ID: 904707665

View in Genome Browser
Species Human (GRCh38)
Location 1:32403602-32403624
Sequence TGGCACCTTAAAATTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904707663_904707665 10 Left 904707663 1:32403569-32403591 CCTCAACTCTGCATTCAGTGATT No data
Right 904707665 1:32403602-32403624 TGGCACCTTAAAATTGATGAAGG No data
904707662_904707665 29 Left 904707662 1:32403550-32403572 CCTAATAGGAGATATCTCTCCTC No data
Right 904707665 1:32403602-32403624 TGGCACCTTAAAATTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904707665 Original CRISPR TGGCACCTTAAAATTGATGA AGG Intergenic
No off target data available for this crispr