ID: 904732679

View in Genome Browser
Species Human (GRCh38)
Location 1:32606774-32606796
Sequence TCACCCAAGAGGAGACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904732673_904732679 24 Left 904732673 1:32606727-32606749 CCTTTCCACAGGCAGGTCGACCT 0: 1
1: 2
2: 35
3: 129
4: 374
Right 904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 173
904732674_904732679 19 Left 904732674 1:32606732-32606754 CCACAGGCAGGTCGACCTGATGA 0: 1
1: 3
2: 23
3: 59
4: 179
Right 904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 173
904732675_904732679 4 Left 904732675 1:32606747-32606769 CCTGATGAGTGTCCAGATGACCA 0: 1
1: 0
2: 2
3: 9
4: 93
Right 904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 173
904732676_904732679 -8 Left 904732676 1:32606759-32606781 CCAGATGACCAGCTCTCACCCAA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904732679 Original CRISPR TCACCCAAGAGGAGACCTGC AGG Intronic
900422708 1:2562505-2562527 TCACCCAACTGGGCACCTGCTGG + Intronic
900866985 1:5275813-5275835 TTAGCCAAGCAGAGACCTGCAGG + Intergenic
902273901 1:15325736-15325758 TCATCCAGGAGGAGCCCTGGAGG + Intronic
902705936 1:18204504-18204526 TAACCCAAGAGGTGAACTGGTGG - Intronic
903543700 1:24110822-24110844 TGGCCCAGGAGGAGAGCTGCTGG + Intronic
904398976 1:30243405-30243427 TCACCCAGGATGGGAACTGCAGG + Intergenic
904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG + Intronic
904804125 1:33119080-33119102 TCACCAAAGCTGAGACCTGAAGG + Intronic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
908669677 1:66532987-66533009 TCACCCAAGTGGAAACCTGGAGG - Intergenic
910604787 1:89071803-89071825 TCAGCCAAGGGGAGCCCTGAAGG + Intergenic
914341958 1:146767280-146767302 TCAAGGGAGAGGAGACCTGCAGG + Intergenic
914490230 1:148146956-148146978 ACACCCAAGAGGGGACCAGGCGG + Intronic
916554307 1:165880465-165880487 GAAACAAAGAGGAGACCTGCTGG - Intronic
921075633 1:211698423-211698445 ACACCCAAGTTGAGAACTGCAGG - Intergenic
921317892 1:213909227-213909249 TCAGCCAAGTGGAGACATCCGGG + Intergenic
922752492 1:228077124-228077146 TCACCCAGGAGGAGCCCGGCAGG + Intergenic
922879918 1:228972962-228972984 TGACCCAAGAGCAGAACTGATGG + Intergenic
923226401 1:231942256-231942278 TCCCCTAAGAGGGAACCTGCTGG + Intronic
924614160 1:245598946-245598968 ACTCCCAAGGGTAGACCTGCAGG - Intronic
924901918 1:248410428-248410450 TCACTCAAGAATGGACCTGCAGG - Intergenic
1064100943 10:12463732-12463754 TAATCCAAGATGAGACCTGGTGG - Intronic
1064998294 10:21315343-21315365 TCACCCCAGAGCAGACCACCAGG - Intergenic
1066144384 10:32541456-32541478 TCACACAAGAGCAGGACTGCTGG + Intronic
1067427645 10:46221731-46221753 GGACCCAAGAGGAGACCAGAAGG - Intergenic
1067442591 10:46317991-46318013 TCACAGTAGAGGAGACCTCCAGG - Intronic
1067583067 10:47457644-47457666 GGACCCAAGAGGAGACCAGAAGG - Intergenic
1067802608 10:49369512-49369534 TCACAGAAGAGGACTCCTGCAGG - Intronic
1068409249 10:56633941-56633963 GCACTCAAGATGAGACCTTCAGG + Intergenic
1069572084 10:69500359-69500381 CCACCCAAGAAGGGACTTGCTGG + Intronic
1069896485 10:71683380-71683402 TCACCCTGGAGCAGACATGCTGG + Intronic
1069970567 10:72164643-72164665 ATACCCAGGAGGAGAACTGCTGG + Intronic
1070145581 10:73771431-73771453 TCTCCCAAGAGGAGAGGGGCAGG + Exonic
1070820835 10:79353188-79353210 CCAGCCAAGAGCAGAACTGCAGG - Intronic
1071419157 10:85472799-85472821 GCACCCAGGAGTAGACTTGCAGG - Intergenic
1076599514 10:131647826-131647848 GCACCTAGGATGAGACCTGCCGG - Intergenic
1079310491 11:19361354-19361376 TCACTCGAGAGGTGACATGCTGG - Intronic
1079526675 11:21398387-21398409 TCACCCAACAGAAGAGCTGACGG - Intronic
1081750689 11:45508732-45508754 TCACATAAGAGGAGCCCTGAAGG - Intergenic
1082819083 11:57531481-57531503 TCACCCAAGATTAGCCCTGGTGG - Intergenic
1083457670 11:62789879-62789901 TCACCCAAGAAGAGGTCTGTAGG - Exonic
1085387682 11:76166397-76166419 TCACGCAGGAGGGTACCTGCAGG + Intergenic
1088135710 11:106553014-106553036 ACAGCTCAGAGGAGACCTGCAGG - Intergenic
1088751195 11:112843422-112843444 ACAACTAAGAGGAAACCTGCAGG - Intergenic
1088805222 11:113346229-113346251 TCACACAAGCAGAGACATGCAGG - Intronic
1089290500 11:117435248-117435270 TCACTAAAGAATAGACCTGCAGG - Intronic
1089321799 11:117631396-117631418 AAGCCCAAGAGGAGAGCTGCGGG + Intronic
1090514576 11:127411830-127411852 ACAGCCGAGAGGAAACCTGCAGG + Intergenic
1091024090 11:132126614-132126636 TCTCCCAAGAGGAGAGGAGCTGG + Intronic
1091644257 12:2261958-2261980 TCCCCCATGAGGATAACTGCAGG - Intronic
1095675622 12:44914387-44914409 TGAGCTAAGAGGACACCTGCAGG - Intronic
1098818509 12:75199912-75199934 ACACCTATGAGAAGACCTGCAGG - Intronic
1099221508 12:79920370-79920392 ACACCTAAGAGTAGAACTGCTGG + Intronic
1101744013 12:107524052-107524074 TCACCTAAGAGGCAGCCTGCAGG + Intronic
1101799375 12:108007353-108007375 GCAACCAAGAAGAGAGCTGCAGG - Intergenic
1103012216 12:117466123-117466145 TCACCCTTGAGGAGTCCTGTTGG - Exonic
1103038572 12:117676019-117676041 TGACCCAAGAGGAGGCCTTCAGG + Intronic
1103945614 12:124524721-124524743 TCATTCAAGGGGAGACCTGGGGG - Intronic
1104003746 12:124877729-124877751 TCATCCAACAGGACACATGCAGG - Intronic
1108366819 13:49724271-49724293 TCACCTAGGAGTAGAACTGCTGG + Intronic
1108642381 13:52394978-52395000 TAACCCAAGTGGAGACTTGAAGG + Intronic
1113817326 13:113182332-113182354 TGACCCACGAGGAGCCCTGTGGG + Intronic
1114378339 14:22173612-22173634 GGCCCCAATAGGAGACCTGCTGG + Intergenic
1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG + Intronic
1122616240 14:103019976-103019998 TCAAACAAGATGAGACCAGCTGG + Intronic
1128461550 15:67872132-67872154 ACACCCAGGAGTAGATCTGCTGG - Intergenic
1128568021 15:68714043-68714065 TCAGCCACGGGGAGGCCTGCTGG + Intronic
1131557879 15:93414974-93414996 GGACCCGAGAGAAGACCTGCAGG + Intergenic
1132150049 15:99452797-99452819 TCCCCCAAGCTGAGACCTGGAGG + Intergenic
1132513268 16:354196-354218 TCACCCAACAGGAGGCGAGCTGG - Intergenic
1138620955 16:58211020-58211042 TCACCAGCCAGGAGACCTGCAGG + Intergenic
1139992317 16:70950145-70950167 TCAAGGGAGAGGAGACCTGCAGG - Intronic
1141097435 16:81172822-81172844 TCACCCAGCAGGAGCCCAGCAGG + Intergenic
1141292944 16:82737252-82737274 TCATCCAGGTGGAGACCTGAGGG + Intronic
1141524566 16:84603482-84603504 TCACCGATGAGGAGACCTCCAGG - Intronic
1142518517 17:489538-489560 TCTCCCAGGAGGCGTCCTGCTGG - Intergenic
1147474211 17:40694679-40694701 TCACCCAGGAGGAGACAAACTGG - Intergenic
1147969870 17:44213436-44213458 TCACCACAGAGCAGACCTGCTGG + Intronic
1150440885 17:65190407-65190429 TAACCCAAGATGAGACCCGGAGG - Intronic
1151246900 17:72802248-72802270 TGGCCCAAGAGAAGGCCTGCAGG + Intronic
1151416985 17:73973004-73973026 CCAGCCAGGAGGAGACGTGCGGG - Intergenic
1151555909 17:74846643-74846665 CCACCCCACAGGAGTCCTGCAGG + Intronic
1155890579 18:31263241-31263263 TCACCCAAGAGAACTCCTCCAGG + Intergenic
1156939968 18:42755401-42755423 ACAGCCAGGAGGAGACCTGTAGG - Intronic
1160536051 18:79592950-79592972 TCACCCAGGGAGGGACCTGCTGG - Intergenic
1160995382 19:1879864-1879886 ACACCCAAGAGGGGACCAGGCGG - Intronic
1161383281 19:3977680-3977702 TCCCCCTGGTGGAGACCTGCAGG - Intronic
1162039990 19:7964962-7964984 TCAGCCAAGCGCAGCCCTGCAGG + Intronic
1164476835 19:28582006-28582028 TTACCCAAGAGCTTACCTGCTGG - Intergenic
1166569340 19:43783976-43783998 AGACCCAAGAGGAGACCAGGAGG - Intergenic
1167235118 19:48309516-48309538 ACAGCTCAGAGGAGACCTGCAGG - Intronic
925215095 2:2087460-2087482 ACACCCAGGAGGGGCCCTGCAGG + Intronic
926865539 2:17353539-17353561 TCACCCAAAGGGAGACATGCTGG + Intergenic
927484197 2:23477681-23477703 TGACCCAACAGGAGGCCTGGAGG - Intronic
928206697 2:29289704-29289726 TTACCCCAGAGTAGACCTGCAGG - Intronic
928244403 2:29614736-29614758 TGACCCAACAGGAGCCATGCAGG - Intronic
928822319 2:35376422-35376444 TAACCGAAGAGCAGTCCTGCCGG + Intergenic
931291438 2:60877351-60877373 ACACCCAAGAGTAGTACTGCTGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG + Intergenic
935011463 2:99140805-99140827 ACAACCAAGCGGAGAGCTGCGGG + Intronic
937091643 2:119210387-119210409 TCAACCAAAAGGAGAACTCCTGG + Intergenic
937644789 2:124254433-124254455 TCACCCAACAGGAGAAAGGCTGG - Intronic
937794466 2:126000464-126000486 TCACCCAAAAGGAGAACTTTTGG - Intergenic
940212420 2:151268830-151268852 TCACCCAAGAGCAGTCTGGCTGG - Intergenic
942534638 2:176950168-176950190 TCACCCAACACCAGATCTGCTGG + Intergenic
943324392 2:186480578-186480600 TCAGCCATGTGGAGACCTGTGGG + Intergenic
948151392 2:235747510-235747532 CCAGCTAAGAGGAGTCCTGCAGG - Intronic
948368475 2:237473494-237473516 TCAGCCAAGAGGGGCCCAGCAGG + Intergenic
948479728 2:238241621-238241643 TCACCCAGCAGGAAGCCTGCAGG - Intergenic
948893221 2:240916930-240916952 CCAACCAGGAGGAGAGCTGCTGG - Intergenic
949017757 2:241723029-241723051 TCTCCCCATAGGAGACCTGGTGG - Exonic
1168819021 20:761223-761245 GCACCCACGAGGCCACCTGCGGG + Exonic
1168921143 20:1537274-1537296 CCTCCCAAGAACAGACCTGCAGG - Exonic
1169374899 20:5058498-5058520 TCACCCAAGAGTCTACCTGTGGG + Intergenic
1170358738 20:15521080-15521102 TCACCCAGGAGAAAACCTACAGG - Intronic
1173113855 20:40221589-40221611 TCAGCTGAGAGGAGACCTGGGGG + Intergenic
1174432559 20:50481040-50481062 TGACCCAACAGGAGAGCTGGGGG + Intergenic
1175338514 20:58212378-58212400 TCTCACAAAAGGAGACTTGCCGG + Intergenic
1175778086 20:61665543-61665565 TCACCCACTAGGAGATCTGACGG - Intronic
1175939995 20:62533478-62533500 TGACCTAAGAGGAGACCTCAGGG - Intergenic
1176143486 20:63555150-63555172 TCACCAAAGACGAGGCCAGCTGG - Exonic
1177098327 21:16867476-16867498 TCAACCACAAGGATACCTGCAGG + Intergenic
1177693597 21:24541986-24542008 TCACCAAACAAGAAACCTGCCGG - Intergenic
1177773449 21:25542988-25543010 GCATCAGAGAGGAGACCTGCTGG + Intergenic
1179451907 21:41473636-41473658 TTCCCCAAGAGGAGACCCCCAGG - Intronic
1181640053 22:24191526-24191548 TCAGCCAACAGGAGACCTAGTGG - Intergenic
1182011885 22:27007935-27007957 GCACCCATGAGGAGAGCTGCAGG + Intergenic
1183423035 22:37723407-37723429 TCACCCAAAGGGACACCTCCAGG + Exonic
1183423052 22:37723467-37723489 CCACCCAACAGGAAACCTCCAGG + Exonic
1183423071 22:37723527-37723549 CCACCCAAGAGGACACCCCCAGG + Exonic
950451900 3:13070114-13070136 TCAGCCTAGTGGAGCCCTGCCGG - Intronic
952191285 3:31025913-31025935 AGAGCCTAGAGGAGACCTGCCGG + Intergenic
952205242 3:31174755-31174777 GCACCCAAGTGGAGACATCCGGG - Intergenic
953766612 3:45747755-45747777 ACAGCTCAGAGGAGACCTGCAGG - Intergenic
954643209 3:52114656-52114678 TGAGCCCAGAGGTGACCTGCTGG - Intronic
957095298 3:75772206-75772228 ACAGCTCAGAGGAGACCTGCAGG - Intronic
961185951 3:124915186-124915208 TCACCCCAGAGGTGACCCACTGG - Intronic
961358190 3:126352003-126352025 TGGCCCATGAGGAGACCGGCAGG + Exonic
962874275 3:139523888-139523910 GGATCCATGAGGAGACCTGCAGG + Intronic
963134382 3:141887538-141887560 ACACCTAAGAGTAGAACTGCTGG - Intronic
969321504 4:6415725-6415747 TCACCCAGGAGGGGAACTGAAGG + Intronic
969574690 4:8030076-8030098 TCAGGCAGGAGGAGACCTGGAGG - Intronic
969694248 4:8725765-8725787 TCACCGTGGAGGAGGCCTGCTGG - Intergenic
973645762 4:52949963-52949985 TCTGCCTAGAGTAGACCTGCAGG - Intronic
975194648 4:71509696-71509718 TTACCCAAGAGGCTACCTGGTGG - Intronic
975769594 4:77707093-77707115 TCAGCCAATGGGAGACCTGGAGG + Intergenic
979152817 4:117341755-117341777 TCTCACAAGATAAGACCTGCTGG - Intergenic
981734328 4:147933739-147933761 CCACCCATGCAGAGACCTGCTGG - Intronic
981850751 4:149227690-149227712 TAACCCTAGAAGACACCTGCAGG + Intergenic
983270558 4:165556903-165556925 ATGCCCAAGAGTAGACCTGCTGG + Intergenic
989024296 5:37048259-37048281 TCACACAAGAGGAAACCTTGAGG - Intronic
991481131 5:67081277-67081299 TAACCCAGGAGGATACCTGTGGG + Intronic
993033304 5:82729128-82729150 CCATCCCAGAGGAGAGCTGCAGG + Intergenic
997211199 5:132077966-132077988 TCTCCCACAAGGAGACCTGTGGG - Intergenic
998331142 5:141328273-141328295 TCACCAAAGTGGACACCAGCTGG + Intergenic
998530620 5:142881120-142881142 GCCACCAAGAGGAGCCCTGCGGG - Intronic
999731509 5:154479138-154479160 ACAGACCAGAGGAGACCTGCTGG - Intergenic
1001120746 5:168978017-168978039 TGCCCCAACAGGAGTCCTGCAGG - Intronic
1002977922 6:2104048-2104070 TAACTAAAGAGGAGACATGCAGG + Intronic
1011038452 6:83002799-83002821 TCACCAAACATCAGACCTGCTGG + Intronic
1014172043 6:118289357-118289379 ACACCCAAGAGTACAACTGCTGG + Intronic
1015294716 6:131577379-131577401 GCACCCAGGAGTAGAACTGCTGG - Intronic
1018626811 6:165787732-165787754 TCTCCAAATAGGATACCTGCAGG - Intronic
1019167290 6:170107133-170107155 TCACCAAAGAGGTGTCCTGGGGG - Intergenic
1022107227 7:27205218-27205240 CCACCCAGGAAGTGACCTGCGGG + Intergenic
1023356443 7:39371660-39371682 CCACCCAAGAGGAGTCATGCTGG + Intronic
1024004085 7:45212560-45212582 CCACCCTACAGGAGACCTGCTGG + Intergenic
1027427921 7:78080815-78080837 TCACCCAAGCAGAAACCTGGGGG + Intronic
1029346296 7:99981032-99981054 TCACCCAAAATAAGACCTTCAGG + Intergenic
1029558876 7:101289483-101289505 TCACCCAAAATAAGACCTTCAGG - Intergenic
1036466542 8:9003033-9003055 TCACGCCAGAGGAGAGTTGCTGG - Exonic
1040285454 8:46098351-46098373 TCACACAAAGGGAGACCTTCAGG - Intergenic
1042004960 8:64169677-64169699 ACAGCTCAGAGGAGACCTGCAGG - Intergenic
1042238852 8:66641949-66641971 ACACCTAAGAGTAGAACTGCTGG + Intronic
1045482615 8:102604238-102604260 TCACCCAAGATGAAGCCTGAAGG - Intergenic
1048845777 8:138602625-138602647 TTCCTGAAGAGGAGACCTGCAGG - Intronic
1055506484 9:76954753-76954775 TCACCAAAGAGGAGAACTGGGGG - Intergenic
1059959743 9:119553325-119553347 CCACCCAGGTGGTGACCTGCTGG - Intergenic
1061077435 9:128350234-128350256 TCACACAAATGGACACCTGCAGG - Intronic
1061184501 9:129044536-129044558 TCTCCCAAGATGAGAACTCCTGG - Intronic
1185640151 X:1585754-1585776 TCACCCAAGAATAGACAAGCAGG + Intergenic
1186575939 X:10766086-10766108 ACACCCAAGGGGAGACAGGCAGG + Intronic
1190825173 X:54011106-54011128 GCACCCAAGGGAAGACCTGTGGG + Exonic
1193449613 X:81649662-81649684 TAACCCATGATGAGAGCTGCTGG + Intergenic
1197776622 X:130122297-130122319 TCAAGCTAGAGGAGCCCTGCTGG + Intergenic