ID: 904741035

View in Genome Browser
Species Human (GRCh38)
Location 1:32676020-32676042
Sequence GAGGCTGCTGTGAGACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3728
Summary {0: 1, 1: 1, 2: 40, 3: 650, 4: 3036}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904741025_904741035 27 Left 904741025 1:32675970-32675992 CCAGCTACTTGGGAGGCCGAGGC 0: 1217
1: 85344
2: 197752
3: 329886
4: 388329
Right 904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG 0: 1
1: 1
2: 40
3: 650
4: 3036
904741023_904741035 28 Left 904741023 1:32675969-32675991 CCCAGCTACTTGGGAGGCCGAGG 0: 1397
1: 97603
2: 211663
3: 384128
4: 448023
Right 904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG 0: 1
1: 1
2: 40
3: 650
4: 3036
904741032_904741035 -5 Left 904741032 1:32676002-32676024 CCTTGAATCCAGCGGGTAGAGGC 0: 1
1: 0
2: 2
3: 33
4: 507
Right 904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG 0: 1
1: 1
2: 40
3: 650
4: 3036
904741028_904741035 11 Left 904741028 1:32675986-32676008 CCGAGGCAGGAGGATACCTTGAA 0: 1
1: 77
2: 1907
3: 17256
4: 39399
Right 904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG 0: 1
1: 1
2: 40
3: 650
4: 3036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904741035 Original CRISPR GAGGCTGCTGTGAGACATGG TGG Intronic
Too many off-targets to display for this crispr