ID: 904705490

View in Genome Browser
Species Human (GRCh38)
Location 1:32387181-32387203
Sequence TCTAGATCACCTCATTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904705490_904705495 13 Left 904705490 1:32387181-32387203 CCTGTAAAATGAGGTGATCTAGA 0: 1
1: 0
2: 1
3: 3
4: 137
Right 904705495 1:32387217-32387239 AGAGCAAACAGGAAAAGAGGGGG 0: 1
1: 0
2: 7
3: 86
4: 780
904705490_904705491 2 Left 904705490 1:32387181-32387203 CCTGTAAAATGAGGTGATCTAGA 0: 1
1: 0
2: 1
3: 3
4: 137
Right 904705491 1:32387206-32387228 AGAGATTCTCAAGAGCAAACAGG 0: 1
1: 0
2: 3
3: 22
4: 253
904705490_904705492 10 Left 904705490 1:32387181-32387203 CCTGTAAAATGAGGTGATCTAGA 0: 1
1: 0
2: 1
3: 3
4: 137
Right 904705492 1:32387214-32387236 TCAAGAGCAAACAGGAAAAGAGG 0: 1
1: 0
2: 2
3: 48
4: 534
904705490_904705493 11 Left 904705490 1:32387181-32387203 CCTGTAAAATGAGGTGATCTAGA 0: 1
1: 0
2: 1
3: 3
4: 137
Right 904705493 1:32387215-32387237 CAAGAGCAAACAGGAAAAGAGGG 0: 1
1: 0
2: 10
3: 78
4: 880
904705490_904705494 12 Left 904705490 1:32387181-32387203 CCTGTAAAATGAGGTGATCTAGA 0: 1
1: 0
2: 1
3: 3
4: 137
Right 904705494 1:32387216-32387238 AAGAGCAAACAGGAAAAGAGGGG 0: 1
1: 0
2: 13
3: 96
4: 1022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904705490 Original CRISPR TCTAGATCACCTCATTTTAC AGG (reversed) Intronic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
901497788 1:9631866-9631888 CTTGGATCACCTCATTTGACGGG - Intergenic
903201448 1:21743144-21743166 TCAAAAGCACCTCATTTTGCAGG + Intronic
903751065 1:25621073-25621095 TCTCCCTCACCCCATTTTACAGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904705490 1:32387181-32387203 TCTAGATCACCTCATTTTACAGG - Intronic
905339408 1:37267945-37267967 TCTGGATCACCTCACTTAATGGG + Intergenic
905630127 1:39513929-39513951 TCTGGATCACCTCATCCTCCAGG - Intronic
905667632 1:39772261-39772283 TCTAGATCACCTCATCCTCCAGG + Intronic
907681324 1:56566790-56566812 TATAGATCAACTCATTATTCAGG + Intronic
914247804 1:145898814-145898836 TCTGAATCATCTCATTTTCCCGG + Intronic
915006372 1:152640989-152641011 TCTGGACAAACTCATTTTACGGG + Intergenic
916160815 1:161911888-161911910 TCTAGCCCCCATCATTTTACAGG + Intronic
919037198 1:192328280-192328302 AATATATCACCTCAATTTACAGG + Intronic
920887546 1:209945679-209945701 CCTAAATCACCACAATTTACAGG - Intronic
921591743 1:217012107-217012129 TCTAGGTCACCTCACTTTCATGG - Intronic
923350326 1:233098702-233098724 TCTAGAACACATCCTTTTTCTGG - Intronic
1062975777 10:1681601-1681623 CTGCGATCACCTCATTTTACAGG - Intronic
1064695490 10:17961095-17961117 TCTTGTTCCCCTCATTTTTCAGG - Intronic
1067572404 10:47381110-47381132 TCTGGATAACCTCTTTTTCCTGG + Intronic
1068020043 10:51569902-51569924 TCTACTACAACTCATTTTACTGG + Intronic
1068402507 10:56548673-56548695 TTGAGATCACATCCTTTTACAGG - Intergenic
1068861319 10:61850866-61850888 TCTAGAAAACCACATTTTAGTGG - Intergenic
1069740231 10:70682707-70682729 TCAAGAGCACCCCATTTTTCTGG + Intronic
1073691784 10:105817475-105817497 TCCAGAACACCTCTTTTGACAGG + Intergenic
1078854951 11:15199675-15199697 TCTAACTAACCTCATTGTACCGG - Intronic
1079939511 11:26660929-26660951 TCTACATCCCTTCAGTTTACAGG + Exonic
1081305916 11:41512033-41512055 TCTAATTCACTTCATTTTAGAGG - Intergenic
1086053154 11:82617700-82617722 TCAATATCACCTCATATTTCAGG - Intergenic
1089428999 11:118405182-118405204 TCTAGGTCCTCTCATTTGACAGG + Intronic
1089703681 11:120261319-120261341 TATTATTCACCTCATTTTACAGG - Intronic
1092902258 12:13070958-13070980 TGTAGTCCACCCCATTTTACAGG - Intronic
1099753991 12:86816543-86816565 TCTAGAACACTTAATTTTGCTGG - Intronic
1102547632 12:113668062-113668084 TCTGCATCACCTCATTTGGCTGG - Intergenic
1102897110 12:116607231-116607253 TCTTGCTCACCTCATTTAAAGGG - Intergenic
1104407373 12:128529288-128529310 TCTAGATCTTCTCATTTGTCTGG + Intronic
1105913609 13:24893322-24893344 TCTAAAACAACTCATTTTTCTGG - Intronic
1106790302 13:33148874-33148896 GATAGCTCACCTCTTTTTACTGG - Intronic
1108231080 13:48341707-48341729 TCCAGATTACCAAATTTTACAGG - Intronic
1109975378 13:69825430-69825452 TCTTCATCACCTAATTTAACTGG - Intronic
1110434346 13:75462740-75462762 TGTAGATCACCTCATTATTTGGG + Intronic
1117043751 14:51791755-51791777 TCTAGCTGACCTCATTTCCCAGG - Intergenic
1119493801 14:75061654-75061676 TCTCAATCACCTTAATTTACAGG + Intronic
1120163675 14:81171482-81171504 TGTAGATAACCTCATTTAAGTGG + Intergenic
1124007730 15:25808351-25808373 TCCAGTTTACCTCATTTTGCAGG + Intronic
1133733221 16:8593809-8593831 TGTAGATAAACTCATGTTACAGG - Intergenic
1134827155 16:17294043-17294065 TCAGGAACACCTTATTTTACAGG - Intronic
1141437348 16:84007734-84007756 TCTAGATGTGCCCATTTTACAGG - Intergenic
1144549847 17:16230465-16230487 TCTAAATTCCCTCATTTTATAGG + Intronic
1146355384 17:32129447-32129469 TCAACATGCCCTCATTTTACGGG - Intergenic
1147005457 17:37399592-37399614 TCTAGTTCACCTAATTTTTTGGG + Intronic
1147860465 17:43518819-43518841 TCTAGATAGCCTCATTTAAGTGG + Intronic
1148264323 17:46213123-46213145 TCTAGCTCACTTTTTTTTACTGG - Intronic
1149386108 17:56144847-56144869 TTTCCATCGCCTCATTTTACAGG + Intronic
1150910627 17:69383923-69383945 TCTAGATGATTTCATTTCACAGG - Intergenic
1151424465 17:74021817-74021839 TCTGGCTCAGCTCATTTTAAGGG - Intergenic
1155319071 18:24601094-24601116 TCTTGTTAACTTCATTTTACAGG + Intergenic
1160367000 18:78335153-78335175 TCTTGATCACCTTATTTAAATGG - Intergenic
1162308138 19:9888137-9888159 TCTATATCACCTCTTTGCACTGG + Intronic
1166863491 19:45822831-45822853 CCTGGATCACCTCTTTCTACAGG + Exonic
927311076 2:21631957-21631979 TTTAGTTATCCTCATTTTACAGG + Intergenic
928786360 2:34891100-34891122 ACTAGATCAACTTATTTTAATGG + Intergenic
932845002 2:75125973-75125995 TATAGATAAACTCATGTTACAGG + Intronic
933507020 2:83190014-83190036 TCCAGATGACTTTATTTTACTGG - Intergenic
938418341 2:131123256-131123278 TGTATCTCACCTCGTTTTACTGG - Intronic
939310210 2:140466297-140466319 TCTAGATCTCAGCATGTTACTGG - Intronic
940748146 2:157594278-157594300 TCTTGACCTCCTCATTTTACAGG - Intronic
941841387 2:170088386-170088408 AGTAGCTCACCTCATTTTCCAGG + Intergenic
942078435 2:172378905-172378927 TCAAAATCACCTTATTTGACTGG + Intergenic
944112980 2:196154325-196154347 TCTAGCTCTCCTCATTGTAAAGG - Intronic
1169011882 20:2257904-2257926 TCAATATCATATCATTTTACAGG + Intergenic
1169677677 20:8172874-8172896 TCCTGATCACCTTCTTTTACTGG - Intronic
1171103673 20:22411330-22411352 TGTAGATCACATTATTTTTCTGG + Intergenic
1172635008 20:36404443-36404465 ACTAGACCACCTCATTGTAAAGG + Intronic
1173162871 20:40665137-40665159 TTTATATCTACTCATTTTACAGG - Intergenic
1174255114 20:49248765-49248787 TCCACATGACCACATTTTACCGG + Exonic
1181744757 22:24948272-24948294 TCCAGACGCCCTCATTTTACAGG - Intergenic
1181748129 22:24970159-24970181 TCTTGGTGAGCTCATTTTACAGG - Intronic
949934012 3:9102459-9102481 CCTCACTCACCTCATTTTACAGG - Intronic
950560426 3:13718282-13718304 TCTTCATCACCCCATTTTCCAGG - Intergenic
951388604 3:22074122-22074144 TCTAGATGTCTTCATCTTACAGG - Intronic
952445011 3:33372588-33372610 TCAAGACCCACTCATTTTACTGG - Intronic
958889554 3:99768458-99768480 TCTAGATATCACCATTTTACAGG + Intronic
960747264 3:120904005-120904027 TATAGATAACTCCATTTTACAGG - Intergenic
963200337 3:142579479-142579501 TCTAGCTCAACTCAATTTATTGG + Intergenic
966514612 3:180804874-180804896 TCAAGATCACTTCATGGTACAGG + Intronic
967517638 3:190389044-190389066 CCTAGAGCAACTCATTTTAAGGG - Intronic
969865260 4:10072095-10072117 TCAAGAGCACCACATTGTACTGG + Intergenic
973178506 4:47239536-47239558 TCTATATAGCCTCATTTAACTGG + Intronic
973780054 4:54280157-54280179 ACTAGATCACCTCATGTGAAAGG + Intronic
976086975 4:81416906-81416928 ACTAGATCACATCAGTTTCCAGG + Intergenic
977659985 4:99573861-99573883 CCTAAGTCACCTCATTTTATAGG + Intronic
978073295 4:104497192-104497214 TCTAGGTTACCTCATTTCTCTGG - Intergenic
981495968 4:145392893-145392915 TCTAGATAACCTACTTTTAATGG - Intergenic
982287338 4:153748793-153748815 TTCAGATGACCTCATTTTGCTGG - Intronic
987276013 5:16363467-16363489 TCTAGGACACCTCATTTGCCTGG - Intergenic
987299475 5:16584562-16584584 TCCAGATCATCACATTTTGCTGG + Intronic
989058990 5:37391475-37391497 TCTAGATTACCTCATGTAAGTGG + Intronic
990438227 5:55816268-55816290 TTTAGATTTCCTCATTTGACAGG + Intronic
990848844 5:60177460-60177482 TGAAAATAACCTCATTTTACTGG - Intronic
991541631 5:67736435-67736457 TCTAGATAACCTCATATAAGTGG - Intergenic
995161037 5:108982222-108982244 TCTAGATTACTTTATGTTACAGG - Intronic
996262433 5:121490314-121490336 TCTAGAACACCTTTTTTTCCAGG + Intergenic
996742427 5:126813155-126813177 TTTATATCACCCCATTTTATGGG - Intronic
996984562 5:129543544-129543566 TAAAGCTCACCTCATTATACTGG - Intronic
1001209718 5:169798854-169798876 TCCAACTGACCTCATTTTACAGG + Intronic
1005412388 6:25563846-25563868 TCTTGATGACCTCATTTCAGTGG - Intronic
1014571521 6:123014656-123014678 TGTGGATCAGCTCATTTTTCAGG + Intronic
1017960053 6:159213657-159213679 AGTAGATCTGCTCATTTTACTGG + Intronic
1019265434 7:114381-114403 TCTAGCTCGCCTCATTTTCAAGG - Intergenic
1021484404 7:21151237-21151259 TATAGATGATCTCATTTTGCAGG - Intergenic
1026124203 7:67565218-67565240 TCTAAATCGCCTCCTTTTATGGG + Intergenic
1028423669 7:90662226-90662248 TCATGAGCTCCTCATTTTACAGG + Intronic
1031214977 7:118878979-118879001 TGTAGATAACCTAGTTTTACTGG + Intergenic
1036695746 8:10973939-10973961 TCTAAATGACTTCATTTTTCTGG + Intronic
1037957728 8:23071807-23071829 TTTTTATCCCCTCATTTTACAGG - Intergenic
1038063948 8:23941800-23941822 TCTAAATCTCCTCTTTTTATGGG - Intergenic
1039986981 8:42455874-42455896 TACAAATAACCTCATTTTACAGG - Intronic
1040969597 8:53120305-53120327 TCAAAATCATCTCATTTTCCTGG - Intergenic
1041767908 8:61438786-61438808 TCTATATTATCCCATTTTACAGG - Intronic
1042664852 8:71193730-71193752 TCTAGTTGAGCCCATTTTACAGG - Intergenic
1043655002 8:82652521-82652543 TCTTGATCACCTCAGTGTCCTGG - Intergenic
1045788174 8:105949434-105949456 TCTTGTTAACCTCATTTTAAAGG + Intergenic
1046567050 8:115915091-115915113 TCTAGGACACATCATTTTAAGGG + Intergenic
1053115079 9:35493038-35493060 TATAGATAAACTCATTTCACAGG + Intronic
1056554357 9:87676610-87676632 TCTAGATCAGCGCAGTTTCCTGG + Intronic
1060335407 9:122717243-122717265 TCTACAACACTCCATTTTACAGG - Intergenic
1061577928 9:131519202-131519224 TCGAAATCACCTCATTTGACCGG + Intronic
1061669500 9:132180615-132180637 TGCAGACCCCCTCATTTTACAGG - Intronic
1061736687 9:132665662-132665684 CCAAAATCCCCTCATTTTACAGG - Intronic
1185497142 X:564178-564200 TCTGTATCACCTCATGTCACCGG - Intergenic
1188757969 X:33987600-33987622 GCAAGATGACCTCATTTTATGGG + Intergenic
1189064350 X:37790452-37790474 TCTTAATGTCCTCATTTTACAGG - Intronic
1189599080 X:42602302-42602324 TATAGTTGACCTCATTTCACTGG - Intergenic
1189966814 X:46382161-46382183 GATAGATCAACTGATTTTACCGG + Intergenic
1191157412 X:57288871-57288893 TCTAGATCATCTCATCTCATGGG - Intronic
1191680421 X:63834450-63834472 TCTATATCACCTCAATTTACAGG + Intergenic
1193887776 X:87005201-87005223 TCTAGATAACCTTATTCCACAGG - Intergenic
1195656571 X:107336936-107336958 TCTAGGTCTCCTCACTTTTCTGG - Intergenic
1195658323 X:107354334-107354356 CTTTGCTCACCTCATTTTACTGG + Intergenic
1196618146 X:117791586-117791608 CCTATATCAATTCATTTTACAGG + Intergenic
1196942387 X:120789850-120789872 TCTTGATCATCCCATTTCACAGG + Intergenic