ID: 904712971

View in Genome Browser
Species Human (GRCh38)
Location 1:32444891-32444913
Sequence CAGTCTGAGCAGAGTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904712962_904712971 10 Left 904712962 1:32444858-32444880 CCCCAGATTAAATGGTCCCAATT 0: 13
1: 27
2: 42
3: 31
4: 153
Right 904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG No data
904712966_904712971 -7 Left 904712966 1:32444875-32444897 CCAATTCACTAATGCCCAGTCTG 0: 12
1: 24
2: 19
3: 12
4: 111
Right 904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG No data
904712965_904712971 -6 Left 904712965 1:32444874-32444896 CCCAATTCACTAATGCCCAGTCT 0: 15
1: 54
2: 47
3: 29
4: 133
Right 904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG No data
904712963_904712971 9 Left 904712963 1:32444859-32444881 CCCAGATTAAATGGTCCCAATTC 0: 8
1: 21
2: 33
3: 50
4: 135
Right 904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG No data
904712964_904712971 8 Left 904712964 1:32444860-32444882 CCAGATTAAATGGTCCCAATTCA 0: 14
1: 16
2: 28
3: 41
4: 103
Right 904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904712971 Original CRISPR CAGTCTGAGCAGAGTCAGGA GGG Intergenic
No off target data available for this crispr