ID: 904713968

View in Genome Browser
Species Human (GRCh38)
Location 1:32452766-32452788
Sequence AGAATGGCGTGAATCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904713960_904713968 12 Left 904713960 1:32452731-32452753 CCTGTAGTCCAAGCTACTCGGGA 0: 181
1: 57066
2: 183325
3: 273776
4: 191166
Right 904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG No data
904713962_904713968 4 Left 904713962 1:32452739-32452761 CCAAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904713968 Original CRISPR AGAATGGCGTGAATCCCAGG GGG Intergenic
No off target data available for this crispr