ID: 904707665 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:32403602-32403624 |
Sequence | TGGCACCTTAAAATTGATGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904707663_904707665 | 10 | Left | 904707663 | 1:32403569-32403591 | CCTCAACTCTGCATTCAGTGATT | No data | ||
Right | 904707665 | 1:32403602-32403624 | TGGCACCTTAAAATTGATGAAGG | No data | ||||
904707662_904707665 | 29 | Left | 904707662 | 1:32403550-32403572 | CCTAATAGGAGATATCTCTCCTC | No data | ||
Right | 904707665 | 1:32403602-32403624 | TGGCACCTTAAAATTGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904707665 | Original CRISPR | TGGCACCTTAAAATTGATGA AGG | Intergenic | ||
No off target data available for this crispr |