ID: 904703900

View in Genome Browser
Species Human (GRCh38)
Location 1:32376340-32376362
Sequence CAGAGTAGAGACTCTGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 347}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904703900_904703907 -9 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703907 1:32376354-32376376 TCTACTCTGGCTGGAGGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 213
904703900_904703906 -10 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703906 1:32376353-32376375 CTCTACTCTGGCTGGAGGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 217
904703900_904703912 10 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703912 1:32376373-32376395 TGGGCTCTGGGCCGCCGGTGTGG 0: 1
1: 0
2: 0
3: 18
4: 236
904703900_904703916 25 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703916 1:32376388-32376410 CGGTGTGGCCAGCAGGCGTTAGG 0: 1
1: 0
2: 1
3: 8
4: 92
904703900_904703918 27 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703918 1:32376390-32376412 GTGTGGCCAGCAGGCGTTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 106
904703900_904703909 -2 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703909 1:32376361-32376383 TGGCTGGAGGCCTGGGCTCTGGG 0: 1
1: 1
2: 11
3: 81
4: 856
904703900_904703910 5 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703910 1:32376368-32376390 AGGCCTGGGCTCTGGGCCGCCGG 0: 1
1: 0
2: 4
3: 48
4: 480
904703900_904703913 18 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703913 1:32376381-32376403 GGGCCGCCGGTGTGGCCAGCAGG 0: 1
1: 0
2: 1
3: 28
4: 169
904703900_904703917 26 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703917 1:32376389-32376411 GGTGTGGCCAGCAGGCGTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 93
904703900_904703908 -3 Left 904703900 1:32376340-32376362 CCTCCCTCAGAGTCTCTACTCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 904703908 1:32376360-32376382 CTGGCTGGAGGCCTGGGCTCTGG 0: 1
1: 2
2: 6
3: 79
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904703900 Original CRISPR CAGAGTAGAGACTCTGAGGG AGG (reversed) Exonic
901081414 1:6586226-6586248 CATAGGAGGGACTCTGTGGGAGG + Intronic
901146212 1:7066295-7066317 CTGAGATGAGACACTGAGGGTGG - Intronic
901616175 1:10541479-10541501 CAGTGCAGAGCCTCTGGGGGCGG + Intronic
902122414 1:14177996-14178018 CATAGGAGGGACTCTGTGGGAGG + Intergenic
902775680 1:18673174-18673196 TAAAGAAGAGACTCTGAGAGGGG - Intronic
903225810 1:21893667-21893689 CAGAGTAGAGACAGAGAAGGAGG + Intronic
903478342 1:23635678-23635700 CAGAGGAGAGACAGTGAGGCAGG + Intronic
904262727 1:29299311-29299333 CAAAGTGGAGACTTTGAAGGTGG + Intronic
904365549 1:30008878-30008900 TAGAGAAGAGACACTGAGGTAGG - Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
907293433 1:53433421-53433443 GAGGGTAGAGACACAGAGGGCGG - Intergenic
908022353 1:59911242-59911264 CAGAAGAGAACCTCTGAGGGAGG + Intronic
908853366 1:68395906-68395928 CTCAGTAGAGACTCTGTGTGGGG + Intergenic
909160913 1:72148095-72148117 CACAGTAGAGACTCTGTGTAGGG + Intronic
909265245 1:73549959-73549981 CCCAGTACAGACTCTGTGGGGGG + Intergenic
909360834 1:74757173-74757195 CCGAGTAGGGACTCTGTGTGGGG - Intronic
911358524 1:96849343-96849365 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
911369579 1:96980577-96980599 CAAATTAGAGACTTTGGGGGTGG + Intergenic
911501970 1:98698146-98698168 CAGATTAGAGATGCTGATGGTGG + Intronic
912004363 1:104878675-104878697 CACAGTAGTGACTCTGTGTGGGG - Intergenic
912376223 1:109212070-109212092 CTAAGTAGAGACCCTGAGGGAGG - Intergenic
912511064 1:110190414-110190436 CAGAGCAGTGAGGCTGAGGGCGG - Intronic
912524368 1:110270206-110270228 CAGAGAGGAGAGTCTGAGGGCGG - Intronic
912741172 1:112198926-112198948 GACAGTGGAGACTCAGAGGGTGG - Intergenic
913199355 1:116483647-116483669 CTGAGTGAAGACTCTGAGGCAGG + Intergenic
915752397 1:158223969-158223991 CCCAGAAGAGACTCTGTGGGGGG - Intergenic
915831813 1:159138299-159138321 AAGAGCAGAGACTCTGATGTGGG - Intronic
916087950 1:161284827-161284849 CAGAGTAGGGTGCCTGAGGGTGG + Exonic
916679479 1:167090838-167090860 CAGAATATAAACTCTGAAGGGGG - Intergenic
916736557 1:167612543-167612565 CAGAGGAGTGACACTGATGGTGG + Intergenic
917082665 1:171272387-171272409 CCCAGTAGAGACTCTGTGTGGGG - Intronic
917892471 1:179453232-179453254 CCCAGTAGAGACTCTGTGTGGGG - Intronic
919862741 1:201752388-201752410 AAGAGTAGAGAATCTTAGTGGGG + Intronic
920361880 1:205424249-205424271 CATAGTGGAGACTCAGAGGCAGG - Intronic
920439647 1:205971141-205971163 CAGAGCTGAGCCTCTGAGGTTGG + Intergenic
922320153 1:224479950-224479972 CCCAGTAGAGACTCTGTGTGGGG + Intronic
922588479 1:226753877-226753899 CAGAGTAGAGGCCCTGAGGCAGG + Intergenic
923402819 1:233631583-233631605 CAGAGTAGAGATGATGAGTGAGG - Intronic
923428052 1:233891667-233891689 CACAGTGGAGACTCTGTGCGGGG - Intergenic
1063754317 10:8989000-8989022 CAGGATAGATACTTTGAGGGTGG + Intergenic
1065155334 10:22864088-22864110 CAGAGCAGATACTGTGAGGTGGG + Intergenic
1065794970 10:29298380-29298402 CAGAGGAGGGACACTGAGGTTGG - Intronic
1066273284 10:33844364-33844386 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
1067286839 10:44913066-44913088 CTGAGTGGAGGCACTGAGGGAGG + Intronic
1068289961 10:54989279-54989301 CCGAGTAGGGACTCTGTGTGGGG - Intronic
1068550930 10:58407186-58407208 CAGAGTAAAGACTCAGAAGTGGG - Intergenic
1070339309 10:75482111-75482133 AGGAGTATACACTCTGAGGGAGG - Intronic
1070564274 10:77591545-77591567 CAACTTAGAAACTCTGAGGGTGG + Intronic
1073444698 10:103573805-103573827 CAGAGTGGGGACTGTGAGGGAGG - Intronic
1074042863 10:109809793-109809815 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
1074298258 10:112210734-112210756 CAGAGCAGAAACTCTGGAGGTGG - Intronic
1075297388 10:121290079-121290101 AACAGTTGAGACTGTGAGGGCGG + Intergenic
1075977398 10:126707618-126707640 CAGAGTGGAGACCCTGGGGTGGG - Intergenic
1076274706 10:129187361-129187383 CATAGGAGAGACTCGGTGGGAGG - Intergenic
1076532094 10:131151694-131151716 CCCAGTAGAGACTCTGTGTGGGG + Intronic
1077475807 11:2789930-2789952 CAGAGAGGAGCCTCTGAGTGGGG - Intronic
1077610767 11:3642076-3642098 CAGACTGGAGGCTCTGAGGAAGG - Exonic
1080497182 11:32831325-32831347 CAGAGTACTGACACTGAGTGGGG - Intronic
1080949104 11:37008294-37008316 CAGAGTTGAGGGTCTGAGTGGGG + Intergenic
1082249318 11:49961627-49961649 CCTAGTAGAGACTCTGTGTGGGG - Intergenic
1083700459 11:64474071-64474093 GAGAGCAGAGACTCTGGTGGGGG + Intergenic
1083929881 11:65835680-65835702 CAGAGTAGAGATACTAAGGCAGG + Intronic
1083956614 11:65987424-65987446 CTGAGTGGAGACCCTGAGTGGGG - Intergenic
1084014766 11:66371838-66371860 CAGAGTCGAGTCCCTGAGGCGGG - Intronic
1084340228 11:68493675-68493697 CAGAGTAGAGATGCCCAGGGTGG + Intronic
1084908800 11:72370822-72370844 CAGGGTAGAGAAGCAGAGGGAGG - Intronic
1084946761 11:72642707-72642729 CAGGGTGGAGGCTCTGAGAGCGG - Intronic
1086078326 11:82877795-82877817 CCCAGTAGAGACTCTGTGTGGGG - Intronic
1086593695 11:88545466-88545488 CAGACTAGAGAATCAAAGGGTGG - Intronic
1086821568 11:91442375-91442397 CCCAGTGGAGACTCTGTGGGGGG + Intergenic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1088988199 11:114928391-114928413 CAGAGAAGAGGCACAGAGGGAGG + Intergenic
1089489959 11:118876734-118876756 CAGAGGCGAGATTCTGATGGAGG - Intergenic
1090534606 11:127626813-127626835 CAGAGAAGAAACTCTTAGTGTGG - Intergenic
1091617471 12:2060315-2060337 CAGGGTAGAGACTGTGAGACAGG + Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1093465140 12:19440485-19440507 CCGAGTTGAGAGTCTGGGGGAGG - Intronic
1094825612 12:34266847-34266869 GAGAGTAGAGACACAGAGGGAGG - Intergenic
1095370487 12:41461357-41461379 CAGAGTGGAGAATTTGAGGATGG - Intronic
1096272507 12:50177461-50177483 CAGAGTGAAGAGTCTGTGGGTGG - Exonic
1096468661 12:51863266-51863288 CAGAGTAGAGACTGGAAGGGAGG - Intergenic
1096960213 12:55569890-55569912 CCCAGTAGGGACTCTGAGTGGGG + Intergenic
1097721715 12:63029254-63029276 CATAGAAGGGACTCTGTGGGAGG - Intergenic
1098358310 12:69631380-69631402 CAGAGCAGAGGCTCTGAGTCAGG - Intergenic
1098926863 12:76360554-76360576 CCCAGTAGGGACTCTGTGGGGGG + Intronic
1099526795 12:83726573-83726595 CACAGTAGAGACTCTGTGTAGGG - Intergenic
1100155733 12:91798350-91798372 CAAATTAGAAACTCTGGGGGTGG + Intergenic
1100442452 12:94629319-94629341 CAGTCTAGAGTCTCTCAGGGTGG + Intronic
1102547885 12:113669893-113669915 CAGAGTGGAGATTCCGAGAGTGG + Intergenic
1103588460 12:121973420-121973442 CCCAGTAGAGACTCTGTGTGGGG - Intronic
1104244448 12:127024309-127024331 AACATTAGAGACTCTGAAGGAGG + Intergenic
1104297185 12:127527338-127527360 TAGAACAGAAACTCTGAGGGTGG + Intergenic
1105964898 13:25374693-25374715 CAGAGTGGAGGCTCTGAGATGGG + Intronic
1108155865 13:47584165-47584187 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
1108242109 13:48475526-48475548 CAGAGCAGGGACTCTGAGGGAGG + Intronic
1109076749 13:57845750-57845772 CCCAGTAGGGACTCTGTGGGGGG + Intergenic
1109614179 13:64808994-64809016 CACAGTAGGGACTCTGTGTGGGG - Intergenic
1110044813 13:70814197-70814219 CACAGTAGGGACTCTGTGTGGGG - Intergenic
1110665150 13:78108121-78108143 CAGAGTAGAGAATCAAAGAGAGG - Intergenic
1111155104 13:84310962-84310984 CCTAGTAGAGACTCTGTGTGGGG + Intergenic
1112383933 13:98920146-98920168 CAGAAAAGAGACACTGAAGGAGG + Intronic
1112431967 13:99358134-99358156 AGGAGTAGAGAATGTGAGGGCGG + Intronic
1112889478 13:104212568-104212590 AAGGGTAGAGACACGGAGGGAGG + Intergenic
1113061486 13:106326804-106326826 CAGAGCAGAGATTCACAGGGGGG - Intergenic
1113280551 13:108783003-108783025 CCCAGTAGAGACTCTGTGTGGGG - Intronic
1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG + Exonic
1115865924 14:37746480-37746502 CAAATAAGAGACCCTGAGGGTGG + Intronic
1116164196 14:41312070-41312092 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1116580667 14:46637325-46637347 CAGTGTTGAGAGTCTGTGGGTGG + Intergenic
1120419021 14:84258919-84258941 AAGAGTAGAGACACACAGGGAGG - Intergenic
1121303794 14:92892210-92892232 GAAAGGAGAGACACTGAGGGAGG + Intergenic
1122145570 14:99687115-99687137 CAGAGGAGGGGCACTGAGGGAGG - Intronic
1122683031 14:103481158-103481180 AGGTGTAGAGACTCTGAGGTGGG + Intronic
1125018932 15:34966056-34966078 GAGACTAGAGAGTTTGAGGGAGG - Intronic
1125523192 15:40359213-40359235 CAGAGGAGGGATTCTGGGGGCGG - Intronic
1125912179 15:43450814-43450836 CAAAGTAGAGATTCTGAGTGGGG - Intronic
1128847818 15:70917136-70917158 CATAGAAGGGAATCTGAGGGGGG + Intronic
1129003567 15:72353757-72353779 CAGAGTAAAGACTCAGGGAGTGG + Intronic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1130149115 15:81297972-81297994 CAGAGCAGAGGCCCTGTGGGTGG + Intronic
1130763977 15:86851632-86851654 CACTCTAGAGACTCTGAGGATGG - Intronic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131647641 15:94362437-94362459 CTGAGGAGGGACTCTGAGGCAGG - Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134370222 16:13616701-13616723 CTGGGCAGAGACTCTGGGGGAGG - Intergenic
1135535928 16:23294486-23294508 AAGAGAAGAGACTAAGAGGGGGG - Intronic
1139240642 16:65388611-65388633 CATGGTAGAGACTCAGTGGGAGG - Intergenic
1140613999 16:76637410-76637432 TAGAGTAGAGACACAGAGGTGGG + Intergenic
1141030386 16:80582627-80582649 CACATTAGAGACTCAGAAGGAGG + Intergenic
1142025289 16:87809583-87809605 CAGAGGAGAGACTGTGTGAGGGG - Intergenic
1142122714 16:88394975-88394997 CAGAGTGGAGAGGCTGATGGGGG - Intergenic
1142959254 17:3542474-3542496 CAGACAGGAGTCTCTGAGGGTGG - Intronic
1143457611 17:7078072-7078094 CAGAGCAGAGACGCTGCAGGAGG + Exonic
1144222769 17:13114947-13114969 CAGAGGAGAGAGGCTGCGGGAGG - Intergenic
1145230720 17:21171534-21171556 CAGAGCAGACACTCAGAGGACGG - Intronic
1146456302 17:33012373-33012395 TTGAGGAGAGACTTTGAGGGGGG + Intergenic
1146480533 17:33201632-33201654 CAGAGTAGAAGCTCAGAGGCAGG - Intronic
1146625190 17:34430060-34430082 CAGAGTAGAAACTCGGACGGTGG + Intergenic
1146681848 17:34814183-34814205 CAGAGAAGAGACTATGAAGAAGG - Intergenic
1147886165 17:43685819-43685841 CAGAGCAGAATCTCTGAGAGTGG - Intergenic
1147952235 17:44113695-44113717 CAGAGTGCAGCCTTTGAGGGAGG - Intronic
1148552234 17:48557441-48557463 CAAAGTAGAGCCTGTGAGTGGGG - Intronic
1148818105 17:50345430-50345452 CAAAGCAGACACTCTGGGGGAGG + Intergenic
1149341138 17:55687557-55687579 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1150860653 17:68797127-68797149 GAGGGTAGAGACACAGAGGGTGG + Intergenic
1153463388 18:5362375-5362397 TAGAATAGAGACTCTTAGGAGGG + Intergenic
1155665796 18:28307123-28307145 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1156422845 18:36974315-36974337 AAGAGTGGAGGCTATGAGGGGGG - Intronic
1157042871 18:44060979-44061001 CAGAGAGGAGACTCTGTGGTGGG + Intergenic
1158681386 18:59570347-59570369 CAGAGCAGATGGTCTGAGGGTGG - Intronic
1159592723 18:70352501-70352523 CAGAGTCGACATTCTGATGGAGG + Intergenic
1161395375 19:4042638-4042660 CTGGGTAGGGTCTCTGAGGGAGG - Intergenic
1161789355 19:6349720-6349742 GACAGATGAGACTCTGAGGGAGG + Intergenic
1162327339 19:10006990-10007012 CAGAGGAGACATTCAGAGGGAGG - Intronic
1162327368 19:10007124-10007146 CAGAGGGGAGGCTCAGAGGGAGG - Intronic
1162615653 19:11798549-11798571 GAGTGCAGAGACTCTGAGTGCGG - Exonic
1164540265 19:29116732-29116754 AAGAGTAGAGCCTTTGAGGAAGG - Intergenic
1164990637 19:32680172-32680194 CAGAGATGAGACTCTGGGGAAGG - Intergenic
1165784860 19:38455441-38455463 CGGATTAGAGAAGCTGAGGGGGG - Exonic
1166268419 19:41699372-41699394 CAAAGGAGAGCCTCTGCGGGAGG - Intronic
1167103623 19:47418685-47418707 CAGAGGAGAGAGACTGCGGGTGG + Intronic
1167209179 19:48122452-48122474 CGGTGCAGAGACCCTGAGGGAGG - Intronic
1168069864 19:53943320-53943342 CAGAGTTGGGGTTCTGAGGGGGG - Exonic
925001184 2:404000-404022 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
925324496 2:3007385-3007407 CCGAGTTGAGACTCTTTGGGAGG - Intergenic
925932796 2:8723596-8723618 CAGAGTAGTCCATCTGAGGGAGG + Intergenic
926939347 2:18118562-18118584 CAAAGTAGGGACTCTGTGTGGGG - Intronic
927163324 2:20291417-20291439 CAGAATAGAGACGCCGAGCGAGG - Intronic
928680111 2:33692914-33692936 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
928812704 2:35248396-35248418 CCCAGTAGGGACTCTGTGGGGGG + Intergenic
929807746 2:45162131-45162153 CCCAGGAGAGATTCTGAGGGAGG + Intergenic
930076174 2:47407420-47407442 CCCAGTAGGGACTCTGTGGGGGG - Intronic
931497630 2:62827415-62827437 CAGAGAAGATCCTTTGAGGGTGG + Intronic
932441821 2:71742450-71742472 TTGAGTAGAGGCTCTGAGAGTGG + Intergenic
932854360 2:75218289-75218311 AAGAGTAGAGACACTGAGAAGGG + Intergenic
933177467 2:79191668-79191690 GAAAGTAGAAACTTTGAGGGAGG + Intronic
937060324 2:118976044-118976066 CAGAGTGGAGCCACTGAGGCTGG + Intronic
937164001 2:119795076-119795098 CAGAGAGGAGACCCTGAGGTGGG + Intronic
937435988 2:121881578-121881600 CAAAGCAGAAACTCTGTGGGTGG + Intergenic
937547120 2:123036190-123036212 CACAGTAGGGACTCTGTGTGGGG + Intergenic
937751067 2:125476786-125476808 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
937868598 2:126771798-126771820 CAGAGTAGGGACGCTGAGGAAGG + Intergenic
939287675 2:140154133-140154155 CACAGTAGGGACTCTGTGTGGGG + Intergenic
939587413 2:144021999-144022021 CAGAGTGTAGCCTCTGAGGAAGG + Intronic
942232597 2:173874047-173874069 CAGGAAAGAGACTCTGAGAGGGG + Intergenic
943023448 2:182601776-182601798 CAGAGTAGAGACCCTGGAGTGGG + Intergenic
944101334 2:196030979-196031001 CCCAGTAGGGACTCTGAGTGGGG + Intronic
944511277 2:200468601-200468623 CAGAGCAGAGAAGCTGAGGAGGG - Intronic
946108224 2:217390835-217390857 CACAGTAGGGACTCTGTGTGGGG + Intronic
946704882 2:222448508-222448530 CACAGTAGAAACTCTGCAGGTGG - Intronic
1169066938 20:2699027-2699049 GAGAACAGAGACTGTGAGGGGGG + Intronic
1169675126 20:8144528-8144550 CAGAGTAGAGACACTCCTGGAGG + Intronic
1170444512 20:16412121-16412143 CAGAGAAGAGACCATGAGAGAGG + Intronic
1170630825 20:18063353-18063375 CAGTGTAGAAAATCTGAGTGTGG + Intergenic
1172200502 20:33122789-33122811 CACAGTAGGGACTCTGTGTGGGG - Intergenic
1172390417 20:34561481-34561503 CAGAGTAGTGACTGTGGGGATGG - Intronic
1172830913 20:37833622-37833644 CAGAGAACAGCCTCTAAGGGAGG - Intronic
1173101328 20:40091539-40091561 CCCAGTAGAGACTCTGTGGGAGG + Intergenic
1173146286 20:40527386-40527408 CAGAGAAGAGAAGCTGAGGTGGG - Intergenic
1173419477 20:42888146-42888168 CAGAGTAGAGATACTCAGTGGGG - Intronic
1174140669 20:48411249-48411271 CAGAGAAGAGACGGGGAGGGAGG + Intergenic
1174268303 20:49347933-49347955 CAGAGCACAGCGTCTGAGGGTGG + Intergenic
1175291017 20:57875263-57875285 CAGAGGAGAGACACAGAGAGGGG - Intergenic
1176377922 21:6095932-6095954 CAGAGTCCAGACTCTAAGGAGGG - Intergenic
1177479591 21:21669454-21669476 CCCAGTAGGGACTCTGTGGGAGG + Intergenic
1178352241 21:31880544-31880566 CAGAAGAGACACTCAGAGGGAGG - Intronic
1178874115 21:36399805-36399827 CAGGGTAGAGCCACTGATGGAGG + Intronic
1179745552 21:43442316-43442338 CAGAGTCCAGACTCTAAGGAGGG + Intergenic
1180948461 22:19709543-19709565 CAGAGCTGAGGGTCTGAGGGAGG - Intergenic
1183297186 22:37037287-37037309 CAGAGCAGAGCCGCCGAGGGTGG + Intergenic
1184309223 22:43630530-43630552 GAGAGGAGAGAGTCTGAGAGAGG + Intronic
1184858275 22:47158417-47158439 GAGAGGAGAGGCACTGAGGGCGG + Intronic
1185363052 22:50420674-50420696 CCGAGTGGAGTCTGTGAGGGAGG + Intronic
1185390480 22:50558487-50558509 AAGGGTAGAGATTCTGAGGGAGG + Intronic
950969378 3:17170830-17170852 CAGAGTAGAGAAACTAAGTGTGG + Intronic
951369402 3:21826643-21826665 CAGAGCAGGCACTCTAAGGGTGG + Intronic
952508922 3:34034821-34034843 CAGAACAGACCCTCTGAGGGTGG - Intergenic
952827555 3:37536987-37537009 CTGACTAGAAACTCTGAAGGTGG + Intronic
953433301 3:42857262-42857284 AAGAGGAGAGACTCACAGGGTGG + Intronic
953946661 3:47154599-47154621 CAGAGAAGAGATACTCAGGGAGG + Intronic
954216318 3:49126388-49126410 CAGAGTAGGGAGTCTCAGGCTGG + Exonic
955795912 3:62636860-62636882 CAGAGGACATATTCTGAGGGTGG - Intronic
956391665 3:68779806-68779828 CCCAGTAGAGACTCTGTGTGGGG - Intronic
956910067 3:73807809-73807831 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
959172496 3:102859949-102859971 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
959661979 3:108879160-108879182 CACAGTAGAGACTGTGATGAAGG + Intergenic
961175609 3:124832612-124832634 CAGAGAACAGACTCTGTGGAAGG - Intronic
963112005 3:141695802-141695824 GAGGGTAGAGACACGGAGGGTGG + Intergenic
964887330 3:161499547-161499569 CAGAGTATAGTCTCTGGGGAAGG + Intronic
965079896 3:164021913-164021935 GGGAGTAGGGATTCTGAGGGGGG + Intergenic
966928771 3:184662453-184662475 CAGAATGCAGGCTCTGAGGGCGG + Intronic
967830755 3:193917954-193917976 CAGAGTGGAGACTCAAAGTGTGG - Intergenic
970372748 4:15424496-15424518 CTGAGTACAGAATCTGAGGCTGG - Intronic
971670232 4:29546573-29546595 CCGAGTAGGGACTCTGTGTGGGG + Intergenic
972057827 4:34826593-34826615 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
975902704 4:79171567-79171589 TATAGTAAAGACTCTGAAGGGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976884733 4:89969299-89969321 AAGAGTAGAGACACGGAGAGGGG + Intergenic
978140642 4:105313715-105313737 CAGAGTAGCAAGTATGAGGGTGG - Intergenic
978991268 4:115084878-115084900 CACAGTAGGGACTGTGGGGGGGG - Intronic
980523159 4:133957582-133957604 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
981260092 4:142708789-142708811 CACAGTGGAGACTCTGTGTGGGG - Intronic
981903218 4:149890700-149890722 CAGTGGGGAGACTCTGAGGCTGG - Intergenic
982121228 4:152145473-152145495 CACAGTAGGGACTCTGTGTGGGG + Intergenic
982280219 4:153676563-153676585 CAGGGTAGAAACTATGAGTGGGG + Intergenic
982318642 4:154057453-154057475 TAGGGTAGAGACACGGAGGGAGG - Intergenic
982948868 4:161663730-161663752 CCCAGTAGAGACTCTGTGTGGGG + Intronic
983322383 4:166211546-166211568 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
983414864 4:167440311-167440333 AAGAGTAGAGACACTGAGAAGGG + Intergenic
984327096 4:178268730-178268752 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
984959490 4:185081627-185081649 GACAGTGGAGACTCAGAGGGTGG - Intergenic
985245434 4:187975780-187975802 CACACTGGGGACTCTGAGGGTGG + Intergenic
985575484 5:671703-671725 CAGAGTGGAGCCCCTGCGGGGGG - Intronic
986756728 5:10843814-10843836 CCCAGTAGAGACTCTGCGTGGGG + Intergenic
987873309 5:23647838-23647860 CCAAGTAGAGACTCTGTGTGAGG - Intergenic
990521961 5:56589214-56589236 CAGAGGAGATACTTTCAGGGGGG - Intronic
991235981 5:64397947-64397969 CAGAGTAGGTAATATGAGGGAGG + Intergenic
991359253 5:65802850-65802872 CAGAGAAGAGACCCTGGGGTGGG + Intronic
991722662 5:69508287-69508309 CACAGTGGAGAGTCTGAGGTGGG - Intronic
995200050 5:109415271-109415293 CCGAGTAGGGACTCTGTGTGGGG - Intergenic
997108216 5:131045774-131045796 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
997799147 5:136842487-136842509 CAGGTCAGAGACTCAGAGGGTGG - Intergenic
998463882 5:142327722-142327744 CTGAGAAGTGAATCTGAGGGAGG + Intergenic
998813919 5:145993380-145993402 CCTAGTAGGGACTCTGTGGGGGG + Intronic
998996545 5:147873393-147873415 AAGAGTAGAGACACGGAGGAGGG + Intronic
1000367065 5:160501531-160501553 CAAAACAGATACTCTGAGGGTGG + Intergenic
1000439562 5:161249662-161249684 GAGAGTAGAGACATGGAGGGAGG - Intergenic
1000522859 5:162319134-162319156 CCCAGTAGAGACTCTGTGTGCGG - Intergenic
1001542702 5:172550560-172550582 CACAGTAGAGCCCCTGAGGCCGG + Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001795536 5:174499130-174499152 CCTAGTAGAGACTCTGTGTGGGG - Intergenic
1002602813 5:180363704-180363726 AAGTGGAGAGACTCTGAGAGTGG + Intergenic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1003703656 6:8498773-8498795 CAGAAAAGACACTTTGAGGGAGG - Intergenic
1005138378 6:22598332-22598354 CAGAGAAGACTGTCTGAGGGGGG - Intergenic
1005298593 6:24449725-24449747 CAGGGAGGGGACTCTGAGGGAGG - Intronic
1006511515 6:34524041-34524063 CAGAGCAGGGACCCTGAGGTTGG + Intronic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1007706074 6:43792198-43792220 CAGAGTATCTAATCTGAGGGAGG + Intergenic
1010020694 6:71156363-71156385 CAGAGATGAGACTGTGAGGCGGG + Intergenic
1012971667 6:105738084-105738106 CAGAGTAGAGACAAGGGGGGTGG - Intergenic
1014459765 6:121682510-121682532 CAGTGTAAGGTCTCTGAGGGAGG + Intergenic
1014871704 6:126603983-126604005 CTGAGGAGAGGCTGTGAGGGAGG - Intergenic
1015074501 6:129139180-129139202 CAGAGTAAAGGCTCTGAGTCTGG - Intronic
1015143330 6:129959035-129959057 CAGAGAGGAGACCCTGAGGTGGG - Intergenic
1015544524 6:134347854-134347876 CAGAGTACAGGCTCTCTGGGTGG - Intergenic
1016176339 6:141081554-141081576 CCCAGTAGGGACTCTGTGGGAGG - Intergenic
1016177607 6:141099382-141099404 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1016296005 6:142574284-142574306 CCCAGTAGGGACTCTGTGGGAGG - Intergenic
1017371070 6:153709778-153709800 CAGGGTAGGGACAGTGAGGGTGG + Intergenic
1018668505 6:166161374-166161396 CAGAGGCTAGACTCTGAGGCAGG - Intronic
1018890134 6:167977091-167977113 CCGCGTGGAGCCTCTGAGGGGGG - Intergenic
1019047601 6:169160745-169160767 CTGATTAGAGAATCTGAGTGAGG + Intergenic
1022948776 7:35315798-35315820 CACAGTGGTGACTCTGTGGGTGG + Intergenic
1024424731 7:49212493-49212515 CCGAGTAGAGACTCTGTATGGGG + Intergenic
1026120098 7:67529378-67529400 CCCAGTAGAGACTCTGTGTGGGG + Intergenic
1027519063 7:79181179-79181201 CCCAGTAGAGACTCTGTGTGGGG + Intronic
1030915199 7:115304012-115304034 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1032257199 7:130306624-130306646 GAGAGCAGAGCCTCTGAGGGTGG + Intronic
1032322140 7:130895315-130895337 GAGAGCAGAGACTCTGCAGGTGG + Intergenic
1033647035 7:143313087-143313109 CAGGGTAGAGGCTCAGAAGGAGG + Intergenic
1033998714 7:147385821-147385843 CCCAGTAGAGACTCTGTGTGGGG + Intronic
1036732680 8:11280255-11280277 CAGAGTAGGGAAGATGAGGGGGG - Intergenic
1037737539 8:21579614-21579636 CAGAGAAGAGACTCTGAGCTGGG - Intergenic
1038334303 8:26634130-26634152 CAGGCTAGAAACTCTGAGGGCGG - Intronic
1038933809 8:32225391-32225413 CAGAGAAGAAACTCTGGTGGTGG - Intronic
1040632345 8:49230176-49230198 CAGAGTAGGGAGTGTGAGTGTGG + Intergenic
1040691112 8:49939768-49939790 CAGAATAGAGAAATTGAGGGTGG - Intronic
1042828499 8:73002181-73002203 AAGAATACAGACTCAGAGGGTGG - Intergenic
1043718051 8:83509639-83509661 GAGAGTAGAGACACGGAGGGAGG + Intergenic
1043758339 8:84031967-84031989 CAGAGAGGAGACTCTGTGGTCGG - Intergenic
1043831335 8:84992725-84992747 CAGAGTAGAGGGTGTGAGGAGGG - Intergenic
1044887416 8:96794105-96794127 CACAGTAGGGACTCTGTGTGGGG + Intronic
1045360912 8:101432506-101432528 CACAGTAGATCCTCTGAGGAAGG + Intergenic
1045362699 8:101447963-101447985 CACAATAGAATCTCTGAGGGTGG - Intergenic
1046109867 8:109709794-109709816 GAAAGGAGAGAGTCTGAGGGAGG - Intergenic
1046345678 8:112923474-112923496 AAGTGTAAAGACCCTGAGGGAGG - Intronic
1047194943 8:122712806-122712828 CCCAGTAGGGACTCTGAGTGGGG - Intergenic
1047941421 8:129830691-129830713 CCAAGTAGAGACTCTGTGTGGGG + Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1048428621 8:134345938-134345960 CAGTGAAGAGAACCTGAGGGAGG - Intergenic
1048881322 8:138875012-138875034 CAGTGAAGAGACTCTGATGAAGG - Intronic
1048916707 8:139191058-139191080 CAGTGCAGAGAGTTTGAGGGTGG - Intergenic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1049763920 8:144344077-144344099 CAGAGTAGAGCAGCTGAGGGTGG - Intergenic
1049992221 9:1000659-1000681 GAGAGTAGCCACTCTGTGGGTGG + Intergenic
1050243436 9:3661576-3661598 CAGACGAGAGAGTCTGAGGAGGG - Intergenic
1051930296 9:22377121-22377143 CAGGGATGAGATTCTGAGGGAGG - Intergenic
1052019387 9:23508407-23508429 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1053305314 9:36980646-36980668 CAGTGTAGAGACCCTGTTGGAGG + Intronic
1055774349 9:79751891-79751913 CTCAGTAGAGACTCTGTGTGGGG + Intergenic
1055950711 9:81727211-81727233 CACAGTGGAGTTTCTGAGGGTGG - Intergenic
1056087079 9:83161102-83161124 CCCAGTAGGGACTCTGTGGGGGG - Intergenic
1057052837 9:91938734-91938756 CAAAGAAGAGATTCTGAGTGGGG - Intronic
1057197319 9:93122243-93122265 CAGAGGAGAGGCTCTGAGCCTGG + Intronic
1058082207 9:100712360-100712382 CCCAGTAGTGACTCTGTGGGGGG + Intergenic
1058970125 9:110073722-110073744 CAGAGAAAAGACTCTGGGGAGGG - Intronic
1060425816 9:123504615-123504637 CTGAATACAGAATCTGAGGGAGG + Intronic
1060982924 9:127803807-127803829 CAGAGGAGCAACTCAGAGGGAGG - Intronic
1061582131 9:131544719-131544741 CAGACTGGAGAATCTGAGGCAGG - Intergenic
1061876875 9:133548474-133548496 CAGAAAATAGACTCTGAGGTGGG + Intronic
1061973511 9:134056936-134056958 GACAGTTGAGACACTGAGGGTGG - Intronic
1203787523 EBV:136276-136298 CCGCGTGGAGACTCTGAGGCAGG + Intergenic
1186335043 X:8577364-8577386 CAGATTTGAGACTCAGAGGAAGG - Intronic
1186501415 X:10053699-10053721 CAGATTGAAGACTCTGAGGCTGG + Intronic
1186742637 X:12534372-12534394 CCCAGTAGGGACTCTGTGGGGGG - Intronic
1186888040 X:13934422-13934444 CTGAGTGCAGCCTCTGAGGGTGG + Intronic
1187455361 X:19436692-19436714 CAGAGTTGAGACTCTGTCTGAGG - Intronic
1188359706 X:29237782-29237804 CAGAGGAGGAACTCTGAAGGAGG + Intronic
1190166053 X:48073626-48073648 CAGATAAGAGACTTTGATGGTGG + Intergenic
1192483310 X:71503545-71503567 AACAGCAGAGACTCTGAGGAAGG - Intronic
1192920010 X:75696595-75696617 CCCAGTAGAGACTCTGTGTGCGG + Intergenic
1193300258 X:79881056-79881078 CAGAGTGAAGAAACTGAGGGTGG + Intergenic
1193547332 X:82846126-82846148 CAGAGTTGGGACTCTGTGTGGGG - Intergenic
1194467082 X:94246352-94246374 CCCAGTAGAGACTCTGTGTGGGG - Intergenic
1194864936 X:99054060-99054082 CCAAGTAGAGACTCTGTGTGGGG - Intergenic
1195668779 X:107452111-107452133 CAGAGGAGTGACTCTGTTGGTGG + Intergenic
1196558625 X:117120902-117120924 CACAGTAGAGACTCTGTGTAGGG + Intergenic
1197284026 X:124574266-124574288 CAGAGAAGTGGTTCTGAGGGAGG - Intronic
1197379450 X:125721821-125721843 CACAGTAGGGACTCTGTGTGGGG - Intergenic
1197642906 X:128986281-128986303 CACAGTAGGGACTCTGTGTGGGG - Intergenic
1198633000 X:138663023-138663045 CAGACTCTAGACTTTGAGGGTGG - Intronic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199754983 X:150855465-150855487 CAGGAGAGAGACTGTGAGGGGGG + Intronic
1200040089 X:153358705-153358727 CCCAGTAGAGACTCTGTGTGGGG - Intronic
1201596637 Y:15677739-15677761 CAGAGGAGAGACCCAGTGGGAGG + Intergenic
1201936933 Y:19419783-19419805 GAGAGTAGAGACATGGAGGGAGG - Intergenic
1202019834 Y:20452867-20452889 CCCAGTAGAGACTCTGTGTGTGG - Intergenic