ID: 904706527

View in Genome Browser
Species Human (GRCh38)
Location 1:32394939-32394961
Sequence ACTTAGATGCAGCCTTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904706523_904706527 12 Left 904706523 1:32394904-32394926 CCAGAGTTTGGAGGAATGTGAAT 0: 1
1: 1
2: 2
3: 17
4: 167
Right 904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 130
904706522_904706527 13 Left 904706522 1:32394903-32394925 CCCAGAGTTTGGAGGAATGTGAA 0: 1
1: 0
2: 2
3: 27
4: 220
Right 904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904706527 Original CRISPR ACTTAGATGCAGCCTTTGGA GGG Intergenic
904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG + Intergenic
919155137 1:193754671-193754693 ACTTACATCCAGACCTTGGAAGG + Intergenic
920539151 1:206764419-206764441 AATTAGATTCTGCCTTTTGAAGG - Intergenic
922216426 1:223523652-223523674 AGTTGTATGCTGCCTTTGGATGG - Intergenic
924526166 1:244851769-244851791 ACTCACATACAGCCTTTGAAGGG - Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1063926734 10:10985586-10985608 ATTTTGATGCTGCCTGTGGAAGG + Intergenic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1067664893 10:48269461-48269483 ACTGAAATGCAGCCTTCAGAGGG + Intronic
1068524907 10:58117288-58117310 ACATATCTCCAGCCTTTGGAGGG + Intergenic
1070779080 10:79127138-79127160 AGTCAGCTGCAGCCTTGGGAAGG - Intronic
1074448183 10:113537705-113537727 ACTTACCTGGAGCCTTTGGGAGG - Intergenic
1075235302 10:120722427-120722449 ACTTAGCTGAAGGCTTTGGCTGG - Intergenic
1075798410 10:125136773-125136795 ACTAATAGGCAGCGTTTGGACGG - Intronic
1080929762 11:36797549-36797571 ACTTAGATGCATACTAAGGAAGG - Intergenic
1084775395 11:71371488-71371510 ACTTAGACGCAGCCATTTGGGGG + Intergenic
1085410650 11:76288497-76288519 ACTTGGACGGAGCCTGTGGATGG - Intergenic
1085622207 11:78045989-78046011 AGTTAGAGGCAGCCTCAGGAGGG + Intronic
1087010580 11:93510395-93510417 ACTTAGATCCAGGCCTTGGTTGG - Intronic
1089220500 11:116867110-116867132 ACTGAAAAGCAGCCTTGGGAAGG - Intronic
1089857447 11:121558973-121558995 ACTTATTTTCAGCCTATGGAGGG + Intronic
1093316655 12:17659744-17659766 TCTTGGAGGCAGCATTTGGATGG + Intergenic
1093854085 12:24077385-24077407 TTAAAGATGCAGCCTTTGGAAGG - Intergenic
1094042649 12:26133783-26133805 ACTTAGATTCTGCCTTTGAGAGG - Intronic
1098490373 12:71068960-71068982 ACTTACATGGATCCTTTTGAAGG - Intronic
1101438555 12:104684918-104684940 GATTAGAGGCAGTCTTTGGAGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106342020 13:28838821-28838843 AATTAGCTCCAGCATTTGGAAGG - Intronic
1106424664 13:29614732-29614754 ACTTGGAGGCAGCATTTTGAGGG + Intergenic
1109310943 13:60692616-60692638 AATTAGATGCAGCCATTGATTGG + Intergenic
1111582692 13:90245219-90245241 CCAAAGAAGCAGCCTTTGGAAGG + Intergenic
1112261050 13:97878877-97878899 AGTTTGAAGCAGCTTTTGGATGG - Intergenic
1114738065 14:25063426-25063448 ACTTGGCTTCAGGCTTTGGATGG - Intergenic
1115040564 14:28920214-28920236 TCGTAGATGCCACCTTTGGAAGG - Intergenic
1115206587 14:30912828-30912850 GCTTAGAGACAGCCTTTGGTGGG - Intronic
1116737238 14:48707531-48707553 AGTGAGATGCAGCCTTCAGAAGG - Intergenic
1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG + Intergenic
1117274470 14:54178825-54178847 ACTTACCTGCTGCCTTTGGACGG + Intergenic
1119191895 14:72688590-72688612 ACTTAAATGCAGCCTTGGTAGGG - Intronic
1120587134 14:86326758-86326780 AATTAAATACAGTCTTTGGATGG - Intergenic
1120747877 14:88168213-88168235 ACTTAGAGACAGCCTTTCCAGGG + Intergenic
1121638513 14:95469967-95469989 ACACAGAGACAGCCTTTGGAAGG - Intronic
1121717687 14:96087967-96087989 ACTGGGATGCTGCCTTGGGAAGG - Exonic
1122193668 14:100068413-100068435 AGTTAGGGGAAGCCTTTGGAGGG + Intronic
1124103767 15:26718672-26718694 CCTTAGCAGCAGGCTTTGGATGG + Intronic
1126950252 15:53873002-53873024 ACATGGATGAAGCCTGTGGAAGG - Intergenic
1129507034 15:76089988-76090010 ACATGGAAACAGCCTTTGGATGG + Intronic
1135298507 16:21303612-21303634 ACTTGGATGCAACCCTTGTAAGG - Intergenic
1135491925 16:22916812-22916834 AATTGGCTGCTGCCTTTGGATGG + Intergenic
1137952122 16:52793332-52793354 ACTGAAATGCAGCAGTTGGAAGG + Intergenic
1138141395 16:54571650-54571672 ACTGGGCTTCAGCCTTTGGATGG + Intergenic
1139153637 16:64414921-64414943 AGTTAGATGCAGGCATGGGAAGG - Intergenic
1140312359 16:73862011-73862033 ACTTAGATTCTTCCTTGGGAAGG - Intergenic
1142258790 16:89032470-89032492 ACTGAGATGTAGCGTGTGGATGG - Intergenic
1145009339 17:19358701-19358723 CCAAAGATGCAGCCTTAGGACGG - Intronic
1147927714 17:43955568-43955590 ACATAGATCCTGCCCTTGGAGGG + Intronic
1148674477 17:49437440-49437462 GTTTAGAGGCAGCCTTTGGTTGG + Intronic
1151206652 17:72512997-72513019 ACTGTGAACCAGCCTTTGGACGG - Intergenic
1151280480 17:73070488-73070510 AGTTACATGGAGCCTTTGAAGGG + Intronic
1152037355 17:77881429-77881451 GCTTTGAAGCAGCCTTTGGTGGG - Intergenic
1152440843 17:80308536-80308558 ACTTAGGAGGAGCCTTAGGAGGG - Intronic
1160297723 18:77653730-77653752 GGTTAGATGCAGCCTTTCTAAGG + Intergenic
1165538804 19:36473287-36473309 ATTTAGATTCTGCCCTTGGAAGG - Intronic
1165881437 19:39046784-39046806 AGTGAGATGCAGCCATGGGAGGG + Intergenic
1167023604 19:46897725-46897747 ACTTAGAAACAGCCTTTACAGGG + Intergenic
925035258 2:680166-680188 ACCCAGAGGCAGCCTTGGGAGGG + Intergenic
926984241 2:18604248-18604270 AGTTAAATGCAGCCTTTGAAAGG + Intergenic
927837117 2:26408019-26408041 ACTGAGAAGCAGGCTTTGAAGGG - Intronic
928296811 2:30090835-30090857 ACTGATGTGCATCCTTTGGAAGG - Intergenic
929516884 2:42611554-42611576 ATTGAGATGCAGTCTTTGGGAGG + Intronic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
934869900 2:97853960-97853982 ACTTAGAGGCAGGGTTTGAAAGG + Intronic
941220656 2:162776225-162776247 ACCTACATGTAGCCTCTGGATGG + Intronic
942017018 2:171827984-171828006 GCTTAGATGCTGTCTGTGGAGGG - Intronic
946116617 2:217468330-217468352 ACTTAGCCTCTGCCTTTGGAAGG - Intronic
946645079 2:221824578-221824600 AATTATATGCAGCCTTTGGCAGG - Intergenic
948161356 2:235827582-235827604 ACTTTGCTGCAGCCCTTGGAAGG + Intronic
1169221438 20:3825460-3825482 CCTTAGAGGCCTCCTTTGGATGG + Exonic
1170000636 20:11609557-11609579 TCATAGATGCAGCCTTTAGCGGG + Intergenic
1170024364 20:11872923-11872945 GCTCAGGGGCAGCCTTTGGAAGG - Intergenic
1170394305 20:15909372-15909394 ACTTAGACCCTGCCTTTTGAAGG + Intronic
1171372810 20:24672635-24672657 ACTCAGATGAAGCCTTGGGGTGG - Intergenic
1171955524 20:31459926-31459948 CCTTAGCTTCACCCTTTGGAAGG - Intergenic
1173233367 20:41220476-41220498 AGTTAGATAGAGGCTTTGGAAGG - Intronic
1179513764 21:41892417-41892439 ACTTTGATACAGCCCTGGGAGGG + Intronic
951120315 3:18919038-18919060 ACTTGGATGGACCCTTTGGTAGG + Intergenic
952268634 3:31811139-31811161 GCTCAGATGTAGCCTGTGGATGG + Intronic
954810471 3:53244165-53244187 GGCTGGATGCAGCCTTTGGAAGG - Intronic
955728354 3:61957483-61957505 ACTTGGATGCAGCATTTTTATGG + Intronic
956711124 3:72039713-72039735 AATTAGATGCAGCCGTGAGAAGG - Intergenic
956778658 3:72587420-72587442 CCCTAGATGCTGCCTTGGGATGG + Intergenic
959178449 3:102948030-102948052 ATTTAGATGCAGCCTTTAAAGGG + Intergenic
960926188 3:122796674-122796696 AAGAAGGTGCAGCCTTTGGAAGG - Intronic
965395445 3:168155636-168155658 AATCAGATCCAGCATTTGGAAGG + Intergenic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
974310214 4:60197154-60197176 AGTTTGATGCAGCCTTTTGAGGG + Intergenic
974882750 4:67779938-67779960 AATAAGAAACAGCCTTTGGAAGG - Intergenic
975408131 4:74015366-74015388 ACTTAGAGGGAGCCTTTCCAAGG + Intergenic
978247891 4:106597270-106597292 ACTAAGATCCAGGCTTAGGAAGG - Intergenic
978450165 4:108823790-108823812 AGTGAGATGCTGCCTTTGCAGGG + Intronic
978598557 4:110404245-110404267 ACTTATACGCAGACTTTTGACGG - Intronic
988853872 5:35207201-35207223 AATTAGATGCAATTTTTGGAAGG + Intronic
991260922 5:64666863-64666885 ACTTGACTGCAGCCTTTTGAGGG + Intergenic
994665120 5:102696227-102696249 ACTTACATGGAGCCTCTTGATGG + Intergenic
1003753577 6:9090687-9090709 ACTTGGTTGCAGCCAATGGAAGG - Intergenic
1003935219 6:10968997-10969019 TCTTAGATGCAGTCTCTTGAAGG + Intronic
1004150099 6:13110283-13110305 ACTTAAAAGCAAGCTTTGGAGGG - Intronic
1004583386 6:16975950-16975972 ACATAGATTCTCCCTTTGGATGG - Intergenic
1010577662 6:77552562-77552584 ATTTAGATGCAGCCATTGCATGG - Intergenic
1011937604 6:92800415-92800437 ACTTTGATGGCGCCATTGGACGG - Intergenic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1013978764 6:116105266-116105288 ACTTAGATGCAGCAGTTCGCTGG - Intronic
1015889172 6:137952243-137952265 ACTGGGATGTAGCCTATGGATGG + Intergenic
1022001672 7:26231988-26232010 ACCAAGATGCAGCCTGTGAATGG + Intergenic
1022007564 7:26280180-26280202 ACTTAGATTCTGCCTGTGGTTGG - Intergenic
1023554472 7:41406614-41406636 ACTTAGTGGCAGCCTTCGGTGGG + Intergenic
1028994574 7:97085911-97085933 ACCTAGATGCAGCCTCTGATGGG + Intergenic
1030261598 7:107570619-107570641 ACCTTGTTACAGCCTTTGGAGGG + Intronic
1030473267 7:109995291-109995313 ACTTAGATGTATTCTTGGGATGG - Intergenic
1033425053 7:141236425-141236447 AGATAGATGCAGCCCTTGGGAGG + Intronic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1038490999 8:27971150-27971172 TTTCAGATGCAGCCTTGGGAGGG + Intronic
1038950567 8:32409988-32410010 CCTTAGAGGCAGGGTTTGGAGGG - Intronic
1039847782 8:41337876-41337898 ACTAGGATGAAGCCTTTGGATGG + Intergenic
1040462308 8:47660713-47660735 ACATAGATGCGGCCTTATGACGG - Intronic
1040988676 8:53325259-53325281 ATTTAGAAGCAGTCTTTAGATGG + Intergenic
1046888721 8:119398610-119398632 ACTTAGATTCAGGATTGGGAAGG + Intergenic
1048285402 8:133137472-133137494 ACTTAGATGTGTCTTTTGGAGGG + Intergenic
1049072721 8:140369275-140369297 AGTTAGAAGCAGGCTCTGGAAGG + Intronic
1049871726 8:144984332-144984354 ACATAGCAGCAGCATTTGGAGGG - Intergenic
1052819211 9:33125630-33125652 ACTTGCAAGCAGCCTTTGTAGGG + Intronic
1057926697 9:99158741-99158763 ACTTAGCTCCAGCCTCTGAATGG + Intergenic
1061911496 9:133727568-133727590 GCCTAGCTGCAGCCTCTGGAAGG + Intronic
1185752876 X:2628050-2628072 GCTTAGATGCAGCTGTTGGAGGG + Intergenic
1187606391 X:20887852-20887874 CTTTGGCTGCAGCCTTTGGAAGG + Intergenic
1188175956 X:26989597-26989619 GCATAGATGGAGGCTTTGGAAGG - Intergenic
1188697190 X:33208414-33208436 AATTGGATACAGCCTTGGGAGGG - Intronic
1192131623 X:68557401-68557423 ATTTAGGTCCTGCCTTTGGAAGG - Intergenic
1198054732 X:132982602-132982624 ACTGAAATGAAGCCTTTTGAAGG - Intergenic
1198627939 X:138600255-138600277 AATTAGATTCAGTCTCTGGAAGG - Intergenic