ID: 904727218

View in Genome Browser
Species Human (GRCh38)
Location 1:32558594-32558616
Sequence TTGTTAGTCTCCAAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904727217_904727218 -3 Left 904727217 1:32558574-32558596 CCATTCATTTACTTATTCGTTTG 0: 1
1: 0
2: 8
3: 104
4: 933
Right 904727218 1:32558594-32558616 TTGTTAGTCTCCAAGTCTGAAGG 0: 1
1: 0
2: 0
3: 4
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904727218 Original CRISPR TTGTTAGTCTCCAAGTCTGA AGG Intronic
904727218 1:32558594-32558616 TTGTTAGTCTCCAAGTCTGAAGG + Intronic
905394664 1:37659431-37659453 TTGTTTGTCTCCAAAGCTCATGG + Intergenic
905465910 1:38153059-38153081 TTGCCAGTCTCCAAGGCAGAGGG - Intergenic
909935112 1:81542180-81542202 TTGTGAATGTGCAAGTCTGATGG - Intronic
910065136 1:83143101-83143123 TTGTTCCTTTCCCAGTCTGAGGG + Intergenic
910443688 1:87279317-87279339 TGGTTAGTCACCCTGTCTGAGGG - Intergenic
910467905 1:87519755-87519777 TTGTAGTTCTCCAAGTCTTAGGG + Intergenic
911377811 1:97072752-97072774 TTGCTAGACTCAAAGTCAGATGG - Intergenic
913401891 1:118444520-118444542 TTTTGACTCTCCAACTCTGATGG - Intergenic
915312749 1:155012474-155012496 TTGTTTGTTCCCAAGTCTGGGGG + Intronic
916661072 1:166922620-166922642 TTGTTATACTCCATGGCTGAGGG + Exonic
917238226 1:172917680-172917702 TTGGGAGTCTCCCAGCCTGAAGG - Intergenic
918210305 1:182344402-182344424 TTTCTAGTCTCCAGGCCTGAGGG + Intergenic
920412411 1:205772814-205772836 CTGTTTGTCTCCAAGACTGGGGG + Intronic
922464395 1:225836877-225836899 TTGTAAGTGTCCAACACTGACGG - Intronic
1063012196 10:2034714-2034736 TTTTTAATCTCCAAGTGTTAGGG + Intergenic
1068623832 10:59217175-59217197 TTTTTAGTCTTCAAGTGTAAAGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071315497 10:84392082-84392104 CTCATAGTCTCCAAGACTGAAGG - Intronic
1074837347 10:117309983-117310005 CTGTTACTCTCCAAGACTGTTGG - Intronic
1078175606 11:8967478-8967500 TTGTAAGTGTGCAAGTCAGAAGG + Intergenic
1079605623 11:22362261-22362283 TTGTTAGTATCCATGATTGAAGG - Intronic
1079719077 11:23787995-23788017 TGGTTAGTATTCAAGACTGAGGG + Intergenic
1080544797 11:33305717-33305739 TTGTTAATCACCAAATCTGGTGG + Intronic
1090562787 11:127950695-127950717 TTGGTAGTTTACATGTCTGATGG - Intergenic
1090612835 11:128486981-128487003 TTGTTAGGAGCAAAGTCTGATGG + Intronic
1091700247 12:2654269-2654291 CTGTTTGTGTCCAGGTCTGATGG + Intronic
1093200548 12:16181359-16181381 TTGCCAGTCTCTATGTCTGAGGG + Intergenic
1093943876 12:25085483-25085505 TTGTCAGTCTGCCAGTCTGCTGG + Intronic
1094500042 12:31012932-31012954 TTGTTAGTTACCACATCTGAGGG + Intergenic
1098611402 12:72462893-72462915 TTGTTAGTCTCCTTCTCTGCTGG + Intronic
1100140474 12:91612636-91612658 TTCTAAACCTCCAAGTCTGATGG - Intergenic
1104074299 12:125376113-125376135 TTGCTAATCTCCTTGTCTGATGG + Intronic
1107742739 13:43469856-43469878 TAGTAAGTCTTCAAGTCAGATGG - Intronic
1110926617 13:81161984-81162006 TTTTCAGTGTCTAAGTCTGATGG - Intergenic
1111130673 13:83971076-83971098 TTGATAGTCTCCAACTATTATGG - Intergenic
1112485927 13:99819668-99819690 ATGTAAGTCTCCAGATCTGAAGG + Intronic
1112722909 13:102265404-102265426 TTATTTTTCACCAAGTCTGATGG - Intronic
1116772387 14:49142659-49142681 TTCTGAGTCTACAAGTGTGAAGG - Intergenic
1117117909 14:52535337-52535359 TCGTTAGTCTACAAGTATCAGGG + Intronic
1120068282 14:80072003-80072025 TTGTTTTTCTCCAAGTTTCAGGG + Intergenic
1123886579 15:24733090-24733112 TGGGTAGTCTTCAACTCTGATGG - Intergenic
1123996775 15:25723955-25723977 TTTTATGTCCCCAAGTCTGATGG - Exonic
1124860205 15:33432047-33432069 TTGTGAGTAGCCAAATCTGAAGG - Intronic
1126768853 15:52035321-52035343 TTGAATGTGTCCAAGTCTGAGGG - Intronic
1131070776 15:89464378-89464400 GTGTTCTTCTCCAAGTGTGAGGG - Intergenic
1134285621 16:12859784-12859806 TTGTTAGACTCCACCTGTGAGGG - Intergenic
1136448716 16:30340083-30340105 TTCTCAGTCTCCAGGTTTGATGG - Intergenic
1140186988 16:72783051-72783073 TTGTTAGTCTCCATGTATTTTGG + Exonic
1140486349 16:75296627-75296649 TTGATAGTCTCAAAGTCAGCTGG - Intronic
1142047146 16:87932780-87932802 TTCTCAGTCTCCAGGTTTGATGG + Intronic
1144116363 17:12096191-12096213 TTGTTAATTTCCATGTCTGATGG - Intronic
1144886065 17:18463100-18463122 CTCATAGTCTCCAAGACTGAAGG - Intergenic
1144951068 17:18993725-18993747 TCGTTATTCTCCAGGTCTGATGG + Intronic
1145146144 17:20481269-20481291 CTCATAGTCTCCAAGACTGAAGG + Intergenic
1145716632 17:27029135-27029157 CTGTTAGACTCCAACTCTGGGGG + Intergenic
1149481628 17:57008096-57008118 TTTTTAGTCTCAGGGTCTGAAGG - Intergenic
1149501414 17:57155681-57155703 TTCTTCAGCTCCAAGTCTGAAGG - Intergenic
1150522134 17:65879437-65879459 TTGTTAATTTACAGGTCTGAAGG - Intronic
1153249333 18:3105544-3105566 TTCTTATTCTCCAAGTTTCATGG - Intronic
1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1155645197 18:28069489-28069511 TTGGTTGTCACCAAGTCTGTTGG - Intronic
1160066227 18:75576637-75576659 TTGTTAGTCACAATGTCTGGGGG - Intergenic
1166675560 19:44738719-44738741 TTGGGGGCCTCCAAGTCTGATGG + Intergenic
927250460 2:20991363-20991385 CTGTGAGTCTCCCAGTCTGGTGG - Intergenic
927356082 2:22174623-22174645 TTGTTAGTCTCAAAGAATCACGG + Intergenic
927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG + Intronic
930601135 2:53444407-53444429 TTTTTAATTTCCAGGTCTGAGGG - Intergenic
931215690 2:60242086-60242108 GTGTTAGTCCCAGAGTCTGAAGG - Intergenic
937039017 2:118806897-118806919 CCGTGCGTCTCCAAGTCTGAGGG - Intergenic
937573739 2:123393756-123393778 CTGTTAGTCTGTTAGTCTGATGG - Intergenic
941724439 2:168845806-168845828 TTGTTAGAATCCAAGTCACATGG + Intronic
948366295 2:237457119-237457141 TTGTGGGTCTCCAAAGCTGATGG - Intergenic
1169339858 20:4788080-4788102 TTGTTTGCCTTCAAGGCTGATGG - Intronic
1173146325 20:40527657-40527679 TTGATAGTATCCAAATCCGAGGG - Intergenic
1174070765 20:47897550-47897572 TTGTTCTTGTTCAAGTCTGAGGG + Intergenic
1174149521 20:48476286-48476308 GTGCTAGTCTTCAAGTTTGATGG - Intergenic
1174149563 20:48476537-48476559 GTGCTACTCTTCAAGTCTGAGGG + Intergenic
1174153298 20:48501106-48501128 TTGTTCTTGTTCAAGTCTGAGGG - Intergenic
1174281237 20:49441052-49441074 TTGAAAATCCCCAAGTCTGAGGG + Intronic
1177061342 21:16377929-16377951 TTTTTAGACTCCTATTCTGAAGG + Intergenic
1178665942 21:34546648-34546670 TTATGAGTCTCCAACTCAGAGGG + Intronic
1179122569 21:38561668-38561690 TTGTCAGTCTCAAAGTCAGTTGG + Intronic
1182130740 22:27848713-27848735 TTGGTAGGCTTCAATTCTGAGGG + Intergenic
957313353 3:78546770-78546792 TTGTTGGGCTCCAAGTCAAAAGG + Intergenic
957314641 3:78561693-78561715 TTTTTAGTTTCCACGTATGAGGG + Intergenic
957846052 3:85737070-85737092 TTGTTGGTCTCCAGTACTGATGG - Intronic
958822444 3:98991101-98991123 TTGTTAAAATCCAAGTCTGTTGG - Intergenic
959040939 3:101422988-101423010 ATGTAGGACTCCAAGTCTGAGGG - Intronic
959262815 3:104102991-104103013 TTGTTACTTCCTAAGTCTGAGGG + Intergenic
960159399 3:114333620-114333642 TTGTTTGTCACCAAGTCACATGG + Intergenic
960298314 3:115970505-115970527 TTGTTAGTCTACAAAAGTGAGGG + Intronic
964093343 3:152901495-152901517 TTGTTATTATCTGAGTCTGAGGG + Intergenic
965293809 3:166917463-166917485 TTGTTCCTTTCCCAGTCTGAGGG - Intergenic
976822208 4:89219225-89219247 TTTTTAGTGTCCAAGGCTTAGGG + Intergenic
978421011 4:108532938-108532960 TTGTTAGCCTCCCCTTCTGATGG + Intergenic
979719964 4:123887605-123887627 TTCCTAGTTTTCAAGTCTGATGG + Intergenic
983357893 4:166687816-166687838 ATGTTATTCTTCAAGGCTGATGG - Intergenic
988655837 5:33210510-33210532 TTTTTAGTTTCCCAGTGTGATGG - Intergenic
989506060 5:42228902-42228924 TTGTTCCTTTCCTAGTCTGAGGG + Intergenic
992047464 5:72908711-72908733 CTTATAGTCTCCAAGACTGAAGG - Exonic
996291992 5:121862240-121862262 ATGTTTTTCTGCAAGTCTGAAGG - Intergenic
998328169 5:141300884-141300906 TTGCTTATCTCCAAGTCTGTGGG + Intergenic
1000188668 5:158886620-158886642 TTGTTAATCTCCTAGTATGTAGG - Intronic
1000742455 5:164986882-164986904 TTGTTTGTTTCCAATTATGATGG + Intergenic
1000765098 5:165278478-165278500 TTGTATGTCTCCAAGTCAGGAGG - Intergenic
1000898744 5:166888370-166888392 ATGCTCGTCTCCAACTCTGATGG - Intergenic
1001071173 5:168586532-168586554 GAGTCAGTCACCAAGTCTGAGGG + Intergenic
1001255737 5:170182294-170182316 TTGCTTGTCTGCAACTCTGAGGG + Intergenic
1009762900 6:68031199-68031221 GTGTTAGTCTTGAATTCTGAAGG - Intergenic
1009811360 6:68671321-68671343 TTGTTGTTTTCCAAGTCTTAGGG + Intronic
1011966758 6:93168350-93168372 TTGTTAGTAACCAAGTCTAAAGG - Intergenic
1015698717 6:136011009-136011031 ATGTAAATCTCCAAGGCTGAGGG - Intronic
1027278972 7:76591647-76591669 TTGTTCCTTTCCCAGTCTGAAGG - Intergenic
1031365576 7:120896438-120896460 CTTTTAGTCTCCCAGTCTTAAGG + Intergenic
1032917366 7:136507320-136507342 TTGTTAGTTTCCAAATTTAATGG - Intergenic
1040923802 8:52654075-52654097 TTGTTTGTCTCCATGTCTTCTGG - Intronic
1040949746 8:52925367-52925389 TAGTTAAATTCCAAGTCTGATGG + Intergenic
1044053811 8:87542876-87542898 TTGTCAGTGCCAAAGTCTGAAGG + Intronic
1044680419 8:94772355-94772377 TTGTTAGTTATCAAGCCTGAGGG - Intronic
1048171251 8:132108962-132108984 ATATAAGTCCCCAAGTCTGATGG + Intronic
1048209077 8:132439827-132439849 TTGTTATTTTACATGTCTGAAGG - Intronic
1051176966 9:14370698-14370720 AAGAAAGTCTCCAAGTCTGAAGG - Intronic
1051981038 9:23017273-23017295 TTTTTAGTTTCCACGTGTGAAGG - Intergenic
1057829941 9:98398626-98398648 TTGCCAGATTCCAAGTCTGAAGG - Intronic
1059990750 9:119862946-119862968 TTATTATTCATCAAGTCTGAAGG + Intergenic
1203491412 Un_GL000224v1:108890-108912 TTATTAATTACCAAGTCTGAAGG - Intergenic
1203504036 Un_KI270741v1:50760-50782 TTATTAATTACCAAGTCTGAAGG - Intergenic
1186317681 X:8388230-8388252 TTGTTAGTCTTACAGTCAGAGGG + Intergenic
1187173387 X:16871716-16871738 TTGTTAGTGCCTAAGGCTGAGGG + Intergenic
1189224266 X:39399292-39399314 TTTTAAGTCTCTAAGTCTTAGGG - Intergenic
1193444012 X:81577524-81577546 TTGTTATTTCCCTAGTCTGAGGG - Intergenic
1193817831 X:86125517-86125539 TTGTTACTTCCCCAGTCTGAGGG + Intergenic
1194334412 X:92627749-92627771 GTGTTAATGTTCAAGTCTGAAGG - Intergenic
1194647204 X:96472277-96472299 TTGTTACTATCCATGTGTGATGG + Intergenic
1194899948 X:99497769-99497791 TTGTTTCTCTCCCAGACTGAGGG - Intergenic
1195347325 X:103963116-103963138 TTGTTAGACGCCCAGTCTAACGG - Exonic
1195360117 X:104075725-104075747 TTGTTAGACGCCCAGTCTAACGG + Intergenic
1196303124 X:114069279-114069301 ATGAGAGTCTCCAAGTCAGAAGG + Intergenic
1199200857 X:145087701-145087723 GTGTAAGCCTCCAAGTCTTAGGG - Intergenic
1200642887 Y:5744799-5744821 GTGTTAATGTTCAAGTCTGAAGG - Intergenic
1200939391 Y:8766264-8766286 TTTTGAGTCTCCAAGTCTGTTGG - Intergenic