ID: 904720087

View in Genome Browser
Species Human (GRCh38)
Location 1:32500928-32500950
Sequence CGCGCAGAGACAGCAGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904720078_904720087 17 Left 904720078 1:32500888-32500910 CCGTCCGGCGCGGCGGACTCCGG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 141
904720082_904720087 13 Left 904720082 1:32500892-32500914 CCGGCGCGGCGGACTCCGGGGAG 0: 1
1: 0
2: 3
3: 5
4: 119
Right 904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 141
904720085_904720087 -2 Left 904720085 1:32500907-32500929 CCGGGGAGGCTTGGTCTGCGCCG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG 0: 1
1: 0
2: 3
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904720087 Original CRISPR CGCGCAGAGACAGCAGCCGC CGG Intronic
900237454 1:1599553-1599575 CGCGCAGCGGCAGCGGCTGCAGG + Exonic
904720087 1:32500928-32500950 CGCGCAGAGACAGCAGCCGCCGG + Intronic
912644838 1:111382985-111383007 GGGGTAGAGACAGCAGTCGCTGG + Intergenic
915598598 1:156908795-156908817 CGCGCACTGACAGAGGCCGCTGG - Exonic
915736644 1:158089478-158089500 TGGGCAGAGAGAGCAGCCTCGGG - Intronic
917725735 1:177825495-177825517 CGTTCAGAGGAAGCAGCCGCTGG - Intergenic
917817515 1:178725548-178725570 CGCGCAGGGCGAGCAGCCCCGGG - Intronic
919780640 1:201218625-201218647 CGAGCAAAGACAGCATCCGATGG - Exonic
920670444 1:208000123-208000145 CCTGCAGAGATAGCAGCCACAGG - Intergenic
921577672 1:216855766-216855788 CGTGCAGATGCGGCAGCCGCAGG - Intronic
922811120 1:228416290-228416312 CGGGCAGGGACAGCGGCAGCGGG + Intronic
1062932806 10:1363798-1363820 CGCGAAGAGGAAGCGGCCGCTGG - Exonic
1063124345 10:3126018-3126040 CGTGCGGGGACAGCAGCCACTGG + Intronic
1067750880 10:48970159-48970181 GGCGCACAGACAGCGGCCCCAGG - Exonic
1069209053 10:65733407-65733429 CGGGCAGAGACATGAGCAGCTGG + Intergenic
1070556495 10:77531893-77531915 CCTGCAGAGTCAGCAGCCCCAGG + Intronic
1071817875 10:89251571-89251593 CCCGCAGAAAAAGCACCCGCAGG + Intronic
1075430237 10:122374539-122374561 CGCGCCGAGGCCGCCGCCGCTGG + Intergenic
1076651995 10:131996433-131996455 CGCGCAGCCTTAGCAGCCGCAGG + Intergenic
1077095012 11:795562-795584 AGCACAGAGAGAGCAGCAGCCGG + Intronic
1083953121 11:65967612-65967634 GGGGCAGGGACAGGAGCCGCGGG + Intronic
1084890129 11:72232650-72232672 CGCCCAGCGAGAGCAGCCGCAGG - Exonic
1088238561 11:107750584-107750606 CGGGCAGAGACACAAGCGGCTGG - Intergenic
1088598138 11:111455067-111455089 CGTGCAGAGGGAGCAGCAGCAGG + Exonic
1088981766 11:114870821-114870843 CCGGCAGAAACAGCAGCTGCTGG - Intergenic
1090081817 11:123618601-123618623 CGGTCAGGGACAGCAGCCTCTGG + Intronic
1096414464 12:51401612-51401634 CGGGCAGAGACACAAGCGGCTGG - Intronic
1098740798 12:74171237-74171259 CGCCCAGAAGCAGCAGCCGAAGG + Intergenic
1101716572 12:107318157-107318179 CGGGCAGGGACAGCAGCAGGGGG + Intergenic
1103221478 12:119249620-119249642 GGTGCCGAGAGAGCAGCCGCGGG + Intergenic
1103828765 12:123762345-123762367 CGCGCATCCACAGCACCCGCAGG - Intergenic
1105843202 13:24273062-24273084 TGCTCAGAGCCAGCAGCCCCAGG + Intronic
1106507385 13:30383030-30383052 CTCACAAAGACAGCAGCTGCTGG - Intergenic
1107313687 13:39107713-39107735 CGACCAGACACAGCAGCTGCAGG + Intergenic
1108206475 13:48095106-48095128 CGCGCAGAGCGAGCTGACGCAGG + Intronic
1112478376 13:99752622-99752644 AGCGCAGGGACAGCAGCAGGAGG - Intronic
1113834919 13:113322429-113322451 CACGCAGGCACAGCAGCTGCAGG + Exonic
1113841486 13:113363971-113363993 CGCGCGGGGACCGCAGCCGCCGG + Intronic
1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG + Intergenic
1116298374 14:43141909-43141931 CGGGCAGAGACACAAGCAGCTGG - Intergenic
1117722069 14:58638018-58638040 CGGGCCGGGACAGCAGCAGCCGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1123030788 14:105450149-105450171 CGGGCAGAGACTCCAGCTGCCGG - Exonic
1128944474 15:71811510-71811532 TGTGCGGAGACAGCAGCAGCGGG + Exonic
1130352870 15:83107338-83107360 CGCGCAGGGACAGGTGCCCCTGG - Intergenic
1130657311 15:85800725-85800747 CTGGCAGGGACAGCAGCTGCAGG + Intergenic
1132484430 16:183110-183132 CGCGAAGTTGCAGCAGCCGCAGG - Intergenic
1132644173 16:991215-991237 CGCGCATACAAAGCACCCGCCGG - Intergenic
1132708450 16:1256310-1256332 CGGGCAGCGCCAGCAGCAGCAGG - Exonic
1133282823 16:4676811-4676833 GGGGCACAGACAGCAGCCACTGG - Intronic
1136592239 16:31224458-31224480 CGCGCAGCCCCAGCAGCCACAGG - Exonic
1139954748 16:70687773-70687795 TGGGCAGACACAGCAGCCTCCGG + Exonic
1142041240 16:87895712-87895734 CCCACAGAGACAGAAGCAGCAGG - Intronic
1142850176 17:2700973-2700995 AGTGCCGAGACAGCAGCCGCAGG - Intronic
1143036939 17:4004832-4004854 CGAGCCGGGAGAGCAGCCGCGGG + Exonic
1143971329 17:10798116-10798138 GGCACAGGGACAGCAGCCGTGGG - Intergenic
1144877955 17:18412163-18412185 CGCACAGACACACCAGGCGCAGG - Intergenic
1145154274 17:20532262-20532284 CGCACAGACACACCAGGCGCAGG + Intergenic
1146727372 17:35167205-35167227 CTCCCAGACACAGCAGCTGCTGG + Intronic
1147133907 17:38424456-38424478 GGGGCAGAGACAACAGCCTCGGG - Intergenic
1148779228 17:50112286-50112308 AGCGCAGAGAAAGCAGCCTGGGG - Intronic
1148892937 17:50820776-50820798 AGGGCAGAGACAGAAGCGGCTGG + Intergenic
1149585677 17:57784612-57784634 CGCACAGATACAGCAGAGGCTGG - Intergenic
1152855657 17:82663594-82663616 AGAGCAGAGCCAGCAGCCCCAGG + Intronic
1152883026 17:82831226-82831248 CGCGCAGGGAGTGCAGCCACGGG - Exonic
1154266689 18:12884427-12884449 CGCGCAGGGACCACGGCCGCCGG - Intronic
1160762996 19:795213-795235 CGCGAACAGACAGAAGCGGCTGG + Intergenic
1160888226 19:1362391-1362413 CGCTCAGAGGCAGCGGCGGCGGG + Intronic
1161650279 19:5480112-5480134 GGAGCAGAGAGAGCAGCCCCAGG + Intergenic
1163395636 19:17059105-17059127 GGTGGAGAGACAGCAGCAGCTGG + Intronic
1166317973 19:41999179-41999201 CGCGCAGTGACAGCAGGGCCCGG + Exonic
1166364655 19:42272395-42272417 CACGCCGAGCCAGCACCCGCTGG - Intronic
926303076 2:11618064-11618086 GGGGCAGAAACAGGAGCCGCCGG + Intronic
927606269 2:24490179-24490201 CGCCGGGAGACAGCAGCAGCAGG + Intergenic
931820109 2:65943272-65943294 CACGCAGTCGCAGCAGCCGCGGG - Intergenic
932681435 2:73829136-73829158 CCCGCGGAGACAGAAGCCGTCGG - Exonic
934902594 2:98172445-98172467 TGTGCAGAGACAGAAGCAGCTGG - Intronic
937665500 2:124482744-124482766 GATGCAGAGACAGGAGCCGCTGG - Intronic
938196680 2:129334779-129334801 CCTGCAGAGACGGCAGCCGAGGG + Intergenic
941916143 2:170815264-170815286 CGCGCGGTGACTGCAGCCCCGGG - Intronic
944663600 2:201940901-201940923 TTCGCAGAAACAGCAGCAGCAGG + Intergenic
945033068 2:205682798-205682820 CGGGCGGAGGCAGCCGCCGCCGG - Exonic
947915309 2:233828722-233828744 CGCGCAGGGACAGCACCCGCAGG - Exonic
948540985 2:238691349-238691371 GGGGCAGGGACAGCAGCCACAGG - Intergenic
1172818727 20:37712682-37712704 CCAGCAGAGACAGCAGAGGCAGG - Intronic
1175074702 20:56362830-56362852 CTCGCAGAGACAGCTGCAGTCGG + Intronic
1175722701 20:61296943-61296965 CGCTCAGAGCCAGCAGCTCCAGG - Intronic
1176274338 20:64255415-64255437 GGCCCCGAGTCAGCAGCCGCAGG + Intergenic
1178488523 21:33033494-33033516 CGCGCACTCGCAGCAGCCGCGGG - Intergenic
1178680478 21:34669470-34669492 CCCGGAGAGCCAGGAGCCGCGGG + Exonic
1179502339 21:41818072-41818094 CGCGTAGAGACAGGAGGGGCAGG - Intronic
1180221688 21:46363162-46363184 CGAGCAAAGGCAGCAGCCGGAGG - Intronic
1181463454 22:23098481-23098503 TGGGCAGGGACAGCAGCCACTGG + Intronic
1182695677 22:32198073-32198095 GGCCCAGAGTCAGCAGCCGTGGG - Intronic
1183598827 22:38828351-38828373 CCCTCAGCCACAGCAGCCGCCGG - Exonic
1184262223 22:43325056-43325078 CGCGGAGAGAAGGCAGCCGTGGG + Intronic
1185370531 22:50458953-50458975 CGCGTAGAGGCAGCACCCGGAGG + Intronic
950940130 3:16884224-16884246 CGGGAGGAGACAGCAGCCGGCGG + Intronic
952945654 3:38476645-38476667 GGGGCAGAGACAGGAGCAGCAGG + Intronic
954176193 3:48847633-48847655 AGCGCGGAGACAGTGGCCGCCGG - Exonic
954920526 3:54187066-54187088 CTCCCAGGGACAGCAGCAGCAGG - Intronic
959591872 3:108090817-108090839 GGCGAAGCGACAGCAGCCGCAGG + Intronic
961674230 3:128555227-128555249 CGCGCAGAGCCAGCCGCAGAAGG + Intergenic
962770871 3:138609069-138609091 CGCCCAGAGATGGCCGCCGCCGG - Intronic
968372721 4:10844-10866 GGCGCAGAGACGGACGCCGCCGG + Intergenic
968657165 4:1783617-1783639 ACCGCAGAGCCAGCAGCAGCTGG + Intergenic
969574868 4:8030879-8030901 CCTGCAGAGCCAGCAGCAGCTGG - Intronic
970324491 4:14909288-14909310 TGGGCAGAAACAGCAGCAGCAGG - Intergenic
974385871 4:61201586-61201608 AGCGCAGAGAAAGCAGCAGGAGG - Intronic
975858061 4:78646011-78646033 TGCCCAGAAACAGCAGCCTCAGG - Intergenic
984413320 4:179425274-179425296 CAGGCAGAGAGAGCAGCCTCTGG + Intergenic
985806182 5:2045053-2045075 CCCCCAGTGACAGCATCCGCAGG - Intergenic
986095361 5:4549155-4549177 TGTGCAGAGACAACAGCAGCAGG + Intergenic
989998465 5:50863686-50863708 AGCTCAGAGACAGCAGCAGAGGG - Intergenic
1001431539 5:171666454-171666476 CCAGCAGAGACAGCTGCTGCGGG + Intergenic
1002460630 5:179371825-179371847 TGCCCAGACACAGGAGCCGCAGG + Intergenic
1012440164 6:99254989-99255011 AGGGCAGAGACAGAAGCAGCTGG + Intergenic
1012872962 6:104693705-104693727 CCCGCAGATACAGAAGACGCTGG + Intergenic
1013429100 6:110040133-110040155 CGCGCAGAGACAGAGGCAGGCGG - Intergenic
1019014144 6:168867524-168867546 AGCTCAGAGACAGCAGGAGCAGG + Intergenic
1019664185 7:2243179-2243201 TGGGCAGAGACACAAGCCGCTGG - Intronic
1020178075 7:5898740-5898762 CGCCCAGAGACAGCAGCCACCGG - Exonic
1020304852 7:6826235-6826257 CGCCCAGAGACAGCAGCCACCGG + Exonic
1024948224 7:54833330-54833352 CGCGAAGATTCGGCAGCCGCAGG - Intergenic
1024961598 7:54981990-54982012 AGCGCAGAGACAGCAGCCCAAGG + Intergenic
1025810596 7:64872972-64872994 CGCGCAGCCTCAGCAGCTGCTGG + Intronic
1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG + Exonic
1032389687 7:131547841-131547863 CTCTCAGTGACAGCAGCAGCCGG - Intronic
1034227816 7:149497173-149497195 CAGGCAGAGAAAGGAGCCGCGGG + Intronic
1035995970 8:4547241-4547263 CACCCAGACTCAGCAGCCGCAGG - Intronic
1036926628 8:12913236-12913258 CGCGCAGAGTCAGCACCAGTGGG + Intergenic
1039469041 8:37802379-37802401 GGCGCAGAGACAGCAGCCAGAGG + Intronic
1040076969 8:43246673-43246695 CGCAGGGAGACAGAAGCCGCTGG - Intergenic
1042190041 8:66177297-66177319 CGAGCAGCCCCAGCAGCCGCAGG - Exonic
1042903073 8:73747110-73747132 CCCGCAGAGCCTGCAGCTGCTGG - Intronic
1047508544 8:125498459-125498481 AGCTCAGAGACAGCAGCTACAGG - Intergenic
1048461610 8:134626003-134626025 CCCTGAGAGCCAGCAGCCGCAGG + Intronic
1048474917 8:134734281-134734303 CCCGAAGCGACAGGAGCCGCCGG - Intergenic
1049518906 8:143078252-143078274 CTCCCAGACACAGCAGCCCCTGG - Intergenic
1049761524 8:144333975-144333997 GGCGCAGACCCTGCAGCCGCCGG + Exonic
1049777271 8:144412558-144412580 CGTACAGGGACAGCAGCAGCAGG + Exonic
1053381217 9:37650929-37650951 CGCGCCGAGGCTGCAGCCGGAGG - Intronic
1055574442 9:77647767-77647789 CGCGGACAGGCAGCAGCAGCCGG + Exonic
1058869530 9:109190401-109190423 GGCCCAGAGAGAGCAGCCACAGG + Intronic
1062475163 9:136723096-136723118 CCTGCAGGGACAGCAGCAGCAGG - Exonic
1186249198 X:7647777-7647799 ACCTCAGAGACAGCAGCAGCAGG - Intergenic
1186474830 X:9849234-9849256 GGAGGAGAGACAGCAGGCGCCGG + Intronic
1189959102 X:46307799-46307821 CAGGCAGAGACACAAGCCGCTGG - Intergenic
1195966319 X:110433071-110433093 AGCTCACAGACAGCAGCAGCTGG - Intronic
1196141158 X:112265071-112265093 AGCTCACAGACAGCAGCAGCTGG + Intergenic
1200068781 X:153517817-153517839 CCCGCAGCGACAGCGCCCGCCGG + Intronic