556-20894578 CTGTGCATCCTTATGCAGGCAGG + Intronic
1145206857 17:20989097-20989119 CTCTACATACAGAAGCAGGAGGG + Intergenic
1146915732 17:36677092-36677114 CTGTCCATCCAAACACAGGCTGG - Intergenic
1147515658 17:41115323-41115345 AAGTCCATACATCAGTAGGCAGG - Intergenic
1149294357 17:55248344-55248366 CTGTCCAGAGATAGGCAGCCTGG - Intergenic
1156943398 18:42796871-42796893 CTGTCTTTACTTAAGGAGGCAGG - Intronic
1157165109 18:45351650-45351672 CTGAGCGTACATAAGTAGGCTGG - Intronic
1157912897 18:51636036-51636058 AAGTCCATACATCAGTAGGCAGG - Intergenic
1158852265 18:61506768-61506790 CTGTCCATGGAGAGGCAGGCTGG + Intronic
928672639 2:33618159-33618181 CTGTCCAAGCATACTCAGGCAGG - Intergenic
929121424 2:38487170-38487192 CTGTTTAAACATAATCAGGCTGG + Intergenic
930414665 2:51076319-51076341 AAGTCCATACATCAGTAGGCAGG + Intergenic
933649490 2:84838896-84838918 CTCTCCACACATAAGCCAGCTGG - Intronic
938471151 2:131563529-131563551 CAGTCCATACCTCAGTAGGCAGG - Intergenic
940782571 2:157948665-157948687 CTATCAATACCTAAGCAGGAAGG - Intronic
940987909 2:160066729-160066751 AAGTCCATACATCAGTAGGCAGG + Intergenic
941536757 2:166732205-166732227 CAGTCCATAGTCAAGCAGGCAGG - Intergenic
942964558 2:181875999-181876021 CTGTCCTTAAATCAGAAGGCAGG - Intergenic
946701178 2:222415920-222415942 AAGTCCATACATCAGTAGGCAGG - Intergenic
947287886 2:228538003-228538025 AAGTCCATACATTAGTAGGCAGG - Intergenic
1169144116 20:3241209-3241231 GGGTCCTTACATAGGCAGGCAGG + Intergenic
1173677262 20:44846793-44846815 CAGTCAATGCAAAAGCAGGCTGG + Intergenic
1175530443 20:59671252-59671274 CTGTACATTCACAAGAAGGCTGG + Intronic
1179196840 21:39172038-39172060 CTTTCCATGCATAAGTAGCCAGG + Intergenic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184576752 22:45374758-45374780 AAGTCCATACATTAGTAGGCAGG - Intronic
1185317146 22:50184186-50184208 CTGTCCACACGGCAGCAGGCTGG - Intergenic
1185374745 22:50477160-50477182 CTGACCAGAAATCAGCAGGCTGG - Intergenic
1185406138 22:50652415-50652437 AAGTCCATACATCAGTAGGCAGG - Intergenic
953925617 3:46980954-46980976 CTGGCCCTCCATAAGGAGGCTGG + Intronic
954053079 3:47998602-47998624 CTGAACATATATAAGCAGTCTGG + Intronic
954402339 3:50325535-50325557 CTGTCCATCCATCTGAAGGCGGG + Exonic
955534725 3:59910731-59910753 AAGTCCATACATCAGTAGGCAGG + Intronic
956329719 3:68092802-68092824 ATGTGCATACAGAAGAAGGCAGG + Intronic
956605025 3:71065136-71065158 CTCTCCAGACAAAAGCAGGGTGG - Intronic
956742679 3:72287365-72287387 CTGTCCAGAGATAGGGAGGCTGG + Intergenic
956862577 3:73339259-73339281 CTGTTCAAACACAAGAAGGCAGG - Intergenic
958953633 3:100443023-100443045 AAGTCCATACATCAGTAGGCAGG + Intronic
959868413 3:111299254-111299276 CTGTACATCCATTAGGAGGCAGG + Intronic
960613856 3:119579697-119579719 CTGTCCCCAGATAAGCAGGGTGG - Exonic
963914269 3:150843021-150843043 AAGTCCATACATCAGTAGGCAGG - Intergenic
964022877 3:152035298-152035320 AAGTCCATACATCAGTAGGCAGG + Intergenic
965936339 3:174117647-174117669 CTCACCAGCCATAAGCAGGCTGG - Intronic
967187945 3:186961409-186961431 TCGTCCATACATAAGGAAGCTGG - Intronic
967816717 3:193805559-193805581 CTGTCTGTAAATAAGCAGGTTGG + Intergenic
968301014 3:197614710-197614732 AAGTCCATACATCAGTAGGCAGG + Intergenic
968361280 3:198148662-198148684 CTGTCCATTCTTCTGCAGGCAGG - Intergenic
968422448 4:497159-497181 CTGTCGATGCAGAAGCAGGCAGG + Intronic
969322407 4:6420585-6420607 CTTTCCAGACCTAAGCAGGTGGG - Intronic
970034681 4:11719756-11719778 CTATGTATACACAAGCAGGCTGG + Intergenic
970798613 4:19945666-19945688 CTAGCCAGGCATAAGCAGGCAGG + Intergenic
971693203 4:29864685-29864707 AAGTCCATACATCAGTAGGCAGG - Intergenic
972764906 4:42143603-42143625 CTGTGCATACATTAGGTGGCTGG - Exonic
972853413 4:43076513-43076535 AGGTCCATACATCAGTAGGCAGG + Intergenic
978356771 4:107884236-107884258 AAGTCCATACATTAGTAGGCAGG - Intronic
978562303 4:110046069-110046091 CTGTCTAGACATATTCAGGCAGG - Exonic
978950209 4:114548942-114548964 ATGTCCATACATCACCAGTCAGG + Intergenic
980279676 4:130703639-130703661 ATGTCCATACTGAAGCAGTCAGG - Intergenic
980471460 4:133257824-133257846 AAGTCCATACATTAGTAGGCAGG + Intergenic
981706076 4:147660331-147660353 CTGTATTTAAATAAGCAGGCTGG + Intronic
984170430 4:176351849-176351871 AAGTCCATACATTAGTAGGCAGG + Intergenic
985226914 4:187771077-187771099 AAGTCCATACATTAGTAGGCAGG + Intergenic
988417735 5:30967446-30967468 AAGTCCATACATCAGGAGGCAGG + Intergenic
989575896 5:42987799-42987821 AAGTCCATACATCAGCAGGCAGG + Intergenic
997999625 5:138614614-138614636 ATGTCCAAACATCAGCATGCAGG + Intronic
998647295 5:144076391-144076413 ATGTCCATGCATGAGCATGCAGG - Intergenic
1000787891 5:165569448-165569470 CTATCCATTCAGAAGAAGGCAGG - Intergenic
1001596998 5:172904889-172904911 CTGGCCTTACATAACCAGCCTGG + Intronic
1002191902 5:177482727-177482749 CCGTCCAAACAGAAGAAGGCAGG - Intergenic
1002703738 5:181146694-181146716 AAGTCCATACATCAGTAGGCAGG - Intergenic
1002864581 6:1109725-1109747 CAGGCCATACAAAAACAGGCTGG + Intergenic
1004088237 6:12472852-12472874 CTGCCCATACATGAAGAGGCAGG + Intergenic
1005322647 6:24669804-24669826 AAGTCCATACATCAGTAGGCAGG + Intronic
1005371214 6:25135809-25135831 AAGTCCATACATCAGTAGGCAGG - Intergenic
1006654716 6:35581087-35581109 CTGTACTTACAAAAACAGGCAGG + Intronic
1006966090 6:37986765-37986787 CTATCCATACTTAACCAGGAAGG + Intronic
1007388412 6:41535110-41535132 CAGACCATACAAAACCAGGCAGG - Intergenic
1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG + Exonic
1009645074 6:66391067-66391089 CTATCCAGGCATAAGCAGCCTGG - Intergenic
1011175228 6:84552414-84552436 CTGTCAAAACAAAAACAGGCCGG - Intergenic
1011940103 6:92832614-92832636 AAGTCCATACATTAGTAGGCAGG - Intergenic
1011954021 6:93002646-93002668 CTGCCAGTACAAAAGCAGGCAGG + Intergenic
1013479040 6:110536821-110536843 AAGTCCATACATCATCAGGCAGG + Intergenic
1013640001 6:112064871-112064893 CTGTTCATACCAAAGCTGGCTGG + Exonic
1014132446 6:117849696-117849718 AAGTCCATACATTAGTAGGCAGG + Intergenic
1014266672 6:119285695-119285717 CTTTCCATATATAAGAAAGCAGG + Intronic
1014455723 6:121632504-121632526 AAGTCCATACATCAGCAGGCAGG + Intergenic
1015985679 6:138881946-138881968 CTGTCCATGCAAAAGCTAGCAGG + Intronic
1016639700 6:146334674-146334696 CTGGCCAGACATAAGCTGGTGGG - Intronic
1017074441 6:150604484-150604506 CAGGCCATACAAAAACAGGCTGG + Intronic
1017386114 6:153885641-153885663 AAGTCCATACATCAGCAGGTAGG + Intergenic
1017501754 6:155032231-155032253 CTGTGCACAGACAAGCAGGCAGG - Intronic
1018806660 6:167267145-167267167 CTGTCCATAACTAAGCATCCAGG + Intergenic
1018916406 6:168135130-168135152 CTGTACATACACACCCAGGCTGG - Intergenic
1019254409 7:40059-40081 CTGTCCATTCTTCTGCAGGCAGG + Intergenic
1021147869 7:17111328-17111350 AAGTCCATACATCAGTAGGCAGG - Intergenic
1022852392 7:34277639-34277661 CTTTCTATACATTAGCTGGCTGG + Intergenic
1024013383 7:45290005-45290027 AAGTCCATACATTAGTAGGCAGG - Intergenic
1029936449 7:104429915-104429937 GAGTCCAAACATCAGCAGGCAGG - Intronic
1031227250 7:119055199-119055221 AAGTCCATACATCAGTAGGCAGG + Intergenic
1032870833 7:135982897-135982919 AAGTCCATACATCAGTAGGCAGG + Intergenic
1033598548 7:142873341-142873363 CTGTCCAAACATAAGTGGGGTGG + Intronic
1039501086 8:38017955-38017977 AAGTCCATGCATCAGCAGGCAGG - Intergenic
1041650860 8:60300847-60300869 AGGTCCATACATTAGTAGGCAGG + Intergenic
1041933338 8:63310631-63310653 CAGGCCATACAAAAACAGGCAGG - Intergenic
1044751518 8:95421004-95421026 CTGACCAGATAAAAGCAGGCAGG - Intergenic
1045088921 8:98718385-98718407 CTGGCCATAGGTAAGCAGTCTGG + Intronic
1045491249 8:102671152-102671174 CTGTCCAGCTGTAAGCAGGCTGG + Intergenic
1047142453 8:122156419-122156441 CTGTCCATCAGTAAGCACGCAGG + Intergenic
1048082178 8:131140200-131140222 CTATCTAAACATAAGAAGGCAGG - Intergenic
1050663737 9:7912122-7912144 GAGTCCATTCAAAAGCAGGCTGG - Intergenic
1050990411 9:12144282-12144304 AAGTCCATACATTAGTAGGCAGG - Intergenic
1051602801 9:18891484-18891506 CGGTCCATATACAAACAGGCAGG - Intronic
1055056570 9:72029603-72029625 GTGTGCTTACATAAGAAGGCAGG - Intergenic
1055440701 9:76333336-76333358 CTCTCCTCACATAAGCAGGTTGG - Intronic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057909619 9:99007662-99007684 AAGTCCATACATCAGTAGGCAGG + Intronic
1058384263 9:104415264-104415286 AAGTCCATACATCAGTAGGCAGG - Intergenic
1062745991 9:138212482-138212504 CTGTCCATTCTTCTGCAGGCAGG - Intergenic
1189885585 X:45541208-45541230 TTGTCCATACTTGAGCAGGATGG - Intergenic
1190955936 X:55193412-55193434 AAGTCCATACATCAGTAGGCAGG + Intronic
1192246652 X:69378641-69378663 CTTTCTAAGCATAAGCAGGCTGG + Intergenic
1193319479 X:80104947-80104969 AAGTCCATACATCAGTAGGCAGG - Intergenic
1193641653 X:84015954-84015976 GAGTCCATACACAAGTAGGCAGG + Intergenic
1193944526 X:87718063-87718085 CTGTCCATATAAAAGAAGACTGG - Intergenic
1195129740 X:101840494-101840516 CTGACCTTACATAGGCAGACTGG + Exonic
1195225587 X:102789145-102789167 AAGTCCATACATCAGTAGGCAGG + Intergenic
1198402652 X:136282360-136282382 CTGGCCAGACAGGAGCAGGCAGG + Intergenic
1199185883 X:144914143-144914165 AAGTCCATACATCAGTAGGCAGG + Intergenic
1199321179 X:146441080-146441102 AAGTCCATACATCAGTAGGCAGG + Intergenic
1199887205 X:152031971-152031993 AAGTCCATACATCAGTAGGCAGG + Intergenic
1200285085 X:154813312-154813334 AAGTCCATACATCAGTAGGCAGG + Intronic