ID: 904742425

View in Genome Browser
Species Human (GRCh38)
Location 1:32688674-32688696
Sequence CAGAATTGCCTGAACCCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30689
Summary {0: 1, 1: 2, 2: 72, 3: 2052, 4: 28562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904742425_904742431 7 Left 904742425 1:32688674-32688696 CCTTGCGGGTTCAGGCAATTCTG 0: 1
1: 2
2: 72
3: 2052
4: 28562
Right 904742431 1:32688704-32688726 CCCCGAGTAGCTGGGATTACAGG 0: 781
1: 48784
2: 215593
3: 259482
4: 188726
904742425_904742426 -2 Left 904742425 1:32688674-32688696 CCTTGCGGGTTCAGGCAATTCTG 0: 1
1: 2
2: 72
3: 2052
4: 28562
Right 904742426 1:32688695-32688717 TGCCTCAGCCCCCGAGTAGCTGG 0: 81
1: 1028
2: 2582
3: 2674
4: 2656
904742425_904742434 26 Left 904742425 1:32688674-32688696 CCTTGCGGGTTCAGGCAATTCTG 0: 1
1: 2
2: 72
3: 2052
4: 28562
Right 904742434 1:32688723-32688745 CAGGCATGCACCACCACGCCCGG 0: 2909
1: 15371
2: 41698
3: 105256
4: 196462
904742425_904742427 -1 Left 904742425 1:32688674-32688696 CCTTGCGGGTTCAGGCAATTCTG 0: 1
1: 2
2: 72
3: 2052
4: 28562
Right 904742427 1:32688696-32688718 GCCTCAGCCCCCGAGTAGCTGGG 0: 83
1: 1033
2: 2728
3: 3154
4: 3043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904742425 Original CRISPR CAGAATTGCCTGAACCCGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr