ID: 904718651

View in Genome Browser
Species Human (GRCh38)
Location 1:32489118-32489140
Sequence AAAATTTGCGAGAGTATAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904718651_904718655 12 Left 904718651 1:32489118-32489140 CCCCTTATACTCTCGCAAATTTT 0: 1
1: 0
2: 1
3: 8
4: 168
Right 904718655 1:32489153-32489175 ATTAGTAAAATGAAGCGCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 160
904718651_904718656 20 Left 904718651 1:32489118-32489140 CCCCTTATACTCTCGCAAATTTT 0: 1
1: 0
2: 1
3: 8
4: 168
Right 904718656 1:32489161-32489183 AATGAAGCGCTGAGGCCAGATGG 0: 1
1: 0
2: 0
3: 22
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904718651 Original CRISPR AAAATTTGCGAGAGTATAAG GGG (reversed) Exonic
904718651 1:32489118-32489140 AAAATTTGCGAGAGTATAAGGGG - Exonic
907630708 1:56079114-56079136 ATAATTTTCAAGAGTGTAAGGGG + Intergenic
908104694 1:60829302-60829324 GAAATTTGCTAGAGCATAAGAGG + Intergenic
908167438 1:61472267-61472289 AAACTTTGTGAGAGTTTCAGTGG - Intergenic
912605925 1:110988527-110988549 AAAATGTGTGAGAGTAAAACTGG + Intergenic
918748955 1:188245874-188245896 AAAATTTAGGAGATGATAAGAGG + Intergenic
919427991 1:197458010-197458032 TAAATTTGTGAGAGTAGAAAAGG + Intronic
921795153 1:219334379-219334401 AAAAATTGGCAGAGTATTAGGGG - Intergenic
921915409 1:220604889-220604911 AAAATTTACTAAAGTTTAAGTGG + Intronic
1064869933 10:19926079-19926101 AAAAATTTGGAGAGTAAAAGAGG + Intronic
1065365332 10:24929723-24929745 AACATTTGAGAGAGAATAAAGGG + Intronic
1066578822 10:36857342-36857364 AAAATTGGCAAGAGTTTAAGAGG + Intergenic
1066753911 10:38690204-38690226 AGAATTTGCCAGGGTAGAAGAGG + Intergenic
1067409455 10:46051791-46051813 TAAAATTGCCAGGGTATAAGTGG - Intergenic
1070443641 10:76471808-76471830 AAAAGTTACTAGAGTAAAAGAGG + Intronic
1071051742 10:81458812-81458834 AAAATTTGGTAGAGTATGTGAGG - Intergenic
1072346093 10:94508229-94508251 AAAAAAAGAGAGAGTATAAGAGG - Intronic
1072702472 10:97653121-97653143 AAAAGTTTCTAGAGTCTAAGAGG - Intronic
1078294207 11:10049684-10049706 ATAATTTGTGACAGTATAAAGGG + Intronic
1078883783 11:15479461-15479483 AAAATGAGCGAGAGTAAAAAAGG + Intergenic
1082310612 11:50642795-50642817 AAAATATGTGAAAGTATATGTGG + Intergenic
1084866475 11:72062298-72062320 AAAATTTGGGAGAGAATGCGAGG - Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1091067610 11:132530806-132530828 AATATTTGGGAGAGGACAAGGGG - Intronic
1095328316 12:40925250-40925272 AAAATTGGTGAAAGTATATGAGG - Intronic
1095864858 12:46960461-46960483 AAAAGTGGCCAGGGTATAAGTGG + Intergenic
1099397980 12:82165251-82165273 AAAAGTTGCTAGTGTTTAAGGGG + Intergenic
1099714710 12:86276424-86276446 AAAATATGAAAGAGTATAATTGG - Intronic
1099965089 12:89437484-89437506 AAAATTTGCCTGATAATAAGAGG - Intronic
1101548569 12:105740140-105740162 AAAATTTGGGAGAGGATGAATGG + Intergenic
1105340487 13:19519021-19519043 AAAATTCATGAAAGTATAAGGGG - Intronic
1106611369 13:31285304-31285326 AAAAGGTGGGAGAGTAGAAGAGG + Intronic
1107406448 13:40118455-40118477 ATAATTTCAGACAGTATAAGGGG - Intergenic
1108367847 13:49734872-49734894 AAAATTTGCAAAATTAGAAGGGG - Intronic
1109016989 13:57029228-57029250 AAAATTAGCATGAGTATAATAGG - Intergenic
1109144328 13:58758884-58758906 AAAATTTGCTAGAATAAAAAGGG + Intergenic
1111200759 13:84932845-84932867 AATGTTTGCAAGAATATAAGAGG - Intergenic
1113402927 13:110011472-110011494 AAATTTTGTGAGAATATCAGTGG - Intergenic
1116363485 14:44030709-44030731 AAAATTTCTGAGAGTGAAAGGGG + Intergenic
1116503018 14:45643807-45643829 AATATTTTCGACACTATAAGAGG - Intergenic
1116995923 14:51324069-51324091 AAAAGCTGCAAGATTATAAGGGG - Intergenic
1119499038 14:75107170-75107192 CAAATTTGCTATAGTATTAGGGG - Intronic
1121177606 14:91902815-91902837 AATATTTAAGAGAGTCTAAGAGG + Intronic
1121375791 14:93409872-93409894 AAAATTTACATGAGTAGAAGGGG + Intronic
1126447537 15:48765618-48765640 AAAATTGGCAAGAACATAAGAGG - Intronic
1127203473 15:56685424-56685446 AAAAATTGGGAGAGGATAAAAGG + Intronic
1129028626 15:72603147-72603169 AAAATTTGCTAGATTAGAAGTGG + Intergenic
1131287323 15:91071328-91071350 AAAAATTGACAGAGAATAAGTGG - Intergenic
1131487197 15:92831056-92831078 AAAGTTTAGGAAAGTATAAGAGG + Intergenic
1135874321 16:26183772-26183794 AGAGTTTACCAGAGTATAAGGGG + Intergenic
1136424996 16:30164051-30164073 AAAATTAGCCAGACTATAGGTGG - Intergenic
1137079336 16:36026697-36026719 AAAATCTGCAAGAGGATAATTGG + Intergenic
1139048735 16:63096783-63096805 AAAATTTGTGATATTATATGTGG - Intergenic
1140970501 16:80007837-80007859 TAAATTTCCGAAAGTAAAAGTGG - Intergenic
1202997602 16_KI270728v1_random:130758-130780 AGAATTTGCCAGGGTAGAAGAGG + Intergenic
1203024289 16_KI270728v1_random:443100-443122 AGAATTTGCCAGGGTAGAAGAGG + Intergenic
1145286892 17:21512542-21512564 AGAATTTGGGAGAGGAGAAGGGG + Intergenic
1145390726 17:22453798-22453820 AGAATTTGGGAGAGGAGAAGGGG - Intergenic
1148936777 17:51169456-51169478 AAAATTGGAGAGAGTAAAATAGG + Intronic
1151508418 17:74543917-74543939 AAAAGGTGCCAGAGAATAAGGGG + Intronic
1152138153 17:78518600-78518622 AAAATTAGCAAGACTATAAAAGG + Intronic
1154990791 18:21596291-21596313 ATAATTTTTAAGAGTATAAGGGG + Intronic
1156407736 18:36798802-36798824 AAAATTTGTAAGAGTATCAAAGG - Intronic
1157261231 18:46177197-46177219 AAAAGTTGTGAGACTATAAAAGG + Intronic
1158695900 18:59703566-59703588 AAAGTTTGCAACAGTGTAAGGGG + Intergenic
1158928138 18:62292171-62292193 AAAAGTTGAGAGAGTAAATGTGG - Intronic
1159548912 18:69874716-69874738 AAAGTTTGTGAAAGAATAAGTGG - Intronic
1166039790 19:40194883-40194905 AAAATTTCAGAGAGTATCAGGGG + Intronic
1167971648 19:53191541-53191563 AAAATTTGTTAGATTATTAGGGG + Intronic
1168165528 19:54544925-54544947 GAAATTTGCATGAGGATAAGAGG - Intronic
925242600 2:2345323-2345345 AGAATTTGGGCGAGCATAAGAGG + Intergenic
929707885 2:44234688-44234710 ACAATTTGTAAGAGTATAAGTGG - Intronic
934185110 2:89664877-89664899 AGAATTTGCCAGGGTAGAAGAGG - Intergenic
934317196 2:91934435-91934457 AGAATTTGCCAGGGTAGAAGAGG + Intergenic
934335981 2:92136014-92136036 AAAATTTGCAAGAGGATATTTGG + Intergenic
934336109 2:92138050-92138072 AAAATTTGCAAGAGGATATTTGG + Intergenic
934367978 2:92694614-92694636 AAAATTTGCAAGAGGATATTTGG + Intergenic
934369316 2:92715880-92715902 AAAATCTGCTAGAGTATATTTGG + Intergenic
934381390 2:92909109-92909131 AAAATCTGCAAGAGGATAATTGG + Intergenic
934386081 2:92985026-92985048 AAAATCTGCAAGAGTATATTTGG + Intergenic
934402575 2:93252632-93252654 AAAATCTGCAAGAGTATATTTGG + Intergenic
934414421 2:93442362-93442384 AAAATCTGCAAGAGTATATTTGG + Intergenic
934419185 2:93519098-93519120 AAAATTTGCAAGAGGATATTTGG + Intergenic
934428551 2:93669120-93669142 AAAATCTGCAAGAGGATAATTGG + Intergenic
934433511 2:93749374-93749396 AAAATCTGCAAGAGTATATTTGG + Intergenic
934438083 2:93823252-93823274 AAAATTTGCAAGAGGATATTTGG + Intergenic
934444929 2:93933620-93933642 AAAATTTGCAAGAGGATATTTGG + Intergenic
934454736 2:94141958-94141980 AAAATCTGCAAGAGTATATTTGG + Intergenic
936609326 2:113986685-113986707 CAAATTTGGGAGAGTATAGATGG - Intergenic
941605440 2:167591188-167591210 AAAATTTGAGAGAGGATTATTGG + Intergenic
1171602775 20:26778390-26778412 AAAATCTGCTAGAGTATATTTGG + Intergenic
1177487154 21:21773814-21773836 ATAATATGCTAGAGCATAAGTGG + Intergenic
1177651714 21:23967295-23967317 TAAATGTGCAAGAGAATAAGAGG + Intergenic
1180543650 22:16478004-16478026 AGAATTTGCCAGGGTAGAAGAGG + Intergenic
1180561394 22:16617543-16617565 AAAATTCATGAAAGTATAAGGGG + Intergenic
1181801424 22:25350350-25350372 AAAATTTGATAGAGTACAAAAGG - Intergenic
1183534264 22:38387465-38387487 AAAATTCATGAAAGTATAAGGGG - Intronic
1202733738 2_KI270716v1_random:115830-115852 AAAATCTGCAAGAGTATATTTGG + Intergenic
1202734284 2_KI270716v1_random:124666-124688 AAAATCTGCAAGAGTATATTTGG + Intergenic
952271394 3:31835493-31835515 AAAATTTTCTACAGTAGAAGTGG - Intronic
953824904 3:46242835-46242857 AGAATTTGTGAAAGTATAGGAGG - Intronic
956032208 3:65050641-65050663 AAAATGTGGGAGAGTCTAGGTGG + Intergenic
957217786 3:77344301-77344323 AAAATATGCAAGAGGAAAAGTGG + Intronic
959960075 3:112288089-112288111 AAAATTTGCCAGGTTATGAGAGG - Intronic
962112407 3:132467241-132467263 AAAATTTGCCAAAGAAAAAGTGG + Exonic
964016563 3:151954351-151954373 GAAATTTGCTGGATTATAAGAGG - Intergenic
965494358 3:169379497-169379519 AATATTTGCCAGTGTATATGTGG + Intronic
966084794 3:176057347-176057369 AAAATTTCAGACAGTTTAAGTGG + Intergenic
966408386 3:179623113-179623135 AAACTTTTCGAGAGTAGAACTGG - Intronic
966501769 3:180650313-180650335 AAATTTTGCCAGAGTATAAGGGG + Intronic
967311421 3:188109964-188109986 AAGATTTTGGAGAGTCTAAGAGG + Intergenic
967594553 3:191314434-191314456 AAAGTTGGCAAGAGTATGAGAGG + Intronic
970462863 4:16292936-16292958 AAATTTAGCCTGAGTATAAGTGG - Intergenic
971711709 4:30121432-30121454 AAAAGTTATGAAAGTATAAGAGG - Intergenic
972131610 4:35842624-35842646 ATAATTTGCGTGAAAATAAGAGG + Intergenic
974363909 4:60920006-60920028 AAAATTTGCCAGAGGATTAATGG + Intergenic
974802789 4:66840324-66840346 AAAATTTATGAGATTATAATGGG - Intergenic
976397938 4:84577103-84577125 AAAATTTCCTAGACTATATGAGG - Intergenic
977119399 4:93078407-93078429 AAAATAGGCAAGAGTATAATGGG - Intronic
977949192 4:102950563-102950585 AGAATTTGCCAGGGTAAAAGAGG + Intronic
980472850 4:133271303-133271325 TAAATTTCCATGAGTATAAGAGG - Intergenic
980810889 4:137877826-137877848 AACATTTGAAAGAGGATAAGAGG + Intergenic
981032192 4:140136524-140136546 AAAACTTGACAAAGTATAAGCGG - Intronic
981522793 4:145681144-145681166 TACATTTGAGAAAGTATAAGTGG + Intronic
983621520 4:169766319-169766341 ATAATTTGCCAGAGTCAAAGTGG - Intergenic
983813437 4:172093255-172093277 AAAATTTAAGAGACTATAAAAGG - Intronic
984098386 4:175459414-175459436 AAAATTTGCTTGAGTATTAAGGG + Intergenic
985009387 4:185567035-185567057 AAAATTGTGGAGAGTATCAGGGG - Intergenic
985281257 4:188288055-188288077 AAAAATTGGGAGAGTATATCTGG - Intergenic
988625870 5:32873853-32873875 AAAATTTGTGTGACAATAAGTGG + Intergenic
989521604 5:42408947-42408969 AAAATTTTGGAAAGTGTAAGGGG - Intergenic
991079221 5:62578090-62578112 AAAATTGGGGAGAGTAAAAGAGG - Intronic
991233873 5:64370217-64370239 ATAATTTGCCTGAGAATAAGTGG - Exonic
991380678 5:66021652-66021674 AAAATTTGAGTGATTATAAGTGG + Intronic
993739837 5:91524756-91524778 AAAATGTGCTAGGGTATAACTGG - Intergenic
997084110 5:130776247-130776269 AAGATTTGAGTGAGTGTAAGTGG + Intergenic
998036269 5:138919607-138919629 CAAATGTATGAGAGTATAAGAGG + Intronic
999844523 5:155464243-155464265 ATAATTTGGGAGTGGATAAGGGG + Intergenic
999917368 5:156277528-156277550 AAAACTTGGGTGAGTAAAAGAGG + Intronic
1006487739 6:34357665-34357687 AAAATATACGAAAGTATAAATGG - Intronic
1008928064 6:56908311-56908333 AAAATTTGAGAGAGATGAAGAGG + Intronic
1009331403 6:62425349-62425371 AAAAATTCCAAGAGTTTAAGAGG - Intergenic
1010308573 6:74354677-74354699 AAAATTTGTGAAAGTAGAACTGG + Intergenic
1010862197 6:80926675-80926697 AAAAATTGTCAGAGTATATGAGG - Intergenic
1012833363 6:104233511-104233533 AAAATTTGCAAAAGAAAAAGAGG + Intergenic
1013202541 6:107913775-107913797 AAAATATATGAGAGTATAAGGGG - Intronic
1014443521 6:121500167-121500189 AAAAGTTGCAAGATTCTAAGGGG - Intergenic
1015561818 6:134524412-134524434 AGAATCTGCAAGAGTAAAAGAGG - Intergenic
1021271743 7:18596870-18596892 AAGATTTACGAGAGTAAAACTGG + Intronic
1023469777 7:40503957-40503979 AAAATTTCCAAGAGAATAATGGG + Intronic
1027953475 7:84850294-84850316 TAAATTTGTGATAGTTTAAGTGG - Intergenic
1031048136 7:116916908-116916930 AAAATATGCCAGACTTTAAGTGG + Intronic
1041778197 8:61547816-61547838 ATAATTTTTAAGAGTATAAGAGG + Intronic
1043724817 8:83597526-83597548 AGAATTTGAGAGAGTTTAAAAGG + Intergenic
1046200344 8:110919567-110919589 AAAAGGTGGGAGAGTATAGGTGG + Intergenic
1048758844 8:137768866-137768888 AAAATTGGAGGGAGAATAAGTGG + Intergenic
1049303840 8:141886981-141887003 AAAACCTGCCAGAGTATAAAAGG + Intergenic
1050219245 9:3367506-3367528 AAAAATTGTGAGATAATAAGTGG + Intronic
1050773893 9:9236475-9236497 GGAAGTTGAGAGAGTATAAGAGG - Intronic
1051234519 9:14985176-14985198 ATAATTTGCCAGAGTCAAAGTGG + Intergenic
1052002875 9:23308168-23308190 ATAATATGCGAGCTTATAAGGGG - Intergenic
1054797050 9:69312523-69312545 AAAATTTGGGAGGGTATGGGAGG - Intergenic
1055798236 9:79999945-79999967 AAAATTTGGGAGAGGAAATGAGG - Intergenic
1056912098 9:90711022-90711044 AATATTTGCCAGAGGATAGGGGG + Intergenic
1059629554 9:116106099-116106121 AAACTTTCTGAGACTATAAGAGG + Intergenic
1059817499 9:117934011-117934033 AAAATGTGAGAAAGTACAAGTGG + Intergenic
1062608280 9:137358582-137358604 AAAAATTTCAAGAGAATAAGAGG - Intronic
1203353241 Un_KI270442v1:101428-101450 AGAATTTGCAAGTGTATAATTGG + Intergenic
1187652917 X:21430013-21430035 AAAATTTAGAAGAGTATAATAGG - Intronic
1188562721 X:31487932-31487954 AACATTTTTGAGTGTATAAGGGG + Intronic
1188750516 X:33899257-33899279 AAAATTTAAGAGAATTTAAGAGG + Intergenic
1191802506 X:65096927-65096949 AAACTTTTCAAGAGTGTAAGGGG + Intergenic
1192724913 X:73739436-73739458 GATATTTGCCAGAGTGTAAGTGG + Intergenic
1194563721 X:95455165-95455187 AATAGATGCGAGAGTAGAAGGGG - Intergenic
1198787531 X:140305111-140305133 AACATTTGGGACAATATAAGGGG + Intergenic
1199930758 X:152518330-152518352 AAAAATTTAGAGAGTATATGAGG + Intergenic
1200330542 X:155292119-155292141 AAAATTTGATAGAGTACAAATGG + Intronic
1201721577 Y:17104176-17104198 AAAATTTGCATAAGTTTAAGGGG + Intergenic