ID: 904707483

View in Genome Browser
Species Human (GRCh38)
Location 1:32402303-32402325
Sequence GCATCGGAGGCCACCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904707483_904707490 12 Left 904707483 1:32402303-32402325 CCCTTGAGGGTGGCCTCCGATGC 0: 1
1: 0
2: 1
3: 14
4: 71
Right 904707490 1:32402338-32402360 CTTCTTGATGTCATCATATTTGG 0: 10
1: 16
2: 16
3: 43
4: 339
904707483_904707492 30 Left 904707483 1:32402303-32402325 CCCTTGAGGGTGGCCTCCGATGC 0: 1
1: 0
2: 1
3: 14
4: 71
Right 904707492 1:32402356-32402378 TTTGGGCAGCTCTCTCCAGATGG 0: 1
1: 0
2: 1
3: 16
4: 236
904707483_904707491 13 Left 904707483 1:32402303-32402325 CCCTTGAGGGTGGCCTCCGATGC 0: 1
1: 0
2: 1
3: 14
4: 71
Right 904707491 1:32402339-32402361 TTCTTGATGTCATCATATTTGGG 0: 1
1: 0
2: 2
3: 23
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904707483 Original CRISPR GCATCGGAGGCCACCCTCAA GGG (reversed) Intergenic
902728700 1:18354179-18354201 ACATCTGAGGCCAGCCTTAAAGG + Intronic
903493897 1:23751442-23751464 GAACCGAAGGCCACCCTCAGGGG + Exonic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
912469905 1:109899502-109899524 GCATCAGGGGCCAGACTCAATGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
918189199 1:182156000-182156022 GCATAAGAGGCTACCCTCGAGGG + Intergenic
919764165 1:201115513-201115535 TCATTGGAAGCCACCCTAAAGGG - Exonic
921967378 1:221104867-221104889 GCATCTGATGCCACACTCCAAGG - Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1092262858 12:6961801-6961823 GCAGCTGGGGCCACCCTCAGGGG + Intergenic
1092361413 12:7839784-7839806 GCTTCGGAGGCCAGGCTCGATGG + Intronic
1104356499 12:128091234-128091256 GCATGGGAGGCCAGCCCCAGGGG - Intergenic
1104746671 12:131215180-131215202 GCAGCGGAGCCCACCCACCAGGG - Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1109432537 13:62253961-62253983 GAATCTGAGGTCAACCTCAATGG + Intergenic
1114450157 14:22820034-22820056 GCATCAGAGGTCACTGTCAATGG - Intronic
1120714325 14:87823823-87823845 GCATTGAGGGCCACCCTCAGTGG + Intergenic
1122604927 14:102941827-102941849 GCAGGGGAGGCCACCCACACAGG + Intronic
1127350783 15:58149923-58149945 GCATCTGTGGCTACCATCAAAGG - Intronic
1127823692 15:62684032-62684054 GCAACAGAGACCACCATCAAGGG - Intronic
1132564488 16:615196-615218 GCATCGAAGGACACCATCAATGG - Intronic
1133597523 16:7307397-7307419 GCATCGGAGTCTACTCTGAATGG + Intronic
1139422554 16:66857496-66857518 AACTCTGAGGCCACCCTCAAAGG + Intronic
1143972711 17:10807069-10807091 GCATGGAGGGCCACCTTCAATGG - Intergenic
1152287594 17:79421844-79421866 GCCTCGTGGGCCACCCTCACGGG - Intronic
1152828001 17:82479541-82479563 GTCTCCAAGGCCACCCTCAAAGG + Intronic
1164569781 19:29364908-29364930 ACATCCGTGGCCACCCTCAGTGG - Intergenic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166727502 19:45037747-45037769 GGATAGGAGGCCGCCCCCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
929562166 2:42962679-42962701 GCGTCTGAGCCCTCCCTCAATGG - Intergenic
932865747 2:75340000-75340022 GCATCTTAGGCCACCCTTGAAGG + Intergenic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
939841442 2:147193591-147193613 GCATCAGAGGCAACAATCAATGG + Intergenic
941321957 2:164066754-164066776 GCATCAGAGGCTACCATAAAAGG + Intergenic
942591148 2:177548032-177548054 GCAGCTGAGGCCACATTCAAAGG + Intergenic
942904157 2:181161007-181161029 GCAGTGGTGGCCACCCTCGAGGG - Intergenic
946709224 2:222489215-222489237 CCATCCAAGCCCACCCTCAAGGG + Intronic
947587820 2:231367453-231367475 GCCTGGGAGGCAGCCCTCAAAGG - Intronic
947843469 2:233224786-233224808 GCATCCAAACCCACCCTCAATGG + Intronic
1171019735 20:21574506-21574528 GCCTTGGAGGCCACTCCCAAAGG - Intergenic
1171086277 20:22240842-22240864 CCAGTGGAGGCCACCCTCAGTGG - Intergenic
1175444187 20:59008819-59008841 GCATCAGAGGCCAAGCACAAGGG - Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1180090085 21:45529401-45529423 GGCTCGGAGGCCACCCTGGAGGG + Intronic
1183746859 22:39697189-39697211 CCAGAGGAGGCCAGCCTCAAAGG - Intergenic
1185072474 22:48664273-48664295 GCATCAGAGGCAACATTCAAAGG - Intronic
953449514 3:42994532-42994554 GCATCGGAGGCCTCCAGAAATGG - Intronic
956167147 3:66405518-66405540 TCTGCGGAGGCCACACTCAAGGG + Intronic
961502836 3:127350015-127350037 GCGTCTGAGGCCACCTTCCAGGG - Intergenic
961649321 3:128409637-128409659 GCCGCGGAGGCCACGCTCACCGG - Intergenic
966491443 3:180531955-180531977 GGATTGGAGGCAACCCCCAAGGG + Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
980978211 4:139631338-139631360 GCATCTGAAACCACCCTCACAGG - Intergenic
984490666 4:180430993-180431015 GTATCCGAGGCCTCCCTAAAAGG - Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
997615817 5:135245582-135245604 GCATCAGAGGCCAGCCCCAGTGG + Intronic
997709733 5:135993918-135993940 CCATGGGAGGCCACTGTCAAAGG + Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1004684370 6:17928459-17928481 ACATCAGAGGCCACCACCAAAGG + Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1009513084 6:64577891-64577913 GCATCTTAAGCCACCCTCTAAGG - Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1013724544 6:113077475-113077497 ACATAGGAGGCCATCCTGAATGG + Intergenic
1017035610 6:150264402-150264424 GCATAGGATGCCACACTCACAGG + Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1023385430 7:39652223-39652245 CCATAAGAGGCCACCCTCATGGG - Intronic
1034931629 7:155168061-155168083 GGATGTGAGGCCACTCTCAATGG - Intergenic
1036116637 8:5966857-5966879 GCATCTCAGGCTACCCACAAGGG - Intergenic
1040002691 8:42592561-42592583 GCATCGGAGACCGACCTCACTGG + Intergenic
1049109377 8:140634264-140634286 GCAGTGGGGGCCACCATCAACGG + Intronic
1049172509 8:141170571-141170593 GCATCTGAGCTCACCCTCATCGG - Intronic
1062684110 9:137801173-137801195 CCAGCAGAGGCCACCCTCTAGGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic
1190320518 X:49176926-49176948 GCATCAGAGACCACCACCAAAGG - Exonic
1200143021 X:153911046-153911068 GCATGGGAGGCCATCCTGGAGGG - Intronic