ID: 904738228

View in Genome Browser
Species Human (GRCh38)
Location 1:32651338-32651360
Sequence CACCCACTGCCCTCCTGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 655}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904738228_904738239 19 Left 904738228 1:32651338-32651360 CCGACCCAGGAGGGCAGTGGGTG 0: 1
1: 0
2: 5
3: 51
4: 655
Right 904738239 1:32651380-32651402 TCGACATGGCCTAACAGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 45
904738228_904738233 -6 Left 904738228 1:32651338-32651360 CCGACCCAGGAGGGCAGTGGGTG 0: 1
1: 0
2: 5
3: 51
4: 655
Right 904738233 1:32651355-32651377 TGGGTGCCTGGGCTGAGCCGCGG 0: 1
1: 0
2: 4
3: 49
4: 481
904738228_904738238 18 Left 904738228 1:32651338-32651360 CCGACCCAGGAGGGCAGTGGGTG 0: 1
1: 0
2: 5
3: 51
4: 655
Right 904738238 1:32651379-32651401 CTCGACATGGCCTAACAGTGAGG 0: 1
1: 0
2: 0
3: 0
4: 45
904738228_904738235 5 Left 904738228 1:32651338-32651360 CCGACCCAGGAGGGCAGTGGGTG 0: 1
1: 0
2: 5
3: 51
4: 655
Right 904738235 1:32651366-32651388 GCTGAGCCGCGGCCTCGACATGG 0: 1
1: 0
2: 0
3: 4
4: 72
904738228_904738240 23 Left 904738228 1:32651338-32651360 CCGACCCAGGAGGGCAGTGGGTG 0: 1
1: 0
2: 5
3: 51
4: 655
Right 904738240 1:32651384-32651406 CATGGCCTAACAGTGAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904738228 Original CRISPR CACCCACTGCCCTCCTGGGT CGG (reversed) Intronic
900159195 1:1215499-1215521 CCTCCTCTGCCCACCTGGGTTGG - Intergenic
900387791 1:2418496-2418518 CACCCACTGCCTCCCTCGGACGG + Intergenic
900578555 1:3396163-3396185 CACCAAGAGCCCACCTGGGTGGG - Intronic
900598638 1:3493735-3493757 CACCCACGCCCTTCCTGGGCAGG + Intronic
900788225 1:4663047-4663069 GCCCCACTGCCCCCCTGGGAAGG - Intronic
900949231 1:5848356-5848378 CACCCACTGCACTCCAGCCTGGG + Intergenic
901326865 1:8371870-8371892 CACCCACTTGGCCCCTGGGTCGG - Intronic
901789991 1:11648997-11649019 CGCCCACAGCGCTCCTGGGCTGG - Intronic
901853449 1:12030006-12030028 CCCCCACTGCCCCCCTGCGCAGG + Exonic
902018858 1:13328909-13328931 CCCCCACCTCCCTCCTGGGCGGG - Intergenic
902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG + Intronic
902727996 1:18350124-18350146 CACCCACTGTCCACTTGGCTTGG + Intronic
902730806 1:18367648-18367670 CACCCACTGCACTCCAGCCTGGG - Intronic
903452339 1:23462726-23462748 CTCACACTGCCCTCCTGGCTGGG - Intronic
903637774 1:24833539-24833561 CCCCCACCTCCCTCCTGGGCGGG + Intronic
903858485 1:26351237-26351259 CAACCCCTGCCCTCCTCGCTGGG + Intronic
903921422 1:26803619-26803641 CCCCCACCTCCCTCCTGGATGGG + Intergenic
904533859 1:31186440-31186462 CATCCACTGCCCTCCAGCCTGGG - Intronic
904738228 1:32651338-32651360 CACCCACTGCCCTCCTGGGTCGG - Intronic
904756292 1:32770539-32770561 CTCCCACTGCCTCCCTGGGGAGG - Exonic
905616356 1:39403138-39403160 CACCCACTGCACTCCAGCCTGGG - Intronic
905645745 1:39624076-39624098 CACCCACAGCCATCCTGGCCAGG - Intergenic
906356942 1:45115281-45115303 CCCCCACCTCCCTCCTGGATGGG + Intronic
906389973 1:45406611-45406633 CACCCACTGCACTCCAGCCTGGG + Intronic
906794590 1:48687045-48687067 CACCCCCTGCCCCTCTGTGTTGG - Intronic
906986444 1:50688091-50688113 CACCCACTGCACTCCAGGCTGGG + Intronic
907381483 1:54094509-54094531 CAGGCACTGCCCTCCTGGGTTGG + Intronic
907418192 1:54328915-54328937 CAGCCCCTGCCCTCCTGGACAGG - Intronic
907515026 1:54988374-54988396 CACCCTGTGACCTCCTAGGTGGG - Intronic
907527032 1:55059715-55059737 CACCCACTGCCCGCGAGGCTTGG + Intronic
908195894 1:61745315-61745337 CACCCACTGCACTCCAGCCTGGG - Intronic
908414753 1:63902358-63902380 AAGCCACTGCCCTCCTGCCTGGG - Intronic
908841350 1:68282867-68282889 CAGCCACTGCCCTCCAGCCTGGG + Intergenic
909030539 1:70534022-70534044 CACCCACTGCACTCCAGCCTGGG - Intergenic
910887261 1:91977825-91977847 CATCCACTGCACTCCAGGCTGGG + Intronic
911070485 1:93828260-93828282 CAACCACTGCCCTCCAGCCTGGG + Intronic
911351742 1:96762677-96762699 CCCCCACCTCCCTCCTGGATGGG + Intronic
911408725 1:97473971-97473993 CACTCACTGCACTCCTGCCTGGG + Intronic
912352561 1:109028225-109028247 CAGCCACTGCACTCCTGCCTGGG - Intronic
913033802 1:114940137-114940159 CAGCCACTGCACTCCAGCGTGGG - Intronic
914171937 1:145233359-145233381 CATCCCCGGTCCTCCTGGGTCGG - Intergenic
914231017 1:145764738-145764760 CCCCCACCTCCCTCCTGGATGGG - Intronic
914357716 1:146901930-146901952 CACCCACTGCACTCCAGCCTGGG - Intergenic
915119895 1:153623230-153623252 CACCCACTGCACTCCAGTCTGGG - Intronic
915590314 1:156866756-156866778 CACACACTGCCTTCCAGGGCTGG + Intronic
916186679 1:162139869-162139891 CACACACTGCCCTCCAGCCTGGG - Intronic
916451743 1:164927688-164927710 CACCCACTGCACTCCAGCTTGGG - Intergenic
916867773 1:168878758-168878780 CCCCCACTGCCCTCCAGTCTAGG + Intergenic
917089021 1:171333861-171333883 CACCCACTGCACTCCAGCTTGGG - Intronic
917375908 1:174349866-174349888 CCCCCACCTCCCTCCTGGATGGG + Intronic
918335005 1:183500723-183500745 CTCCCACTTCCCTCCTTGTTTGG - Intronic
918933399 1:190887145-190887167 CACCCACTGCCCTCATGCATAGG - Intergenic
919083368 1:192891953-192891975 AAGACCCTGCCCTCCTGGGTGGG - Intergenic
919129760 1:193437616-193437638 CCCCCACCTCCCTCCTGGATGGG + Intergenic
919129780 1:193437662-193437684 CCCCCACCTCCCTCCTGGATGGG + Intergenic
919761077 1:201098720-201098742 CAGCCACTGCCCTCCTGCTCTGG - Intronic
919987471 1:202685939-202685961 CACCCTCTACACTCCTGGGGAGG + Intronic
920056883 1:203199366-203199388 CATCCAGTGCCAACCTGGGTAGG - Intergenic
920250161 1:204618012-204618034 CACCCACACCCTTCCTGGGTTGG + Exonic
920317515 1:205088656-205088678 CACCCTCCCACCTCCTGGGTGGG + Exonic
920504197 1:206505282-206505304 CACCCACTGCACTCCAGGAAGGG + Intergenic
921155293 1:212433802-212433824 AACCACCTGCCCACCTGGGTTGG + Intronic
922102523 1:222487940-222487962 CCCCCACCTCCCTCCTGGATGGG - Intergenic
922459200 1:225801646-225801668 CTGCCACTGCACTCCAGGGTGGG + Intergenic
922719956 1:227895286-227895308 CACCCACTGCCCTGCTGTGTCGG - Intergenic
922767606 1:228164009-228164031 CACCCTCTGCCCTGCTGTGTTGG + Intergenic
923580881 1:235211286-235211308 CAGCCACTGCACTCCAGGCTGGG + Intronic
924065585 1:240218512-240218534 TACCCACTGCCCTCCAGCCTAGG + Intronic
924203106 1:241681040-241681062 CACCCCCTCCCCTCCTGTCTTGG + Intronic
924308421 1:242715454-242715476 CACCCACTGCACTCCAGCCTGGG + Intergenic
924779170 1:247131235-247131257 CACTCACTGCCTCCCTGGGCTGG - Intronic
1062931406 10:1354955-1354977 GCTCCACTGCCCTCCTGGGCTGG - Intronic
1063214001 10:3907583-3907605 GCTCCACTGCCCTCCTGAGTTGG + Intergenic
1063292481 10:4763648-4763670 CATTCACTGCACTCCAGGGTGGG + Intergenic
1064159887 10:12936398-12936420 CACCCACTGCACTCCAGCCTGGG - Intronic
1065584468 10:27204094-27204116 CAGCCACTGCCCTCCAGCCTGGG + Intronic
1066085532 10:31970347-31970369 CCCCCACCTCCCTCCTGGGCGGG - Intergenic
1067115677 10:43433907-43433929 CTGCCACTGCACTCCTGGCTAGG + Intergenic
1067188887 10:44053371-44053393 CACCCACTGCACTCCAGCCTGGG + Intergenic
1067473510 10:46552036-46552058 CACTCAGTGCCCTCCTCTGTGGG - Intronic
1068337075 10:55647636-55647658 CACCCACTGCACTCCAGCCTGGG + Intergenic
1069386416 10:67886511-67886533 CTGCCACTGCACTCCAGGGTGGG + Intronic
1069776025 10:70927650-70927672 CACCCACTCCCCACCTGCCTAGG - Intergenic
1070135480 10:73689839-73689861 CCCCCACCTCCCTCCTGGATGGG - Intronic
1070418136 10:76209110-76209132 CACCCACTGCACTCCAGCCTAGG + Intronic
1070868467 10:79725816-79725838 CAGCCACTGCACTCCAGCGTGGG - Intergenic
1070873544 10:79780140-79780162 CACCCACTCCCTTCCTGTGACGG + Intergenic
1070966522 10:80534296-80534318 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1071293683 10:84204337-84204359 CACCCACTGGCCTCCAGGGCTGG - Intronic
1071604724 10:86977512-86977534 CAGCCACTGCACTCCTGCCTGGG - Intronic
1071635381 10:87248023-87248045 CAGCCACTGCACTCCAGCGTGGG - Intergenic
1071640476 10:87302290-87302312 CACCCACTCCCTTCCTGTGACGG + Intergenic
1071654760 10:87435655-87435677 CACCCACTCCCTTCCTGTGACGG - Intergenic
1071659865 10:87489961-87489983 CAGCCACTGCACTCCAGCGTGGG + Intergenic
1072548448 10:96458199-96458221 CAACCACTACCCTGCTGGATGGG + Intronic
1072684584 10:97528903-97528925 CCCCCACCTCCCTCCTGGATGGG + Intronic
1072687415 10:97546543-97546565 CACCCACTGCGCTCCAGCCTGGG + Intronic
1073042100 10:100614774-100614796 GACCTACTGCCCTTCTGAGTAGG - Intergenic
1075090452 10:119441380-119441402 CTCCCACAGCCCACCTGGGCAGG - Intronic
1075715438 10:124552600-124552622 CAGCCACTGCCCCCCAGGCTGGG + Intronic
1075776488 10:124992276-124992298 CACCCACTGCACTCCAGCCTAGG - Intronic
1076132350 10:128022202-128022224 CACCCAGGCCCCTCCTGAGTCGG + Intronic
1076351114 10:129815924-129815946 CACCCCCTCCCCTCTGGGGTGGG + Intergenic
1076863027 10:133150916-133150938 CACCCACTGCCCTCCGGGAGAGG - Intergenic
1077854998 11:6115618-6115640 CACTCACTGCCTTCCTTGGCTGG - Intergenic
1078262859 11:9727346-9727368 CACCCACTGCACTCCAGCCTGGG + Intronic
1080306069 11:30838059-30838081 CCGCCACTGCACTCCAGGGTGGG - Intronic
1080645858 11:34186927-34186949 CACCCTCTCCCCTCCTGGGAGGG + Intronic
1081934967 11:46898107-46898129 CCCCCACCTCCCTCCTGGATGGG + Intronic
1082233721 11:49798388-49798410 CCCCCACCTCCCTCCTGGATAGG + Intergenic
1082749631 11:57002216-57002238 CGCCCACTCCCTTCCTGGCTTGG - Intergenic
1083079162 11:60073152-60073174 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1083208660 11:61168777-61168799 CACTCACAGCCGACCTGGGTTGG - Intergenic
1083510830 11:63208371-63208393 CACCCCCAGCCATTCTGGGTTGG - Intronic
1083576339 11:63794556-63794578 CAGCCACTGCACTCCAGCGTGGG + Intergenic
1083776877 11:64898315-64898337 CCCCCACTACCAACCTGGGTGGG - Exonic
1083960040 11:66009871-66009893 CACCCACTGCACTCCAGCCTGGG - Intergenic
1084078863 11:66805023-66805045 CAGCCACTGCACTCCAGCGTGGG + Intronic
1084192941 11:67507052-67507074 CACCCACTGCCCTCCAGAGGAGG + Intronic
1084448861 11:69220797-69220819 CACCCAGAGCCCTCGTGGGCTGG + Intergenic
1084511160 11:69605012-69605034 CACCCACTGCACTCCAGCCTGGG - Intergenic
1084570557 11:69957104-69957126 CTCCCACTGCCATGCTGGGCTGG - Intergenic
1084672675 11:70616460-70616482 CACCCAGCGCCCTCCTCGGGCGG - Intronic
1084728383 11:71057290-71057312 CACCCACTGCCCTCCAGCCTGGG + Intronic
1085116487 11:73936320-73936342 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1085291052 11:75399741-75399763 CACACAGCGCCCTCCTGGCTGGG - Intronic
1085336247 11:75698788-75698810 CTCCCAGTGCCCTCCTGCATGGG - Intergenic
1085402766 11:76244441-76244463 CAGCCCGAGCCCTCCTGGGTGGG + Intergenic
1085614110 11:77981803-77981825 CACGCACTGCACTCCAGGCTGGG - Intronic
1085754501 11:79191929-79191951 CCCCCACCTCCCTCCTGGATGGG - Intronic
1086359197 11:86039357-86039379 CAACCACTGCCCTCCAGCCTGGG + Intronic
1086881732 11:92158268-92158290 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1087056543 11:93942041-93942063 CACCCTCTGACCTCCAGGGCTGG - Intergenic
1087920441 11:103861021-103861043 CGCCCACTGCACTCCTGCCTGGG - Intergenic
1088768297 11:113007232-113007254 CACCCACTGCACTCCAGCCTGGG - Intronic
1088904703 11:114146027-114146049 GACCCACAGCCCTTCTAGGTAGG - Intronic
1089305827 11:117525501-117525523 CACCCACTGCCCTCCAGGCTGGG - Intronic
1089434406 11:118452071-118452093 CAGCCACTGCCCTCCAGCGCAGG - Intronic
1089494564 11:118901748-118901770 CTCACCCTGCCCACCTGGGTAGG + Exonic
1089509177 11:118985065-118985087 CCACCACTGCCCACCTGGGCTGG + Intergenic
1089713928 11:120337319-120337341 CACCGACTCCCCTGCTAGGTCGG - Intronic
1090973205 11:131660362-131660384 CCCCCTCCGCCCTCCTGGTTTGG - Intronic
1091772459 12:3161856-3161878 CACCCACTGCACTCCAGCCTGGG - Intronic
1091903361 12:4163420-4163442 CACCCACTGCACTCCAGCCTGGG + Intergenic
1092394250 12:8111221-8111243 CAGCCACTGCACTCCAGTGTGGG - Intergenic
1092498660 12:9024069-9024091 CACCCACTGCACTCCAGCCTGGG - Intergenic
1092578918 12:9819022-9819044 CACTCACTGCTTCCCTGGGTGGG - Intergenic
1093054275 12:14538976-14538998 CAACCACTGCCCTCCAGCCTGGG + Intronic
1095494418 12:42769728-42769750 CACCCTCTGACCTCCAGGGAGGG + Intergenic
1095511372 12:42954592-42954614 CTCCCACTATTCTCCTGGGTTGG + Intergenic
1095949981 12:47776533-47776555 CTCCCACCACCCTCCTGGGAAGG - Intronic
1096459898 12:51816316-51816338 ATCCCCCTCCCCTCCTGGGTAGG + Intergenic
1096517810 12:52167205-52167227 CACCCACTGCACTCCAGCCTGGG - Intergenic
1096755860 12:53799011-53799033 CACTCACTCTCCTTCTGGGTTGG + Intergenic
1097128093 12:56789737-56789759 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1097158363 12:57028679-57028701 CCCCCTCTGCCCTCCTGTGTGGG - Exonic
1098366686 12:69710888-69710910 CACCCACTGCACTCCAGCCTGGG + Intergenic
1098793642 12:74860751-74860773 CCTCCACTGCCCTCATGGCTGGG + Intergenic
1099255303 12:80307620-80307642 CCCCCACCTCCCTCCTGGATGGG + Intronic
1100436743 12:94578103-94578125 CACCCACTGCACTCCAGCCTGGG + Intronic
1100531374 12:95464721-95464743 CACCCACTGCACTCCAGCCTGGG + Intergenic
1101481017 12:105097162-105097184 CACCCACTGCACTCCAGACTGGG + Intergenic
1102835860 12:116059457-116059479 CACCCACTGCACTCCTGCCAAGG - Intronic
1103258412 12:119563301-119563323 CACCCACTGCACTCCAGCCTGGG + Intergenic
1103641723 12:122357489-122357511 CCCCCACCTCCCTCCTGGATGGG - Intronic
1103728271 12:123009817-123009839 CAGCCACTGCCCACCTGGCATGG + Intronic
1104002488 12:124868982-124869004 CACCGACCGCCCTCCAGGGCGGG + Intronic
1104040339 12:125125997-125126019 CACCCACTGCACTCCAGCCTGGG - Intronic
1104720551 12:131042995-131043017 CAACCTGTGCCCTCCTGGGCAGG + Intronic
1104807537 12:131599063-131599085 CCTCCACTCCCCTCCTGGGATGG + Intergenic
1105504366 13:20997665-20997687 CACCCTCTGCTCTCTTGGCTTGG + Intronic
1105508485 13:21031811-21031833 CACCCACTGCACTCCGGCCTGGG + Intronic
1106127443 13:26911910-26911932 CACCCACTGCACTCCAGCCTGGG + Intergenic
1106199903 13:27527581-27527603 TACACACTGGCCTCCTGTGTGGG + Intergenic
1108351500 13:49593357-49593379 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1108443907 13:50486812-50486834 CACCCACCACCCTCCTGGGTCGG - Intronic
1108502102 13:51078270-51078292 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1108608765 13:52064335-52064357 CCCCCACCTCCCTCCTGGATGGG - Intronic
1109756956 13:66773819-66773841 CACCCACTGCACTCCAGCCTGGG - Intronic
1109894677 13:68669258-68669280 CACCCACTGCACTCCAGCCTGGG - Intergenic
1109975213 13:69822153-69822175 CACCCACTGCACTCCAGCCTGGG + Intronic
1111367495 13:87268741-87268763 CGCCCACTGCACTCCAGGCTGGG - Intergenic
1112298950 13:98213124-98213146 AGCCCCCTGCCCACCTGGGTGGG + Intronic
1112574024 13:100619175-100619197 CCCCCACCTCCCTCCTGGATGGG + Intronic
1113347951 13:109499074-109499096 CACGCACTGCCCTCCTGCACAGG - Intergenic
1113628197 13:111862033-111862055 CTCTCACTGCCCTCCTAGTTGGG + Intergenic
1115493905 14:33984422-33984444 CCCCCACCTCCCTCCTGGATGGG + Intronic
1116191590 14:41673678-41673700 CCCCCACCTCCCTCCTGGATGGG + Intronic
1117277139 14:54203605-54203627 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1118341052 14:64895405-64895427 CCCCCACCTCCCTCCTGGGCGGG + Intergenic
1118371911 14:65144498-65144520 CACCCACTGCCCACCTCTGCTGG - Intergenic
1119135448 14:72214216-72214238 CACCCACTGCTCTCCAGCCTGGG - Intronic
1119436305 14:74600015-74600037 CAACAGCTGCCCTCCTGGCTGGG - Intronic
1119517076 14:75256896-75256918 CCACCACTGCCCTCCAGGCTGGG - Intronic
1119878438 14:78080155-78080177 CACCCACTGCACTCCAGCCTGGG - Intergenic
1119937176 14:78602723-78602745 CACTCTCTGCCCTCATGGGCCGG - Intronic
1120662017 14:87261299-87261321 CACCCACTGCACTCCAGCCTGGG + Intergenic
1121027223 14:90625453-90625475 GAGCCACTGCTCTCCTGGCTGGG + Intronic
1121637919 14:95466276-95466298 CAGCCACCTGCCTCCTGGGTCGG + Intronic
1121994022 14:98587661-98587683 CACCCACTGCCCGCCTGAGATGG - Intergenic
1122233211 14:100317586-100317608 CACCCACTCCCTTCCAGAGTGGG + Intergenic
1122553965 14:102566633-102566655 CACCCACTGCACTCCAGCCTGGG - Intergenic
1124858117 15:33410703-33410725 CACCCACTGCCATGCTGTGCGGG - Intronic
1124956341 15:34362917-34362939 TTCCCACTCCCCACCTGGGTTGG - Intronic
1125491041 15:40148638-40148660 CACACACTGCTCTCCAAGGTGGG + Intergenic
1126412186 15:48383778-48383800 CACCCTCTGCCTTTCTGGGAGGG - Intergenic
1127503032 15:59572347-59572369 CACCCACTACACTCCAGTGTGGG - Intergenic
1127959640 15:63881230-63881252 ACGCCACTGCCCTCCTGTGTGGG - Intergenic
1128080887 15:64856220-64856242 GACCCACTTCCTTCCTGAGTGGG + Intronic
1128154745 15:65385359-65385381 CACCCTCTCCCCGCCTGGCTCGG - Intronic
1128489670 15:68134498-68134520 CCCCCACTGCCCTCCCGGACGGG + Intronic
1128970509 15:72101623-72101645 CCCCCACCTCCCTCCTGGATGGG - Intronic
1129893058 15:79084603-79084625 CACCCACTGTCCTCCTCGTGGGG + Intronic
1130896115 15:88171639-88171661 CACCCAAAGCCCTGCAGGGTAGG + Intronic
1132307793 15:100830253-100830275 CTCCCAATTACCTCCTGGGTGGG + Intergenic
1132697930 16:1210191-1210213 CCCCCAGGTCCCTCCTGGGTGGG + Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133977272 16:10608139-10608161 CACCCACTGCACTCCAGTCTGGG + Intergenic
1134633800 16:15777163-15777185 CACACACTGCCCTCCAGCCTGGG - Intronic
1134773333 16:16830064-16830086 CACCCATGGCTCTCCTGGGCTGG + Intergenic
1135100490 16:19600970-19600992 CACCCACTGCCCTCCAGCCTGGG - Intronic
1135147599 16:19976315-19976337 CACCCACTGCACTCCAGCCTGGG - Intergenic
1135526291 16:23215847-23215869 CCCACACTGCCAGCCTGGGTTGG + Exonic
1135689597 16:24525676-24525698 CACCCACTGCACTCCAGTCTGGG - Intergenic
1135733505 16:24913318-24913340 CACCCCCAGCCCTCCTGGGAAGG + Intergenic
1136003294 16:27312485-27312507 CACCCACTGCACTCCAGCCTAGG + Intergenic
1136116421 16:28097603-28097625 CTCCCCCTGCCCCCCAGGGTGGG - Intergenic
1136165244 16:28448876-28448898 CCCCCACCTCCCTCCCGGGTGGG - Intergenic
1136165267 16:28448925-28448947 CCCCCACCTCCCTCCCGGGTGGG - Intergenic
1136197707 16:28666095-28666117 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1136197730 16:28666144-28666166 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1136214045 16:28780232-28780254 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1136214068 16:28780281-28780303 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1136258781 16:29060156-29060178 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1136258804 16:29060205-29060227 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1136392535 16:29974477-29974499 CACCCCCTCCCCTCCAGGGGAGG + Exonic
1136608847 16:31354267-31354289 CACCCACTGCACTCCAGCCTGGG + Intergenic
1136918913 16:34245736-34245758 CCCCCACTTCCCTCCCGGATGGG + Intergenic
1137290306 16:47047984-47048006 CCCCCAGTGGCCTCCTGAGTGGG - Intergenic
1138112855 16:54338401-54338423 CACCCACTGCACTCCAGCCTGGG - Intergenic
1138194266 16:55040857-55040879 CTCCCGCTGCCCTCCTTGGAAGG + Intergenic
1138492897 16:57386930-57386952 CACCCACTGCACTCCAGCTTGGG - Intergenic
1138642594 16:58397070-58397092 CCCCCACCTCCCTCCTGGATGGG + Intronic
1139378862 16:66517694-66517716 CACCCACTGCCCCCAAGGGTTGG + Intronic
1139482022 16:67236026-67236048 CCCCCAGTCCCCTCCTGGGCAGG - Intronic
1139639245 16:68278987-68279009 CCCCCACCTCCCTCCTGGATGGG + Intronic
1139677666 16:68536184-68536206 AAACCTCTGCTCTCCTGGGTAGG + Intronic
1139683435 16:68582977-68582999 TACTCAGTCCCCTCCTGGGTCGG - Intergenic
1139976467 16:70815362-70815384 CACCCACTGCACTCCAGCCTGGG + Intronic
1141065229 16:80908699-80908721 GAGCCACTGCACTCCTGGGCAGG + Intergenic
1141619741 16:85230744-85230766 AACTCACAGTCCTCCTGGGTTGG + Intergenic
1141627443 16:85268738-85268760 CACCCTCTGCCTTCCTCGGGGGG + Intergenic
1142017008 16:87754729-87754751 CTGACACTGCTCTCCTGGGTAGG + Intronic
1142027507 16:87822495-87822517 CGTCCACTGCCCTCTTGGGACGG - Intergenic
1142171654 16:88625596-88625618 CAGCCTCTGCCCTGCTGGGCTGG - Intronic
1142249206 16:88983391-88983413 CACCCACTACCCGCCTGGGGTGG - Intergenic
1142314400 16:89334532-89334554 TGCCCACTGCCCACATGGGTGGG - Intronic
1142363993 16:89640212-89640234 CCCCCAGGGCCCTCCAGGGTGGG - Intergenic
1142705150 17:1689645-1689667 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1142825437 17:2507309-2507331 CCCCCACCTCCCTCCTGGATGGG - Intronic
1143377045 17:6472992-6473014 CTGTCACTGCGCTCCTGGGTGGG - Intronic
1144312477 17:14025486-14025508 CACCCACTGCCCGCCTGTTAAGG - Intergenic
1144332275 17:14235839-14235861 CACCCACTGCCCGCCTGTTAAGG + Exonic
1144643655 17:16953809-16953831 CACCCACTGCACTCCAGCCTGGG - Intronic
1144737617 17:17563872-17563894 GAGCCAGTGCCCTCCTGGGGAGG - Intronic
1145078558 17:19875493-19875515 CACTCACTGCCCTCCGGCCTGGG - Intergenic
1146208688 17:30925226-30925248 CACTCACTGCACTCCAGGCTGGG - Intronic
1146444367 17:32922710-32922732 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1147215849 17:38898629-38898651 CTACCCCTGCCCTCCAGGGTGGG + Intronic
1147833492 17:43313925-43313947 CACCCACTGCACTCCAGCCTGGG - Intergenic
1147852268 17:43452149-43452171 CCCCCACTTCCCTCCTGGACGGG - Intergenic
1148344908 17:46896811-46896833 CACACACTCCCCTCCTGCTTGGG - Intergenic
1148446851 17:47743101-47743123 CATCCAGTGCGCTCCTGTGTTGG - Exonic
1148474200 17:47916382-47916404 CACCAGCTGCCCTCCAGGATAGG - Exonic
1148833700 17:50453831-50453853 CACCCACTGCACTCCAGCCTGGG - Intronic
1150176766 17:63065931-63065953 CACCCACTGCACTCCAGTCTGGG - Intronic
1150285848 17:63953637-63953659 CACCCACTGCACTCCAGCCTGGG + Intronic
1150470202 17:65430811-65430833 CACCCTCTGCCATCCAGGCTTGG - Intergenic
1150923271 17:69505629-69505651 CACTCACAGACTTCCTGGGTAGG + Intronic
1151247662 17:72807548-72807570 CACCCACTGACCTCCTAGAGGGG + Intronic
1151552885 17:74832096-74832118 CCCCCACTGCCCACCTGGCGAGG - Intronic
1151641692 17:75400037-75400059 CACCCACTGCACTCCAGACTGGG - Intronic
1151762819 17:76116228-76116250 CCCCCACTGCACTCCTGCCTGGG - Intronic
1151964498 17:77424435-77424457 CCTCCACGGCCCACCTGGGTGGG + Intronic
1152469625 17:80483441-80483463 TACCCACTGCCTCCCTGGATGGG - Intergenic
1152747831 17:82049412-82049434 CACCCACTGCCCAGCTGGCATGG + Intronic
1153605478 18:6827647-6827669 CCCCCACCTCCCTCCTGGATGGG + Intronic
1153845529 18:9046075-9046097 CTCCCACTGCCCTCCAGTATGGG + Intergenic
1154134613 18:11764730-11764752 CAGCCACTGCACTCCTGCCTGGG + Intronic
1154166812 18:12021559-12021581 CAGCCACTGCACTCCAGGCTGGG - Intronic
1154289906 18:13098278-13098300 CCCCCACCTCCCTCCTGGATGGG + Intronic
1155828041 18:30473710-30473732 CCGCCACTGCACTCCAGGGTGGG + Intergenic
1157757314 18:50230329-50230351 CACCCACTGACCTCTTGGGAGGG + Intronic
1157932806 18:51841866-51841888 CACCCACTGCACTCCAGTCTGGG - Intergenic
1158218157 18:55122010-55122032 CAACCTCTGCCTTCCTGGGTGGG + Intergenic
1158890645 18:61868657-61868679 CACCCATTGCACTCCTGCCTGGG + Intronic
1159423400 18:68252280-68252302 CCACCACTGCCCTCCTGTCTGGG - Intergenic
1159614866 18:70569648-70569670 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1160711743 19:555018-555040 CACTCACTGCCCTCGAGGGATGG + Intergenic
1160717846 19:584492-584514 CAGCAACTGCCCTGCTAGGTGGG + Intergenic
1160727196 19:622549-622571 CACCCCCTCTCCTCCTGGCTGGG - Intronic
1160872399 19:1283241-1283263 CACCCACTGCCCACATGGCCAGG - Intergenic
1160894628 19:1396720-1396742 CAGCCACGCCCCTCCTGGGGCGG + Intergenic
1161273829 19:3404603-3404625 CCGGCCCTGCCCTCCTGGGTGGG - Intronic
1161758184 19:6150054-6150076 CACCCACTGCACTCCAGCCTGGG + Intronic
1161790214 19:6355558-6355580 CCCCCACCTCCCTCCCGGGTGGG - Intergenic
1161912674 19:7206207-7206229 CACCCACTGCACTCCAGCCTGGG - Intronic
1162604603 19:11697107-11697129 CACTCACTGCCCTCCAGCCTTGG - Intergenic
1162760983 19:12887920-12887942 GACCCTCTCTCCTCCTGGGTGGG + Intergenic
1163221177 19:15922298-15922320 CACCCACTACGTTCCTGGGATGG + Intronic
1163231117 19:16002997-16003019 CACCCCCAGCCCTTCTGGGTTGG + Intergenic
1163277572 19:16295035-16295057 CACCAACTGCACTCCTGCTTGGG + Intergenic
1163511335 19:17736989-17737011 CACCCACTGCACTCCAGCCTGGG - Intergenic
1163657438 19:18555386-18555408 CACCCACTGCACTCCAGCCTGGG - Intergenic
1163886251 19:19967247-19967269 CACTCACTGCCCCCCTTGGCTGG + Intergenic
1163904315 19:20137970-20137992 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1163945482 19:20530412-20530434 CCCCCACCTCCCTCCTGGGCGGG + Intergenic
1163962013 19:20705384-20705406 ACACCACTGCCCTCCAGGGTGGG + Intronic
1164066637 19:21721621-21721643 CCCCCACCTCCCTCCTGGGCGGG - Intergenic
1164107507 19:22121826-22121848 CACCCACTGCACTCCAGCCTGGG - Intergenic
1164168068 19:22700425-22700447 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1165015715 19:32878572-32878594 CACCCACTGCTCTGGTGAGTAGG - Intergenic
1165121615 19:33562667-33562689 CTCACAACGCCCTCCTGGGTAGG - Intergenic
1165581876 19:36872412-36872434 CACCCACTGCCCCCCAGGGAGGG - Intronic
1165821273 19:38677782-38677804 CACCCACTGCACTCCAGCCTGGG - Intronic
1165910549 19:39223738-39223760 CACCCACTGCACTCCAGCCTGGG + Intergenic
1166159879 19:40944534-40944556 CCCCCACATCCCTCCTGTGTGGG + Intergenic
1167108696 19:47446469-47446491 CACCCACTGCACTCCAGCCTGGG - Intronic
925050163 2:807260-807282 CACCTATGCCCCTCCTGGGTGGG + Intergenic
926697424 2:15780459-15780481 GGCCCACTGAGCTCCTGGGTGGG + Intergenic
927128240 2:20033528-20033550 CACCCACTGCCTGCCTGTCTAGG - Intronic
927776903 2:25910450-25910472 CCCCCACCTCCCTCCTGGATGGG + Intergenic
928217569 2:29375001-29375023 CACACACTGCCAACCTGGGGAGG - Intronic
928518908 2:32068850-32068872 CACCCATTGCACTCCTGCCTGGG + Intronic
929516035 2:42605720-42605742 CCCCCACCTCCCTCCTGGATGGG + Intronic
929707334 2:44227558-44227580 CACCCACTGCACTCCAGCCTAGG - Intronic
930130752 2:47847659-47847681 CACCCACTGCACTCCAGCCTGGG + Intronic
931699653 2:64899322-64899344 CACCCACAGCCCACCTTTGTCGG - Intergenic
932128989 2:69170298-69170320 CACCCACTGCCATCCTGCTGTGG - Intronic
932258766 2:70309419-70309441 CACCCACTGCACTCCAGCCTGGG - Intergenic
932610249 2:73193660-73193682 CACCCACTGCACTCCAGCCTGGG + Intergenic
932710656 2:74061249-74061271 CCCCCACTTCCCTCCCGGATGGG + Intronic
932770975 2:74500660-74500682 CACCCACAGCCCTCCTTTGTAGG + Intronic
933237659 2:79882913-79882935 CACTCACTGCCTTCCTTGGCTGG + Intronic
933598365 2:84305213-84305235 CACCCCCTGACCTCCAGGGAGGG + Intergenic
933734991 2:85487884-85487906 CCCCCACCTCCCTCCTGGATGGG - Intergenic
933815458 2:86064795-86064817 CAGCCACTGCACTCCTGCCTGGG - Intronic
934145369 2:89088442-89088464 CACCCACTGCACTCCTGCCTGGG - Intergenic
934223887 2:90112109-90112131 CACCCACTGCACTCCTGCCTGGG + Intergenic
934632477 2:95943439-95943461 CGCCCACTGCCCTCCAGCCTGGG + Intronic
934675061 2:96243961-96243983 GAGCCACTGCCCTCCAGGCTGGG - Intergenic
934801025 2:97159823-97159845 CGCCCACTGCCCTCCAGCCTGGG - Intronic
934946947 2:98549253-98549275 CACCCAGGGGCTTCCTGGGTCGG - Intronic
935671215 2:105558754-105558776 CACCCACTGCACTCCAGCCTGGG - Intergenic
936095590 2:109528438-109528460 CATGCCCTGCCCTCCTGGGAAGG + Intergenic
937245482 2:120489615-120489637 AACCCACTGCCATCTCGGGTGGG + Intergenic
937450066 2:121994466-121994488 AACCCAGTGACATCCTGGGTGGG - Intergenic
937454608 2:122030593-122030615 CTCCCACTGCCCTCCCTGGAGGG + Intergenic
937556587 2:123165541-123165563 CACCCACTGCACTCCAGCCTGGG - Intergenic
938115860 2:128602648-128602670 AGGCCCCTGCCCTCCTGGGTGGG + Intergenic
938828849 2:135033377-135033399 CCCCCACTGCCCTCCCGGACGGG + Intronic
940286305 2:152036340-152036362 CTGCCACTGCCCTCCTGCCTGGG - Intronic
940406271 2:153305951-153305973 CAACGTTTGCCCTCCTGGGTGGG - Intergenic
940792377 2:158042745-158042767 CACCCAGTGTCCTCCTTGGGAGG - Intronic
941233553 2:162941236-162941258 CACCCACTGCACTCCAGCCTGGG + Intergenic
943739949 2:191398299-191398321 CCCCCACCTCCCTCCTGGGCTGG + Intronic
944568113 2:201012415-201012437 CACCCACTGCACTCCAGCATGGG + Intronic
944598555 2:201283100-201283122 CCCCCACCTCCCTCCTGGGCGGG + Intronic
945151306 2:206795191-206795213 CAGCCACTGCCCTCCTGGCCAGG - Intergenic
945262572 2:207858518-207858540 CACTCACTGCACTCCAGGCTGGG - Intronic
945970317 2:216226453-216226475 CCCCCACCTCCCTCCTGGGCGGG + Intergenic
946165976 2:217864029-217864051 TGCCCACTGCCTTCCTGGGATGG - Intronic
946431364 2:219628657-219628679 CACCCAGTGCCATCCTGTGCCGG + Intronic
946542313 2:220698094-220698116 CACCCACTTCCCTCCAATGTTGG - Intergenic
947793251 2:232879464-232879486 CTCCCGCTGGCCCCCTGGGTGGG + Exonic
948239818 2:236420765-236420787 CAGCCACTGCCCTCCAGCCTGGG + Intronic
948669562 2:239559344-239559366 CTCCCACTGCCCTCCTAGGCAGG + Intergenic
948706384 2:239795881-239795903 CCCCCACCTCCCTCCTGGATGGG - Intronic
948982409 2:241501117-241501139 CACCCATCACCCTCCTGGGCAGG + Intronic
948997946 2:241593516-241593538 CAGCCTCGGCCTTCCTGGGTCGG - Intronic
1169085863 20:2824347-2824369 CCCCCACCTCCCTCCTGGGCGGG - Intergenic
1169142728 20:3235388-3235410 CCCCACCTGCCCTCCTGGGGAGG - Intronic
1170406646 20:16044916-16044938 CACCCCCTGGCCTCCTGGAGTGG + Intronic
1170540117 20:17379193-17379215 CCACTACTCCCCTCCTGGGTGGG - Intronic
1170569034 20:17622575-17622597 CACCCTGTGCCATGCTGGGTCGG + Intronic
1170573360 20:17645153-17645175 CCCCTACTGCACTGCTGGGTGGG + Intronic
1171571075 20:26251985-26252007 CTCCAACTGTCCTCCTGCGTTGG + Intergenic
1172160519 20:32864933-32864955 CAACCACAGCCCTGCAGGGTAGG + Intronic
1172721027 20:37000399-37000421 CCCCCACCTCCCTCCTGGATGGG - Intronic
1173769580 20:45645959-45645981 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1173900212 20:46582163-46582185 CACCCACTGCACTCCAGCCTGGG - Intronic
1174177757 20:48655857-48655879 CACCCATTGCCCTCCCTGGCAGG - Intronic
1174214525 20:48905917-48905939 CACCCACTGCACTCCAGCTTGGG - Intergenic
1174909633 20:54593212-54593234 CACCCACTGCACTCCAGCCTGGG + Intronic
1175264812 20:57696132-57696154 CACACACTTCCCTCCTTGGAAGG - Intronic
1175846717 20:62063664-62063686 CTCCCACTGCCCTCCCGAGGGGG + Intronic
1175986940 20:62768690-62768712 CCGGCACTGTCCTCCTGGGTGGG - Intergenic
1176199660 20:63854651-63854673 GTCCCACTGCCTTCCTGGGTTGG + Intergenic
1176263878 20:64198457-64198479 CACCCACTGCTCACCTGGTCAGG - Intronic
1176348257 21:5770588-5770610 CCCCCACTTCCCTCCCGGATGGG + Intergenic
1176355071 21:5891172-5891194 CCCCCACTTCCCTCCCGGATGGG + Intergenic
1176416269 21:6476762-6476784 CACCCACTGCACTCCAGCCTGGG + Intergenic
1176496570 21:7553867-7553889 CCCCCACTTCCCTCCCGGATGGG - Intergenic
1176542578 21:8168658-8168680 CCCCCACTTCCCTCCCGGATGGG + Intergenic
1176561529 21:8351703-8351725 CCCCCACTTCCCTCCCGGATGGG + Intergenic
1177028691 21:15954629-15954651 CACCCACCACCTCCCTGGGTGGG + Intergenic
1177998925 21:28135898-28135920 CAACCACTGCCCTCCAGCCTGGG + Intergenic
1178034421 21:28564101-28564123 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1178366234 21:31991258-31991280 CACCCACTGCACTCCAGCCTGGG - Intronic
1178434032 21:32541508-32541530 CACCCACTGCACTCCAGCCTGGG + Intergenic
1179566287 21:42251116-42251138 ATCCCACTTCCCTCCTGGGTAGG - Intronic
1179691769 21:43085097-43085119 CACCCACTGCACTCCAGCCTGGG + Intergenic
1180184249 21:46131649-46131671 CACAGGCTGCCCTCCTGGGAGGG - Intronic
1180243737 21:46531258-46531280 CACTCACGGCTCTCCTGAGTGGG + Intronic
1180872254 22:19152924-19152946 CACCCACTGCACTCCAGCCTGGG - Intergenic
1182576837 22:31278580-31278602 CGCCCACTTGCCTCCTGGGGAGG - Intronic
1183711588 22:39507285-39507307 CACCCACTGCACTCCAGCCTGGG - Intronic
1183743177 22:39679437-39679459 CAGCCCCTGCCCACCTGGGCAGG - Exonic
1183871578 22:40745239-40745261 CCCCCACCTCCCTCCTGGGCGGG + Intergenic
1183888388 22:40904504-40904526 TAGCCACTGCCCTCCAGTGTGGG + Intronic
1184180946 22:42825210-42825232 CACCCACTGCACTCCAGCATGGG + Intronic
1184202819 22:42981757-42981779 CACCCACCTCCCTCCTGGACGGG - Intronic
1184609085 22:45590950-45590972 CACCCACCTACCTGCTGGGTGGG - Intronic
1184652440 22:45925403-45925425 CACCCTCTGCCATCCTGGGAGGG - Intronic
1185191111 22:49436990-49437012 CACCCACTGCCTTCCTGTGGAGG - Intronic
1185388339 22:50546716-50546738 CAGGCACTGCCCTCCTGGGCAGG + Intergenic
949502267 3:4692097-4692119 CACCCACTGCACTCCAGCCTGGG + Intronic
950266458 3:11576810-11576832 CACCCTCTGCCTTCCTGAGGCGG - Intronic
950492347 3:13313742-13313764 CTTCTTCTGCCCTCCTGGGTAGG - Intergenic
951366422 3:21788434-21788456 CACCCACTGCACTCCAGCCTGGG + Intronic
952360744 3:32627827-32627849 CACCCCCTGACCTCCTTGGACGG - Intergenic
952635318 3:35522354-35522376 CCCCAACTGCCCTTCTGAGTGGG + Intergenic
952756000 3:36867528-36867550 CACCCACAGCCCTCCTGCCAAGG - Intronic
953166277 3:40467857-40467879 CACCCACTGCACTCCAGCCTGGG - Intergenic
953496315 3:43390286-43390308 TCCCCACTGCCCTTCTGGCTGGG + Intronic
953618591 3:44513252-44513274 CACTCACTGCACTCCTGCCTGGG - Intergenic
953651981 3:44814349-44814371 CACCCACTGCACTCCAGCCTGGG - Intronic
954694258 3:52412157-52412179 CACCCACTGCACTCCAGCCTGGG + Intronic
954967521 3:54624578-54624600 CACCCACTGCACTCCAGCCTGGG + Intronic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
956422711 3:69101363-69101385 CCCCCACTGCACTCCTGGCTGGG - Intronic
957646759 3:82939918-82939940 GCCCCACTGCCCACCTGGGCGGG - Intergenic
958016643 3:87945649-87945671 AACCCCCAGCCCTTCTGGGTTGG - Intergenic
958406242 3:93761241-93761263 CACCCACTTCCCTGATGGGGTGG + Intergenic
958406602 3:93762482-93762504 CACCCACTTCCCTGATGGGGTGG + Intergenic
959062220 3:101626005-101626027 CACCCCCTGACCTCCTGGGGAGG - Intergenic
959415678 3:106074805-106074827 CCCCCACCTCCCTCCTGGATGGG + Intergenic
960526675 3:118718531-118718553 CCCCCACCTCCCTCCTGGATGGG + Intergenic
960841301 3:121962421-121962443 CACTCACTGCTTTCCTGAGTTGG - Intergenic
961141489 3:124560136-124560158 GACCCACTTCCCTCTAGGGTGGG - Intronic
961393678 3:126571340-126571362 CAGCCTCTGCCCACCTGGGGTGG + Intergenic
961489201 3:127240824-127240846 CACCCCCCAACCTCCTGGGTGGG - Intergenic
961645076 3:128388555-128388577 CACCCACTGCTCTCCAGTGAGGG + Intronic
962251420 3:133838328-133838350 CTCCCTCTGCCCTGCTGGGTGGG - Intronic
962572198 3:136723543-136723565 CCCCCACTTCCCTCCCGGATGGG - Intronic
963056847 3:141193221-141193243 CACCCACTGCTTCCCTGGGCAGG - Intergenic
963244417 3:143047004-143047026 CCCCCACCTCCCTCCTGGATGGG + Intronic
963492286 3:146016832-146016854 CACCCACTGCCATTCCGGATCGG + Intergenic
963493028 3:146025076-146025098 CACCCACTGCACTCCAGCCTGGG - Intergenic
963859579 3:150294773-150294795 CACCCACTGCACTCCAGCCTGGG + Intergenic
964310278 3:155384991-155385013 CACCCTCTGCTCTCCTCAGTGGG - Intronic
964328789 3:155577215-155577237 CACCCACTGCACTCCAGCCTGGG + Intronic
965905559 3:173701084-173701106 CACCCACTGCACTCCAGCCTGGG + Intronic
966288274 3:178323701-178323723 CACCCACTGCACTCCAGCTTGGG - Intergenic
966801597 3:183769026-183769048 CACCCCCGGCTCTCCTGGTTTGG - Intronic
967023778 3:185546121-185546143 CAGCCACTGCACTCCAGGCTGGG + Intronic
968289956 3:197531352-197531374 CACCCACTGCACTCCAGCCTGGG + Intronic
968456621 4:703815-703837 TTCCCACTACTCTCCTGGGTGGG - Intergenic
968462226 4:731699-731721 CTCCCCCTCCCCTCGTGGGTGGG + Intronic
968462307 4:731896-731918 CTCCCCCTCCCCTCGTGGGTGGG + Intronic
968462328 4:731946-731968 CTCCCCCTCCCCTCGTGGGTGGG + Intronic
968578295 4:1378015-1378037 CAGCCCCTGCCATCCTGGCTAGG - Intronic
968745159 4:2356192-2356214 CATCCACTGCCCCCCTGCCTGGG + Intronic
968777436 4:2552052-2552074 CAGCCACTGCACTCCAGGCTGGG - Intronic
968902964 4:3439791-3439813 CACCCCCTGCCCTCCTGGCTGGG - Exonic
968925983 4:3548740-3548762 CACCCACATCCCTGCTGGGCAGG - Intergenic
968946376 4:3666774-3666796 AACCCACACCCATCCTGGGTTGG + Intergenic
968956890 4:3724093-3724115 CACCCACGGCCCCCGAGGGTGGG + Intergenic
969061891 4:4442572-4442594 CACCCACTGCACTCCAGCCTGGG + Intronic
969456367 4:7302020-7302042 CACCCACTGCCCAACCAGGTGGG - Intronic
971559345 4:28055849-28055871 CACCCACTGCACTCCAGCCTGGG + Intergenic
972318347 4:37948583-37948605 CACCCACTGCACTCCAGCCTGGG + Intronic
972981562 4:44709932-44709954 CACACACTGCACTCCTGTCTGGG + Intronic
973109273 4:46377967-46377989 CCCCCACCTCCCTCCTGGATGGG - Intronic
973127668 4:46607969-46607991 CACAAACTCCCCTCCTAGGTAGG - Intergenic
973910249 4:55572801-55572823 CACCCACTGCACTCCGGCCTGGG - Intronic
974199607 4:58622143-58622165 CACTCACTGCCTCTCTGGGTTGG - Intergenic
974942088 4:68481895-68481917 CACCCACTGCACTCCAGCTTGGG + Intronic
975042524 4:69762297-69762319 CCCCCACCTCCCTCCTGGATGGG - Intronic
975063857 4:70037806-70037828 CCCCCACCTCCCTCCTGGATGGG - Intergenic
975596788 4:76054788-76054810 CATCCACTGCACTCCAGGCTAGG + Intronic
975600998 4:76099258-76099280 CACCCACTGCACTCCAGCCTGGG + Intronic
976243262 4:82981982-82982004 CACCCACTGCACTCCAGACTGGG + Intronic
977037445 4:91973044-91973066 CACCCACTGCACTCCAGCCTGGG + Intergenic
977834271 4:101630771-101630793 CACCCACTGCACTCCAGCCTGGG - Intronic
980018847 4:127683706-127683728 CCCACACTGTCCTCCTGGTTAGG - Intronic
980966944 4:139531086-139531108 CACCCATTTCTCTACTGGGTAGG + Intronic
982213438 4:153059679-153059701 CACTGACTGCCCTCCAGGGAGGG + Intergenic
982251686 4:153413637-153413659 CACTCACTGCCCTCCAGCCTGGG + Intronic
982850557 4:160309769-160309791 CCGCCACTGCACTCCTGGCTGGG + Intergenic
984583927 4:181541340-181541362 CTCCCACTGCCCTCCAGCCTAGG + Intergenic
985138538 4:186813888-186813910 CACCCACTGCACTCCAGCCTGGG + Intergenic
985551599 5:535950-535972 CACCCGCAGCCCACCTGGGCAGG + Intergenic
985674107 5:1221512-1221534 CACCCACCTCCCTCCTGGGATGG - Intronic
986072286 5:4296952-4296974 CACCCTCTGTCCTCCATGGTCGG - Intergenic
986630094 5:9763459-9763481 CACCCACTGCACTCCAGCTTGGG + Intergenic
987342406 5:16950510-16950532 CACCCACTGCACTCCAGCCTGGG + Intergenic
987597594 5:20021089-20021111 TAACGACTGCCCTACTGGGTTGG + Intronic
988137396 5:27191838-27191860 CCCCCACTGCCCTCCAGCCTGGG + Intergenic
989172438 5:38486053-38486075 CACCAACTGCCCTTCTAAGTGGG + Intronic
989527364 5:42468608-42468630 AACCCGCTGCCCTCCAGCGTTGG - Intronic
991135463 5:63176868-63176890 CACTCACTGCTTCCCTGGGTAGG + Intergenic
991722634 5:69508075-69508097 CACCCACTGCACTCCAGCCTGGG - Intronic
992450460 5:76871563-76871585 ATGCCACTGCCCTCCAGGGTGGG - Intronic
992901674 5:81302426-81302448 CGCCCACTGCACTCCAGGTTGGG + Exonic
992918800 5:81489984-81490006 CAGCCACTGCACTCCAGGCTGGG + Intronic
995120967 5:108534869-108534891 CCACCACTGCACTCCAGGGTGGG - Intergenic
995236154 5:109832727-109832749 CCCCCACTTCCCTCCCGGATGGG + Intronic
995594450 5:113733084-113733106 CACACACTGCCCTCCAGCCTGGG - Intergenic
995994511 5:118282849-118282871 CCCCCACCTCCCTCCTGGATGGG - Intergenic
996873535 5:128217154-128217176 TTCCCACTCCCCTGCTGGGTAGG + Intergenic
997096857 5:130923493-130923515 CACTCACTGCCTCCCTTGGTTGG - Intergenic
997874689 5:137537631-137537653 CCCCCACCTCCCTCCTGGATGGG + Intronic
997960305 5:138316013-138316035 GAAGCCCTGCCCTCCTGGGTGGG + Intronic
997963983 5:138343466-138343488 CACCCACTGCACTCCAGCTTGGG + Intronic
998328689 5:141304461-141304483 CGCACACTGCACTCCAGGGTGGG + Intergenic
999239287 5:150118220-150118242 CCCCCACTGCCCCCCGGGGATGG - Intronic
999308005 5:150533101-150533123 CACCCGCTGCCCTCATGGATGGG - Intronic
999454765 5:151706016-151706038 CACCCACTGCACTCCAGCCTGGG + Intergenic
999771738 5:154781024-154781046 CACCCACTGCACTCCAGCCTAGG + Intronic
999787601 5:154906036-154906058 CACCCACTGCACTCCAGCCTGGG - Intronic
1000749443 5:165075296-165075318 CACTCACTGCCTCCCTGGGCTGG + Intergenic
1001044676 5:168362802-168362824 TTCCCTCTGCCCTGCTGGGTTGG - Intronic
1001628436 5:173156543-173156565 AGCCCACTGCCCTCCTGCCTTGG - Intronic
1001954724 5:175841306-175841328 CACAAACTGCCCTTCTGTGTGGG - Intronic
1002375458 5:178785677-178785699 CACCCACTGCACTCCAGCCTGGG + Intergenic
1005297618 6:24442162-24442184 CACCCACTGCACTCCAGCCTGGG - Intronic
1005343895 6:24870546-24870568 CACCCACTGCACTCCAGCCTGGG - Intronic
1005632831 6:27724865-27724887 CACTCACTGCCCTCCAGCCTGGG - Intergenic
1005929861 6:30475340-30475362 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1005958036 6:30678246-30678268 CACCCACTGCACTCCAGCCTGGG - Intronic
1006411241 6:33875097-33875119 ACCCCACTGGCCTCCAGGGTGGG - Intergenic
1007215484 6:40234408-40234430 CACTCACTGCTTCCCTGGGTAGG - Intergenic
1007227392 6:40324772-40324794 TAGCTGCTGCCCTCCTGGGTGGG - Intergenic
1007368177 6:41408977-41408999 CACCCTCAGCCCTCCCGGGAAGG + Intergenic
1007379964 6:41482923-41482945 CACCCACTGAACTCCTGTGATGG - Intergenic
1007448746 6:41927049-41927071 CAGCCACTGCACTCCAGTGTGGG + Intronic
1007735716 6:43981163-43981185 AACCCTCTGCCCTCCAAGGTGGG + Intergenic
1008345653 6:50423286-50423308 CACCCACTGCACTCCAGCCTGGG + Intergenic
1008552590 6:52647162-52647184 CACACACTTAGCTCCTGGGTTGG - Intergenic
1008926472 6:56894861-56894883 CCCCCACCTCCCTCCTGGGCGGG + Intronic
1008975725 6:57423927-57423949 TACCCACTGCACTCCTGTGCAGG - Intronic
1009994651 6:70884743-70884765 CACACACTGCCCTCCAGCCTAGG - Intronic
1010162024 6:72867889-72867911 CAGCCACTGCACTCCAGGCTGGG + Intronic
1011291405 6:85781146-85781168 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1011474167 6:87735971-87735993 CCCCCACCTCCCTCCCGGGTGGG + Intergenic
1012113334 6:95262564-95262586 TTCCCACTCCCCTCCTGGCTTGG - Intergenic
1012860753 6:104556441-104556463 CACTCACTAGCCTCCAGGGTGGG + Intergenic
1013479681 6:110543147-110543169 CAACCTCTGCTCTCCTGGGGGGG + Intergenic
1014463746 6:121730085-121730107 CACCCACTGCACTCCAGCGTGGG + Intergenic
1014764041 6:125388850-125388872 CCCCCACCTCCCTCCTGGGCGGG + Intergenic
1014865352 6:126521980-126522002 CAGCCAATGCCCTCCTAGGGAGG - Intergenic
1015150282 6:130029860-130029882 CACCCACTGCACTCCAGCCTGGG - Intronic
1015488763 6:133801001-133801023 CACTCACTGCTTCCCTGGGTAGG + Intergenic
1016130464 6:140461976-140461998 CACCCACTGCACTCCAGCCTAGG + Intergenic
1016165302 6:140935105-140935127 CACCCACTGCACTCCAGCCTGGG - Intergenic
1016741923 6:147537711-147537733 CACTCACTGCCCTCCAGCCTGGG + Intronic
1017745752 6:157445561-157445583 CCCCCTCTGCCCCCTTGGGTTGG + Intronic
1018522325 6:164664090-164664112 CACCCACTGCACTCCAGCTTTGG - Intergenic
1019408013 7:893994-894016 CACCCACTCCAGCCCTGGGTCGG + Intronic
1019430509 7:996882-996904 CCCCCAATGCCATCCTGGGGTGG + Intergenic
1019978197 7:4601309-4601331 CACCCACTGCACTCCAGCCTGGG + Intergenic
1019996832 7:4729945-4729967 CAGCCACTGCCCTCCAGCCTGGG + Intronic
1020140525 7:5609078-5609100 CACCCACTGCACTCCAGCCTGGG + Intergenic
1020248388 7:6448251-6448273 CACCCACTGCACTCCAGCCTGGG - Intronic
1020284801 7:6671358-6671380 CCCCCACCTCCCTCCTGGGCGGG + Intergenic
1020325881 7:6975044-6975066 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1020341509 7:7116115-7116137 AACGCCCTGCTCTCCTGGGTTGG + Intergenic
1022030597 7:26488446-26488468 CCCCTCCTGCTCTCCTGGGTGGG + Intergenic
1022076295 7:26974147-26974169 CACTCACTGCTTTCCTGGGTGGG + Intronic
1022413131 7:30154780-30154802 CACTCACTGCCCTTCTGGAAAGG - Intronic
1023123056 7:36928734-36928756 CTCCCACAGCCCTGGTGGGTGGG - Intronic
1023179361 7:37466013-37466035 CACCCACTGCACTCCAGCCTGGG + Intergenic
1024141967 7:46470749-46470771 CCCCCACTGCCCTCAGGTGTTGG - Intergenic
1024538780 7:50459912-50459934 CCCCCACCTCCCTCCTGGATGGG - Intronic
1024934302 7:54697765-54697787 CACCCACTGCCTCGCGGGGTCGG + Intergenic
1025019951 7:55472993-55473015 CATCCCCGGTCCTCCTGGGTCGG + Exonic
1025158695 7:56634549-56634571 CACTCACTGCCTTACTGGGTGGG - Intergenic
1025716419 7:63961492-63961514 CCCCCACTGCACTCCAGGCTGGG + Intergenic
1025727918 7:64083705-64083727 CACTCACTGCTTTACTGGGTGGG + Intronic
1025757006 7:64353216-64353238 CACTCACTGCTTTACTGGGTGGG + Exonic
1025803469 7:64809220-64809242 CCCCCACCTCCCTCCCGGGTGGG + Intronic
1026890778 7:73980709-73980731 CACCCACTGCACTCCAGCTTGGG + Intergenic
1027206453 7:76103727-76103749 CACCCACTGCACTCCAGCCTGGG + Intergenic
1029093432 7:98066676-98066698 CACCCACTGCACTCCAGCCTAGG - Intergenic
1029606318 7:101601457-101601479 CACCCAATGCCCTGATGGGCTGG + Intergenic
1029713464 7:102312723-102312745 GCCCCACTGCCCTCCTGCTTGGG - Intronic
1030088307 7:105836125-105836147 CTCCCCCAGCCCTCCTGGTTTGG - Intronic
1030838833 7:114322062-114322084 CACCCACTGCACTCCAGCCTGGG - Intronic
1031949478 7:127877461-127877483 CAAATACTGCCTTCCTGGGTAGG + Intronic
1032313248 7:130808658-130808680 CACCCACTGCACTCCAGCCTGGG - Intergenic
1032500809 7:132398437-132398459 CACCCAGGGCCCTCCTGGCTTGG - Intronic
1033124715 7:138697567-138697589 CACCCACTGCACTCCAGCCTGGG + Intronic
1033144995 7:138863700-138863722 CAGCGACTGCCCTCGTGGGATGG + Intronic
1033880406 7:145874830-145874852 CACCCACTGGCCTCCTTGGGAGG + Intergenic
1035264778 7:157684841-157684863 CGCCCTGTGCCCTCCTGGGCCGG + Intronic
1035946760 8:3971948-3971970 CACCCACTGCACTCCAGCCTGGG - Intronic
1036205084 8:6799674-6799696 CACCCACTGCACTCCAGCCTGGG - Intergenic
1036618400 8:10405994-10406016 CACCATCTGTCCTCCAGGGTAGG + Intronic
1037504551 8:19516973-19516995 GACCCACTGCCCACCTGGAGAGG + Intronic
1037813024 8:22097893-22097915 CCCCCTCTGCCCTCCTGAGGAGG + Intronic
1037862879 8:22418573-22418595 CACACACTGCACTCCAGGCTAGG - Intronic
1038450252 8:27634733-27634755 CACCCTCTGACCTCCTTGGGAGG + Intronic
1039499408 8:38004796-38004818 GCCCCACTGCACTCCTGGCTGGG + Intergenic
1039519721 8:38160063-38160085 CACCCACTATGCTCCTGAGTAGG + Intergenic
1039746411 8:40431813-40431835 CACCCACTGCACTCCAGCCTGGG + Intergenic
1040298472 8:46175637-46175659 CACCCAGTGCTGTCCTGGGTGGG + Intergenic
1040324995 8:46337175-46337197 CCCCCACGGCTCTCCTGGGCAGG + Intergenic
1040337674 8:46424313-46424335 CACCCAGGGCTGTCCTGGGTGGG + Intergenic
1040372453 8:46789945-46789967 CACTCACTGCTTTACTGGGTGGG + Intergenic
1040380432 8:46867092-46867114 CACTCACTGCTTTACTGGGTGGG - Intergenic
1041255636 8:55977875-55977897 CACCCACCGCCCTCCAGCCTAGG + Intronic
1041676753 8:60547533-60547555 CCCCCACCTCCCTCCTGGATGGG + Intronic
1042269091 8:66937676-66937698 CACCCACTGCACTCCAGCCTGGG + Intergenic
1042582173 8:70292030-70292052 CACCCACTGCACTCCAGCCTGGG + Intronic
1043223007 8:77689978-77690000 CACCCATTGCCCTCCAGCTTGGG + Intergenic
1043418196 8:80073058-80073080 CACCCACTGCACTCCAGCCTGGG + Intronic
1043447523 8:80333592-80333614 CACCCACTGCACTCCAGCCTGGG - Intergenic
1043985911 8:86694231-86694253 CCCCCACCTCCCTCCTGGATGGG + Intronic
1044588349 8:93889079-93889101 CACACACTGCACTCCAGCGTGGG + Intronic
1044748863 8:95397354-95397376 CCGCCACTGCCCTGCTGGCTTGG + Intergenic
1045777826 8:105826611-105826633 AACCCACTGCAGTCATGGGTGGG - Intergenic
1045934456 8:107662824-107662846 CACCCACTGCACTCCAGCCTGGG + Intergenic
1046928157 8:119815315-119815337 CAGCCACTGCCCTCCAGCCTGGG - Intronic
1049081839 8:140449325-140449347 CAGTCACTGGCCTCCTGGCTTGG - Intronic
1049111870 8:140651332-140651354 CACCCACTGCACTCCAGCCTGGG - Intergenic
1049497852 8:142945077-142945099 CACCCCCTGCCCTCCTGCTGAGG + Intergenic
1049591595 8:143465296-143465318 CACCCCCTGCCTTCCTGGGGAGG + Intronic
1050998366 9:12248042-12248064 CACCCACTGCACTCCAGCCTGGG + Intergenic
1051258161 9:15234388-15234410 CCCCCACCTCCCTCCTGGATGGG - Intronic
1052213612 9:25937802-25937824 TACTTACTGCCCTCATGGGTTGG - Intergenic
1053928658 9:43092987-43093009 CACCCAAGGCCCTGGTGGGTGGG - Intergenic
1054144331 9:61550921-61550943 CACCCACATCCCTGCTGGGCAGG + Intergenic
1054673424 9:67829474-67829496 CACCCACTGCACTCCAGCCTGGG - Intergenic
1054711147 9:68512057-68512079 AATTCACTGCCCTCCTGGCTTGG + Intronic
1056152745 9:83804604-83804626 CCCCCACCTCCCTCCTGGATGGG - Intronic
1057751618 9:97796904-97796926 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1058521210 9:105815620-105815642 CATCCTCTTCCCTCCTGGATCGG + Intergenic
1058726705 9:107811640-107811662 TAACCACTGCCCTCCAGCGTAGG - Intergenic
1058784848 9:108376910-108376932 CACTCACTGGCCTCCTGGAAGGG + Intergenic
1058924264 9:109646216-109646238 TACTTGCTGCCCTCCTGGGTGGG + Intronic
1059367326 9:113796876-113796898 CACCCCATTCCCTCCTGGGCTGG - Intergenic
1059461025 9:114430182-114430204 CCCTCACTGCCCTCCTGGCCTGG - Intronic
1059501505 9:114757785-114757807 AACCCACTGCCCTCCCAGATAGG - Intergenic
1059879841 9:118678019-118678041 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1060343052 9:122793494-122793516 CACCCACTGCACTCCAGCCTGGG + Intergenic
1060565137 9:124584136-124584158 CACCCACTGCACTCCAGCCTGGG - Intronic
1060929418 9:127479548-127479570 CAGCCAGTGGCCTCCTGGCTTGG + Intronic
1061164809 9:128916168-128916190 CAGTCACTGCCCTCCAGGGTGGG + Exonic
1061230594 9:129313573-129313595 CATCCACGGCCCACCTGTGTTGG - Intergenic
1061551212 9:131335784-131335806 CACCCACTGCACTCCAGCCTGGG - Intergenic
1061688452 9:132304060-132304082 CAGCCACTGCACTCCAGGCTGGG + Intronic
1062274654 9:135725031-135725053 CACGCAGTTGCCTCCTGGGTGGG - Intronic
1062282184 9:135757042-135757064 CATCCACTGACCTCCAGGGTGGG + Intronic
1062410598 9:136422211-136422233 CACCCTCTGCACCCCTGGGAGGG + Intronic
1062496700 9:136835279-136835301 AAACCACTGCCCTCCTGGCCTGG - Intronic
1062530384 9:136997009-136997031 CACCCACTGGCTTTCTGGGCTGG - Intergenic
1062600055 9:137315517-137315539 CACCCCCAGCCCTCCTGGACCGG - Intronic
1062600671 9:137317408-137317430 GACCCACTGCCCTCCTCAGGTGG - Intronic
1062664308 9:137659592-137659614 CACCCACTGCACTCCAGCCTGGG - Intronic
1203463851 Un_GL000220v1:68136-68158 CCCCCACTTCCCTCCCGGATGGG + Intergenic
1186244864 X:7608813-7608835 CTCCCACCTCCCTCCTGGATGGG + Intergenic
1187064929 X:15824263-15824285 CAGCCACTGCCCTCCAGTCTGGG - Intergenic
1188786518 X:34353267-34353289 CACCCACCGTCAGCCTGGGTGGG + Intergenic
1189617021 X:42794403-42794425 CCCCCACTCCCCTCCTGGCCAGG - Intergenic
1189837744 X:45040729-45040751 CCCCCACCTCCCTCCTGGATGGG + Intronic
1189854836 X:45213999-45214021 CACTCACTGCTTCCCTGGGTGGG - Intergenic
1190829917 X:54050567-54050589 CTCCCATTGCACTCCTGGCTGGG + Intergenic
1190924100 X:54886240-54886262 CACTCACTGCCTTCCTGGGCCGG + Intergenic
1190977059 X:55416325-55416347 CACTCACTGCTTCCCTGGGTTGG - Intergenic
1191068914 X:56380154-56380176 CCCCCACCTCCCTCCTGGGTGGG + Intergenic
1191068937 X:56380201-56380223 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1191877195 X:65809073-65809095 CACTCATTGCTTTCCTGGGTGGG - Intergenic
1192234657 X:69288031-69288053 CACCCACTGCACTCCCGTCTGGG + Intergenic
1192252200 X:69422295-69422317 CCCCCACCTCCCTCCTGGATGGG - Intergenic
1192286906 X:69747924-69747946 CAGCCACTGCCCTGCTGGTAAGG + Intronic
1192892666 X:75407423-75407445 CTCCCACCTCCCTCCTGGGCAGG - Intronic
1192980101 X:76330298-76330320 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1193379380 X:80801260-80801282 CGCCCACTGCCCTCCAGCCTGGG - Intronic
1194514190 X:94829552-94829574 CACCCACTGCACTCCAGTCTGGG - Intergenic
1194714604 X:97275328-97275350 CGCCCACCTCCCTCCTGGGTGGG + Intronic
1194714627 X:97275376-97275398 CCCCCACCTCCCTCCTGGGTGGG + Intronic
1194867325 X:99085474-99085496 TACTCACTGCTCCCCTGGGTAGG - Intergenic
1194947843 X:100090712-100090734 CACTCACTGCTTCCCTGGGTGGG - Intergenic
1195267453 X:103196610-103196632 CAGCCACTGCCCTCCAGCCTGGG + Intergenic
1195716933 X:107826652-107826674 CTGCCACTGCCCTCCTGGGACGG + Intronic
1195722284 X:107878309-107878331 CATCCCCTCCCCTCCTGGCTGGG - Intronic
1195983049 X:110600706-110600728 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1196229364 X:113203158-113203180 CACTCACTGCCTTCCTTGGCTGG + Intergenic
1196381726 X:115098443-115098465 CACTCACTGCCTCCCTTGGTTGG - Intergenic
1197226203 X:123959565-123959587 CATCCACTGCCTTCCTGGGCGGG - Intergenic
1197742059 X:129902778-129902800 GAGCCACTGCACTCCTGCGTGGG + Intergenic
1197777243 X:130126446-130126468 CACCCACTGCACTCCAGCCTGGG + Intergenic
1198097773 X:133397512-133397534 ACACCACTGCCCTCCAGGGTGGG + Intronic
1198189113 X:134285971-134285993 CCCCCACCTCCCTCCTGGATGGG + Intergenic
1198246936 X:134839670-134839692 CCCCCACCTCCCTCCTGGATGGG - Intronic
1198252137 X:134890030-134890052 CAGCCACTGCCCTCCAGCCTGGG + Intronic
1200205462 X:154312334-154312356 CACCCACTGCACTCCAGCTTGGG + Intronic
1200243155 X:154508220-154508242 CACCCAGAGGCCTCCTGGGGAGG + Intronic
1200411783 Y:2868365-2868387 CCCCTACTCCCCTCCAGGGTCGG - Intronic
1200899599 Y:8416263-8416285 CACCCACTGCTTTACTGGGTGGG - Intergenic
1201732534 Y:17220257-17220279 CACCCACTGCACTCCAGCCTGGG - Intergenic