ID: 904707495

View in Genome Browser
Species Human (GRCh38)
Location 1:32402384-32402406
Sequence CAGGTCTACAACCCACATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904707494_904707495 -10 Left 904707494 1:32402371-32402393 CCAGATGGCAGATCAGGTCTACA 0: 1
1: 0
2: 3
3: 16
4: 108
Right 904707495 1:32402384-32402406 CAGGTCTACAACCCACATGTTGG 0: 1
1: 1
2: 2
3: 3
4: 98
904707488_904707495 27 Left 904707488 1:32402334-32402356 CCACCTTCTTGATGTCATCATAT No data
Right 904707495 1:32402384-32402406 CAGGTCTACAACCCACATGTTGG 0: 1
1: 1
2: 2
3: 3
4: 98
904707489_904707495 24 Left 904707489 1:32402337-32402359 CCTTCTTGATGTCATCATATTTG 0: 10
1: 19
2: 14
3: 28
4: 245
Right 904707495 1:32402384-32402406 CAGGTCTACAACCCACATGTTGG 0: 1
1: 1
2: 2
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904707495 Original CRISPR CAGGTCTACAACCCACATGT TGG Intergenic
900503757 1:3019085-3019107 CAGGTCCACCACCAACCTGTGGG - Intergenic
901989612 1:13102219-13102241 CAGTTCAACAACCTAAATGTTGG + Intergenic
901992200 1:13124533-13124555 CAGTTCAACAACCTAAATGTTGG - Intergenic
902654050 1:17855477-17855499 CAGGTCAATAACACAGATGTCGG + Intergenic
904707495 1:32402384-32402406 CAGGTCTACAACCCACATGTTGG + Intergenic
909973429 1:82018432-82018454 CAGTTGTACAACCTACATTTAGG + Intergenic
913507774 1:119534020-119534042 CAGGTCCACAAATAACATGTTGG + Intergenic
913558360 1:119992366-119992388 AAGGTCTACAATCCACTTGGAGG + Intronic
913639481 1:120798085-120798107 AAGGTCTACAATCCACTTGGAGG - Intergenic
914278966 1:146151851-146151873 AAGGTCTACAATCCACTTGGAGG + Intronic
914540014 1:148602793-148602815 AAGGTCTACAATCCACTTGGAGG + Intronic
914626632 1:149468424-149468446 AAGGTCTACAATCCACTTGGAGG - Intergenic
915643326 1:157247291-157247313 CACGGCTATAACCTACATGTAGG + Intergenic
921414610 1:214871428-214871450 CAGGTCTCGTACCAACATGTTGG - Intergenic
1067048390 10:42998678-42998700 CAGGTTTACAACCCACTGGCTGG - Intergenic
1067770571 10:49120619-49120641 CAGGTCTACAGCCCACAGCCTGG - Intergenic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1073792358 10:106953487-106953509 CAGATCTAAAACCCACAGATAGG + Intronic
1076244590 10:128936636-128936658 CAGTACTACAACACACATGCCGG + Intergenic
1076711551 10:132338495-132338517 CAGGATTACACCCCACAAGTGGG - Intronic
1076987068 11:245606-245628 CAGGTGGACCAGCCACATGTCGG - Intronic
1077186884 11:1239449-1239471 GACTTCTACAACCCACATGGGGG + Exonic
1086581805 11:88408450-88408472 CAGGTCCACTACCGACACGTTGG + Intergenic
1096277386 12:50221384-50221406 GAGGTCTGCAATCCACATGAAGG + Intronic
1097611281 12:61824259-61824281 CCAGTCTGCAACTCACATGTTGG - Intronic
1098970230 12:76847172-76847194 AAGGTATAAAACCCACATGATGG - Intronic
1100780052 12:98014442-98014464 GAGCTCTACAATCCAAATGTTGG - Intergenic
1102473973 12:113176695-113176717 GAGGTCTGCAGCCCACATCTGGG + Intronic
1104370253 12:128218033-128218055 CTGGTCTACAAGCCACATCAAGG + Intergenic
1110730561 13:78875439-78875461 CAAGGCTACAACCCAGATATTGG + Intergenic
1114639118 14:24207233-24207255 AAGGGCTACAACCCACAGGCTGG - Exonic
1121428110 14:93867690-93867712 CCTGTCCACAGCCCACATGTGGG - Intergenic
1122709518 14:103645343-103645365 CAGGTCTACAAACCAAGTGGTGG + Intronic
1125643534 15:41251470-41251492 CTGGTCTGCAACCCAGAGGTTGG - Intronic
1127827549 15:62718324-62718346 CAGATGTGCCACCCACATGTGGG - Intronic
1131274556 15:90970069-90970091 CTGGGCTAGAACCCACATGTAGG + Intronic
1133080081 16:3311662-3311684 CAGGTGTACAGCCCACATTGTGG - Intronic
1135534727 16:23284479-23284501 CAGGTCAACAACCCACATGTTGG + Intronic
1135559467 16:23464856-23464878 GAGGTCTACAACCCACCTAATGG + Exonic
1136133511 16:28239961-28239983 CAGGTCCACGACCGACACGTTGG + Intergenic
1137408662 16:48209629-48209651 CAGGTCTACCGCCCAGGTGTCGG + Intronic
1138261599 16:55627454-55627476 CAGTTTTACAAGCCACATATGGG - Intergenic
1138281310 16:55773891-55773913 CAGGCCCACAGCCCACAAGTGGG - Intergenic
1139634712 16:68251126-68251148 CAGGTTTAAAAACCACCTGTTGG - Intronic
1142500037 17:327192-327214 CAGGGCTGCAACCCACACCTGGG - Intronic
1153077084 18:1175277-1175299 TGGGTCTACAACCCACCTATTGG - Intergenic
1153195486 18:2591457-2591479 CATGTATACAACTCCCATGTGGG - Intronic
1154058295 18:11033157-11033179 CCTCTCTACAACACACATGTGGG + Intronic
1161113557 19:2483813-2483835 CAGGTGTATAAACAACATGTGGG - Intergenic
1163250648 19:16124632-16124654 CAGCCCCAGAACCCACATGTGGG - Intronic
1164696800 19:30251030-30251052 CCGGTCTACAAAGAACATGTGGG + Intronic
1166281613 19:41797985-41798007 CAGTTCTACTTCCCACATATGGG + Intronic
925215953 2:2096003-2096025 CATGTGTAAAACCCACAGGTGGG - Intronic
932822139 2:74910763-74910785 CAGGTGAACAACCCAGATGATGG - Intergenic
933161788 2:79032994-79033016 CAGGTCTAAAATCAAGATGTTGG - Intergenic
936516183 2:113182944-113182966 CAGGTCTAGGACACACATCTGGG - Exonic
936669706 2:114642964-114642986 CAGGTATATAACCCCCATGTGGG - Intronic
941939492 2:171019253-171019275 CAAGTCTATAAGCCAAATGTAGG + Intronic
942863710 2:180647215-180647237 CAGGTGGAAAACCCACATTTGGG - Intergenic
943436000 2:187866718-187866740 CAGCTCTACAACCCTCAAGCTGG + Intergenic
946948513 2:224847365-224847387 CAGGACAAGAACCCACATCTTGG + Intronic
1172577554 20:36020964-36020986 AAGGTCTAGAACCCAAATGGTGG + Intronic
1173248546 20:41352454-41352476 CAGGTGTAAAAACCACAGGTAGG + Intronic
1174464827 20:50709103-50709125 AAGGTCTGCAAGCCACAAGTTGG - Intergenic
1175490904 20:59380661-59380683 CAGGTCTACACACCACTGGTGGG + Intergenic
1183861522 22:40673736-40673758 CAGGTCCATGACCAACATGTTGG + Intergenic
950580356 3:13858087-13858109 CAGCTCTGCTGCCCACATGTTGG - Intronic
953379794 3:42460814-42460836 CAGGTCTAATACCCAGGTGTAGG - Intergenic
958992104 3:100858685-100858707 CTGGTCTAGTACCCACAGGTAGG + Intronic
960280963 3:115781013-115781035 CTGCTCTAGAACCCATATGTTGG + Intergenic
966697497 3:182805877-182805899 TAGGACTACAACCCACATTATGG - Intronic
969240978 4:5897304-5897326 CTGGGCTACAACCGAGATGTTGG - Intergenic
971771395 4:30901602-30901624 AATGACTACAACCCACATGATGG + Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
983554980 4:169051890-169051912 CAGGACTAAAAGTCACATGTTGG - Intergenic
984365431 4:178793398-178793420 TTGGTCTACAAGGCACATGTGGG - Intergenic
984553001 4:181182830-181182852 CTGGGCTAAAACCAACATGTTGG - Intergenic
986325793 5:6672890-6672912 CTGGTCTAAAATACACATGTGGG + Intergenic
989616065 5:43338001-43338023 CAGTACAAAAACCCACATGTAGG - Intergenic
992313775 5:75531457-75531479 CTGGTCCACAGCCCACATTTTGG - Intronic
1000104857 5:158049692-158049714 TAGTACTTCAACCCACATGTTGG - Intergenic
1005790494 6:29295505-29295527 CAAGTCTACAACCCTGACGTGGG - Intergenic
1009023236 6:57967960-57967982 CAGGTCCACAACCAACATGTTGG + Intergenic
1009198804 6:60719494-60719516 CAGGTCCACAACCAACATGTTGG + Intergenic
1009895727 6:69746556-69746578 CAGGTCCACAACCAACACATTGG - Intronic
1011071797 6:83393115-83393137 CAGGTCCACCACTGACATGTTGG - Intronic
1017640531 6:156489694-156489716 CAGGTCCTCCAACCACATGTGGG - Intergenic
1020551767 7:9615690-9615712 CAGGTCCACGACCGACACGTTGG - Intergenic
1020909182 7:14107207-14107229 AAGGTCACCAAACCACATGTGGG - Intergenic
1022835335 7:34108241-34108263 GAAGTGTACAACCCCCATGTAGG - Intronic
1027047621 7:75001493-75001515 CAGGTCCACACCCCAGATGCCGG - Intronic
1027292168 7:76726001-76726023 CAGTTCTACCACCCATGTGTAGG + Intergenic
1027637242 7:80690517-80690539 CAGGTATACCACTCAAATGTAGG - Intergenic
1029308985 7:99643785-99643807 CAGGTCTTCAACTCAGATGTGGG - Intergenic
1033342411 7:140502423-140502445 CAGCTTTAAAATCCACATGTGGG + Intergenic
1033946466 7:146724981-146725003 AAAGTCTGCAACCCAGATGTTGG + Intronic
1035223338 7:157419419-157419441 CAGCTGTGCAACCCACATGAGGG - Intergenic
1045683990 8:104692301-104692323 CAGGGCCTCAACCCAGATGTAGG + Intronic
1056194313 9:84214657-84214679 CAGGTCTAAAACCAAGGTGTTGG + Intergenic
1060250095 9:121979303-121979325 CAAGGCTGCAGCCCACATGTTGG - Intronic
1062690686 9:137840749-137840771 AAGGTCAACAACCCACCAGTAGG - Intronic
1185558469 X:1039946-1039968 TTGGCCTCCAACCCACATGTTGG + Intergenic
1186308971 X:8296770-8296792 GAGTTCTACAAAGCACATGTTGG - Intergenic
1193467781 X:81868829-81868851 CAGGTCTACAGCCCCCACTTGGG + Intergenic
1199539167 X:148939504-148939526 CATGGCTAGAACCCAAATGTGGG + Intronic