ID: 904740187

View in Genome Browser
Species Human (GRCh38)
Location 1:32668767-32668789
Sequence GCGTCTCCGTGGACATCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 2, 1: 2, 2: 2, 3: 3, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904740183_904740187 3 Left 904740183 1:32668741-32668763 CCTTCTGGAGAGTGCAACCCAGA 0: 2
1: 2
2: 2
3: 21
4: 168
Right 904740187 1:32668767-32668789 GCGTCTCCGTGGACATCAGAAGG 0: 2
1: 2
2: 2
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904740187 Original CRISPR GCGTCTCCGTGGACATCAGA AGG Exonic
902581238 1:17409075-17409097 GAGTCTCCGGGAGCATCAGAGGG + Exonic
904740187 1:32668767-32668789 GCGTCTCCGTGGACATCAGAAGG + Exonic
915876754 1:159618628-159618650 GTGTGTCTTTGGACATCAGAAGG - Intergenic
922153196 1:223022350-223022372 GCTTCTCCCTGGGCAGCAGAAGG + Intergenic
923065088 1:230510146-230510168 TCTTCTCCCTGGAGATCAGAGGG + Intergenic
1076698601 10:132258668-132258690 GCGTCAGCGTGGACAGCAGTCGG - Intronic
1085057380 11:73413539-73413561 GTGTCTCCGTACACATCAGATGG - Intronic
1092820493 12:12349830-12349852 GGCTCTGCGTTGACATCAGAAGG - Intronic
1104950108 12:132436156-132436178 GCTTCTCCGTGGGCATGTGAGGG - Intergenic
1106368125 13:29104028-29104050 GCATCCCCCTGGACATGAGATGG + Intronic
1107495591 13:40922634-40922656 GCGTCTCCCCGGGCACCAGAAGG - Intergenic
1113363713 13:109656133-109656155 GAGTCTCTGTGGAGCTCAGATGG - Intergenic
1114323223 14:21564328-21564350 GCGTCTCTGTGGACATCAGAAGG + Intergenic
1115278990 14:31639857-31639879 GAGACTCCGTGGACATAGGATGG + Intronic
1117355348 14:54918754-54918776 GCATCTCGGTGGCCATCAGATGG + Intergenic
1120771698 14:88386185-88386207 TCGTCTCCATGGAGAGCAGAGGG - Intronic
1122288618 14:100667623-100667645 GAGTCTCCCTGGGCAGCAGAGGG + Intergenic
1128089970 15:64912586-64912608 GCGTCTGTGTGGGCATCAGCTGG + Intronic
1145784772 17:27586699-27586721 GTGTCTCCATGCAGATCAGATGG + Intronic
1154501946 18:15001573-15001595 CCATCTCCGTGGGCTTCAGAAGG - Intergenic
1158111901 18:53949410-53949432 GAGTCTGCCTGGACCTCAGAAGG + Intergenic
1162232888 19:9282325-9282347 CCTTCTCCGTGGACATCACAGGG + Intergenic
1164917539 19:32063978-32064000 CCTTCCCAGTGGACATCAGAGGG - Intergenic
944913245 2:204330768-204330790 GAGGCTCCTTGGAGATCAGATGG + Intergenic
947810945 2:233003603-233003625 ACGTCTCCATGGACTTCAGTGGG - Intronic
948805512 2:240452184-240452206 GCCCCTCCTTGGACACCAGAGGG - Intronic
1172480831 20:35270428-35270450 GGGCCTCCGTGGCCATCAGGTGG - Intronic
1179948505 21:44696752-44696774 GCCTCTGCGTGGACCACAGAAGG - Intronic
1180843960 22:18971441-18971463 GCGACACCATGGACATCAGCAGG - Intergenic
1181057513 22:20267267-20267289 GCGGCACCATGGACATCAGCAGG + Intronic
1182414292 22:30210883-30210905 GCAACTCCGTGGATTTCAGACGG - Intergenic
1183739805 22:39663269-39663291 GCATCTGAGGGGACATCAGAAGG + Intronic
1184008571 22:41729474-41729496 GGGTCTCCGTGAACAGCAGCAGG - Intronic
1185208564 22:49554008-49554030 GCCCCTCTCTGGACATCAGAAGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
955405890 3:58625473-58625495 GCTTCACCTTTGACATCAGAGGG + Intronic
958621379 3:96566852-96566874 GCATCTCTGTGGACATCAGAAGG + Intergenic
968077879 3:195826256-195826278 ACGTCTCCGTGGCCAGCACAGGG + Intergenic
970435904 4:16035127-16035149 GCCTCTTCGTGGACATGGGATGG - Intronic
983770420 4:171541841-171541863 GAGTCTCCTTGGCCATGAGAGGG - Intergenic
983849559 4:172563209-172563231 GAGTGTGCGTGGAAATCAGAAGG - Intronic
986337937 5:6768792-6768814 GGGACTCTGTGGACACCAGAGGG + Intergenic
987124377 5:14797866-14797888 GCGTCTCCGTGGACATCAGAAGG - Intronic
1003017034 6:2476337-2476359 GAATCTCCGTGCACATTAGAGGG + Intergenic
1008236745 6:49059888-49059910 GTGTGTCTGTGTACATCAGATGG - Intergenic
1009036270 6:58120495-58120517 GTGTCTCTGTGGACATCAGAAGG - Intergenic
1009212087 6:60874109-60874131 GTGTCTCCGTGGACATCAGAAGG - Intergenic
1010512588 6:76738850-76738872 GAGTATCCTTGGAGATCAGATGG - Intergenic
1011749748 6:90443119-90443141 GCATCTTCATGGATATCAGAGGG + Intergenic
1019565517 7:1676920-1676942 CTTTCTCCGTCGACATCAGAGGG - Intergenic
1029161815 7:98557936-98557958 AGGTCTCCGTGGGCCTCAGATGG - Intergenic
1033786612 7:144739056-144739078 GTGTTTCCGTGGAAAGCAGATGG - Intronic
1049229843 8:141476237-141476259 GAGTCTCTGTGAACAGCAGAAGG - Intergenic
1051245970 9:15111379-15111401 GGGTCTCAGTGGGCATAAGAGGG + Intergenic
1061899299 9:133664878-133664900 GCATGCCCGTGGACATCTGAAGG - Intronic
1187496610 X:19801223-19801245 GCTTCCCTGTGGTCATCAGATGG - Intronic
1188456193 X:30369216-30369238 GTACCTCCGTGGAGATCAGAGGG - Intergenic
1193655132 X:84188539-84188561 GCTGCTCCGTGGACTTGAGAGGG - Intergenic
1201670372 Y:16513794-16513816 GCGTGTCTCTGGACATGAGATGG + Intergenic