ID: 904744228

View in Genome Browser
Species Human (GRCh38)
Location 1:32701600-32701622
Sequence CCATGGTGCCAGGCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904744216_904744228 26 Left 904744216 1:32701551-32701573 CCTCCAAGCTGTGCTGTTAGCAC 0: 1
1: 0
2: 0
3: 11
4: 129
Right 904744228 1:32701600-32701622 CCATGGTGCCAGGCCTCTGCTGG 0: 1
1: 0
2: 5
3: 40
4: 366
904744217_904744228 23 Left 904744217 1:32701554-32701576 CCAAGCTGTGCTGTTAGCACACA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 904744228 1:32701600-32701622 CCATGGTGCCAGGCCTCTGCTGG 0: 1
1: 0
2: 5
3: 40
4: 366
904744219_904744228 -8 Left 904744219 1:32701585-32701607 CCTCCACCACCCCACCCATGGTG 0: 1
1: 0
2: 4
3: 72
4: 637
Right 904744228 1:32701600-32701622 CCATGGTGCCAGGCCTCTGCTGG 0: 1
1: 0
2: 5
3: 40
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904744228 Original CRISPR CCATGGTGCCAGGCCTCTGC TGG Intronic
900217802 1:1490931-1490953 CCCAGGTGCCCGGGCTCTGCTGG + Intronic
900679102 1:3906533-3906555 CCTTGCTGCCAGCCCTCCGCTGG + Intergenic
900848059 1:5119653-5119675 CCATGGCTCCACGTCTCTGCCGG - Intergenic
901533341 1:9867233-9867255 CCAGCCTGCCTGGCCTCTGCTGG - Intronic
901853410 1:12029853-12029875 CCAGGGTCCCAGGGCCCTGCTGG - Exonic
903136072 1:21310080-21310102 CCACTGTGCCAGGCCCCAGCTGG + Intronic
903886861 1:26545874-26545896 CCATGGTGCCGTGGCCCTGCTGG + Exonic
904509569 1:30992542-30992564 CAATGGTGCCAAGCCTGTGGAGG - Exonic
904744228 1:32701600-32701622 CCATGGTGCCAGGCCTCTGCTGG + Intronic
904827114 1:33280779-33280801 CCATTGTGCACGGCCTCTTCAGG - Intronic
904961728 1:34338629-34338651 CCATGGTGCAAGGCATCAGTAGG - Intergenic
905116651 1:35647030-35647052 CCACGGTGCCTGGCCTCGCCTGG - Intergenic
905217223 1:36417365-36417387 CCACTGTGCCCGGCCTATGCTGG + Intronic
906030822 1:42718580-42718602 CCATGGTGCATGTCATCTGCTGG + Intergenic
906189341 1:43885749-43885771 CCATTTTCCAAGGCCTCTGCAGG + Intronic
906293693 1:44636193-44636215 CTCTGGTGCCAGGCCTCTGCTGG + Intronic
906518513 1:46453551-46453573 CCCTTGTGCCAGCCCTGTGCTGG + Intergenic
906581321 1:46937306-46937328 CCATGGAGCCAGGAATCTGTAGG + Exonic
906823893 1:48958143-48958165 CCACTGCGCCTGGCCTCTGCAGG + Intronic
908510849 1:64849073-64849095 CCATGCTGTCAGGATTCTGCAGG + Intronic
909183186 1:72450385-72450407 CCATCGTGCCTGGCCTCATCAGG - Intergenic
911773324 1:101775378-101775400 CCATGGTGCCAGACAGATGCTGG + Intergenic
912914483 1:113799328-113799350 CCATGGTGCCTGGCATCTCTTGG + Intronic
915251430 1:154591838-154591860 CCATGCTGGCAGGCCCGTGCAGG + Intronic
922702680 1:227771019-227771041 CCAAGGTGACTGGGCTCTGCGGG + Intronic
923681508 1:236122297-236122319 CCATGGTCCCTGGCCTCTTGGGG - Intergenic
924707048 1:246509999-246510021 CCATGGTCCCAGGGCTGTCCAGG + Intergenic
1063469847 10:6275462-6275484 TGATGGAGTCAGGCCTCTGCCGG + Intergenic
1064099018 10:12447342-12447364 TCATGATGAGAGGCCTCTGCTGG + Intronic
1064682285 10:17822837-17822859 CCAAGGTACCAGCCCTCAGCTGG - Intronic
1066635539 10:37495737-37495759 CTATGCTGCCAGGCCTGTGATGG - Intergenic
1067222934 10:44356955-44356977 CCCTGGTTCCTGGCCTCCGCCGG - Intergenic
1067274895 10:44825299-44825321 CCAAGGTTTCAGGCATCTGCTGG - Intergenic
1067947694 10:50700803-50700825 CTATGGTGCCAGCCCCGTGCTGG + Intergenic
1068607227 10:59019089-59019111 CCATGCTGCCAGAGCTCTCCAGG - Intergenic
1069004105 10:63298059-63298081 CAATGGGGCCAGACCTGTGCTGG + Intronic
1069397259 10:68003298-68003320 GCATGGTGGCAGGCGCCTGCAGG - Intronic
1069709999 10:70482072-70482094 CCCTGTGGCCAGGACTCTGCAGG + Intronic
1069886613 10:71627773-71627795 CCATGGTGCCAGCCCTGCTCAGG - Intronic
1069911322 10:71761607-71761629 CCATGGTGCCATGGAGCTGCAGG - Exonic
1070883010 10:79865796-79865818 CTATGGTGCCAGCCCTGTGCTGG + Intergenic
1071649578 10:87382111-87382133 CTATGGTGCCAGCCCTGTGCTGG + Intergenic
1072826296 10:98610126-98610148 CCATTGTGCCTGGCCTCAGGTGG + Intronic
1074415184 10:113261341-113261363 CCCAAGTGACAGGCCTCTGCAGG - Intergenic
1075004374 10:118819562-118819584 CCACTGTGACCGGCCTCTGCTGG - Intergenic
1075516487 10:123112807-123112829 CCAAGGTGCAAAGTCTCTGCTGG - Intergenic
1075568577 10:123521880-123521902 CCAGGTTGCCAGGCCTGAGCTGG + Intergenic
1075677354 10:124304560-124304582 TCATGGTGGCAGGCCTCTAAGGG - Intergenic
1076291042 10:129345952-129345974 CCATGGTGCCTGGCTTCTCAGGG - Intergenic
1076941498 10:133613062-133613084 CCATGGTCCCAGGCCAGGGCTGG + Intergenic
1077410579 11:2402119-2402141 TAATGGTGCCAACCCTCTGCAGG - Intronic
1078578814 11:12523362-12523384 CCAAGGTGGGAGGCCCCTGCTGG - Intronic
1079646352 11:22868113-22868135 CCATGGAGCCAGCCCTGTACTGG - Intergenic
1081387422 11:42488018-42488040 CCATGGTTTTAGGCATCTGCTGG - Intergenic
1081492165 11:43577460-43577482 GGATAGTGCCTGGCCTCTGCAGG - Intronic
1081973225 11:47214466-47214488 CGGCGCTGCCAGGCCTCTGCGGG - Intronic
1082218162 11:49600211-49600233 CCACTGTGCCTGGCCTCTGATGG + Intergenic
1082277254 11:50235270-50235292 CCACCGTGCCAGGCCTTTGATGG + Intergenic
1083329143 11:61889311-61889333 GCCTGGTGCCAGGCCCATGCTGG - Intronic
1084419611 11:69053738-69053760 CGCTGGTGCCAGGGCCCTGCAGG + Intronic
1084579435 11:70013921-70013943 CCAGGGAGACAGGCCTCAGCAGG - Intergenic
1084718838 11:70891225-70891247 CCACCGTGCCCGGCCTCTGGTGG - Intronic
1085019109 11:73193952-73193974 CCATGATGCCAAGCCTCACCAGG - Intergenic
1085385718 11:76157121-76157143 CCAAGGTGCTCAGCCTCTGCTGG - Intergenic
1086393973 11:86395327-86395349 CCACAGTGCCAGGCCTCTAGAGG - Exonic
1086631409 11:89023936-89023958 CCACTGTGCCTGGCCTCTGATGG - Intronic
1088790100 11:113217234-113217256 TGATGGTGTCAGTCCTCTGCAGG + Intronic
1089339022 11:117745125-117745147 CCATGGTGACAGGCCTCAGGAGG + Intronic
1089757213 11:120695774-120695796 CCAACCTGCCAGGCCTCTGCAGG - Intronic
1090014326 11:123072409-123072431 GCATGGTGCCAGGCACCTGTAGG - Exonic
1090501430 11:127265183-127265205 CCAGGGTGCCAGGCACCTGGTGG - Intergenic
1090975620 11:131677805-131677827 CAAGGATGCCAGGCCTCTGCAGG - Intronic
1091613718 12:2033275-2033297 CCATGATGCCCGCCCTCTGCAGG + Intronic
1092488799 12:8926327-8926349 CCACTGTGCCCGGCCTCTCCAGG - Intronic
1092953827 12:13531447-13531469 ACATGGGGCCTGGGCTCTGCAGG - Intergenic
1093930472 12:24950495-24950517 CAATGGTGCCAGGCCACAGCAGG - Intergenic
1094642259 12:32287822-32287844 CCACTGTGCCCGGCCTCGGCTGG + Intronic
1096151673 12:49317486-49317508 CCATGGTGCCTGGCCACGCCTGG - Intergenic
1099826390 12:87782006-87782028 CCACAGTGCCCGGCCTCTGTTGG + Intergenic
1100442159 12:94627253-94627275 GCATGGTGCCAGGGCTTTGGGGG - Intronic
1101881098 12:108626421-108626443 CCACCGTGCCAGGCCTATGTTGG + Intronic
1102648303 12:114418213-114418235 CCATGGTGCCTGACCTTTGGAGG - Intergenic
1102874157 12:116436793-116436815 CCATGGAACCAGGCCTTTCCAGG + Intergenic
1103227396 12:119299813-119299835 CCATGGTTTCAGGCATCTACTGG - Intergenic
1103366579 12:120388753-120388775 CCATGGGGCCAGGCACCTGCTGG - Intergenic
1103390477 12:120569276-120569298 CCACTGTGCCTGGCCTCTGTCGG + Intronic
1104317577 12:127718632-127718654 CCACTGTGCCCGGCCTCTGATGG - Intergenic
1104551516 12:129761473-129761495 CCATCCTCCCAGGCCTCTGAGGG + Intronic
1104647851 12:130509657-130509679 CCATGGCCCCCGGCCTCTGCTGG + Intronic
1106234143 13:27847380-27847402 CTATGGTTCAAGGCTTCTGCTGG - Intergenic
1107453653 13:40535397-40535419 CCATGGTGCCAGGCCGGTTCTGG - Intergenic
1108591875 13:51919732-51919754 CCATGGTGACCTGCCTTTGCAGG + Intergenic
1108633840 13:52313191-52313213 CCATGGTGCCAGAGCTCTGGAGG + Intergenic
1108634259 13:52316884-52316906 CCATGGTGCCAGAGTTCTGGAGG + Intergenic
1109135593 13:58645893-58645915 CCGCCGTGCCAGGCCTCTTCTGG + Intergenic
1109974145 13:69808452-69808474 TCAGAGTGCCAGGCCTCTGTAGG - Intronic
1110685147 13:78363628-78363650 CCAATGTGACAGGCCTCTTCTGG - Intergenic
1113129831 13:107023509-107023531 CCATGTTGCCAGGCACCTGTGGG - Intergenic
1113968138 13:114166387-114166409 CCTTGGAGCCTGGGCTCTGCAGG - Intergenic
1114621298 14:24098009-24098031 CCAAGGTCCCAGCCCTCTGGGGG - Intronic
1115351317 14:32398583-32398605 CCATGGTTCCAGGCTTCTCCTGG + Intronic
1118042459 14:61932173-61932195 CAATGGTACCAGTCCTCTGGAGG - Intergenic
1118085082 14:62405211-62405233 CCATGATGCCATGGCTCTTCAGG - Intergenic
1118870333 14:69736057-69736079 CCATTGTGCCTGGCCTTTTCTGG + Intronic
1119204465 14:72783853-72783875 CCGTGGGCCCAGGGCTCTGCAGG - Intronic
1119396438 14:74329558-74329580 CCATAGTGCCTGGCCTGTGGAGG + Intronic
1119428252 14:74549947-74549969 CCAGTGTGCCAACCCTCTGCTGG - Exonic
1121959243 14:98243479-98243501 CCAAGGCTCCAGGCCTCGGCAGG + Intergenic
1122083256 14:99281727-99281749 CCTCTGTGCCAGGCCTGTGCTGG - Intergenic
1122581356 14:102773774-102773796 CCATGGTGCCCAGCCTCGGGGGG - Intergenic
1122809761 14:104282094-104282116 CCATGGAGCCAGGCCTGGGTGGG + Intergenic
1122841539 14:104466774-104466796 CCATGGTGTCAGGCATCCACTGG + Intergenic
1125871975 15:43110393-43110415 CCATGGTGCCTGGCCACTTTGGG - Intronic
1126101396 15:45120302-45120324 CCAGGGTGGCATTCCTCTGCTGG - Exonic
1126181425 15:45788616-45788638 CCACTGTGCCTGGCCTCTGTTGG + Intergenic
1127626575 15:60786094-60786116 ACATGGTTCCAGGCCTCTGGGGG + Intronic
1127770488 15:62226555-62226577 CCAAGGTCCCAGGTCTCTGGAGG + Intergenic
1127985436 15:64066817-64066839 CCACTGTGCCTGGCCTCTACTGG - Intronic
1128572066 15:68741054-68741076 CCACAGTGCCAGGGCTGTGCTGG + Intergenic
1129266940 15:74398196-74398218 GCTTGGTGTCAGGCCTGTGCTGG - Intergenic
1129629809 15:77246292-77246314 CCACTGTGCCTGGCCCCTGCTGG + Intronic
1130035944 15:80361603-80361625 CCATTGAGCTAGGCTTCTGCAGG - Intronic
1130402064 15:83566485-83566507 CCATTGTGCCTGGCCAGTGCCGG - Intronic
1130615900 15:85407525-85407547 CCATCGTGCCCGGCCTGTGCTGG + Intronic
1130720584 15:86382208-86382230 CCATTGTCTCAGGCCACTGCTGG + Intronic
1131432854 15:92400669-92400691 CCCAGATGCCAAGCCTCTGCCGG + Intronic
1134391007 16:13820080-13820102 ATTTGGTGCCAGGGCTCTGCTGG - Intergenic
1135071801 16:19358526-19358548 CCATCGCGCCCGGCCTCTGGTGG + Intergenic
1136065990 16:27759178-27759200 CCCTGAGGCCAGGACTCTGCTGG - Intronic
1136733499 16:32441421-32441443 CCCTCGTCCCAGCCCTCTGCGGG - Intergenic
1137434379 16:48443635-48443657 CCATGGTGTCAAGCCTATGTGGG - Intronic
1137750633 16:50858790-50858812 TCTTGGTCCCAGGCCTCTTCAGG + Intergenic
1138414255 16:56862332-56862354 CCATGGAGCCAGTCCTCTGGGGG + Intergenic
1139312077 16:66035937-66035959 CCATGGTGCCAGCCCAGTACAGG - Intergenic
1139367125 16:66440416-66440438 CCACAGTGCCTGGCCCCTGCTGG + Intronic
1139471497 16:67180319-67180341 CCAGGGTGCCACGCCCCCGCCGG + Exonic
1141053900 16:80798328-80798350 CCACAGTGCCCGGCCTGTGCAGG + Intronic
1141362818 16:83412321-83412343 GCATGGTGGCAGACGTCTGCAGG + Intronic
1141552927 16:84818185-84818207 CCATCGTGCCAGGCCTCCAAAGG + Intergenic
1141683928 16:85559439-85559461 CCATGGTGTCAGGCCTCTGTGGG - Intergenic
1142075467 16:88115110-88115132 CCATGCTGCCTGGTCTGTGCCGG + Intronic
1142149422 16:88506124-88506146 CCATGATGCCTGGCCTCTGCTGG - Intronic
1142282468 16:89155618-89155640 CCTTGGGTCCAGGCCTCTGGCGG - Exonic
1203019584 16_KI270728v1_random:388181-388203 CCCTCGTCCCAGCCCTCTGCGGG + Intergenic
1203037919 16_KI270728v1_random:661339-661361 CCCTCGTCCCAGCCCTCTGCGGG + Intergenic
1142470227 17:159201-159223 CCCCTGTGCCAGGCCTCTGGCGG - Intronic
1142621665 17:1169261-1169283 CCATTGTTCTTGGCCTCTGCTGG - Intronic
1143030151 17:3963396-3963418 CCAAGGTGCCAGGCCACATCTGG + Intronic
1143122001 17:4613972-4613994 CCACCGTGCCTGGCCTATGCAGG - Intergenic
1143615675 17:8047803-8047825 GCATGTTGCCAGGCCTTTGGAGG - Exonic
1143735005 17:8905450-8905472 CCATGGTGCCTGGCATCTCTGGG - Intronic
1144665245 17:17098101-17098123 CCCTGGTGCCTGGCCCCAGCAGG - Intronic
1144772981 17:17770009-17770031 CCAGGGTGACAGGGCTTTGCTGG + Intronic
1145024869 17:19460744-19460766 CCAAGGCGGCAGACCTCTGCTGG + Intergenic
1145987651 17:29057961-29057983 CCATGGCGCCCGGCCTTGGCTGG - Intergenic
1146058303 17:29591923-29591945 CTGTGGTGCCAGGCCCCAGCGGG - Intronic
1146103110 17:30004920-30004942 CCACTGTGCCTGGCCTCTGTGGG + Intronic
1146158892 17:30548410-30548432 CCATGGTGCCAGGGCACTGACGG - Intergenic
1147537214 17:41328611-41328633 CCATGGTCCCAGGGCTGTCCAGG - Intergenic
1147884281 17:43674352-43674374 CCATGGTTTTAGGCCTATGCTGG - Intergenic
1147894546 17:43742025-43742047 GCATGGTGCTGGGCATCTGCTGG + Intergenic
1148028109 17:44602153-44602175 CCCTGGAGCTAGGGCTCTGCAGG + Intergenic
1148352135 17:46948830-46948852 CCATGGTTCCACGCCTCTCAGGG - Intronic
1148444803 17:47731057-47731079 CCCTGGGGCCATGCCTCTGGAGG - Intergenic
1149833711 17:59893486-59893508 CCTAGGTGTGAGGCCTCTGCGGG + Intronic
1151587209 17:75016797-75016819 CGCTGGAGCCAGGCCTCTGATGG + Intronic
1151897965 17:76993135-76993157 CCATGCTCCCTGGTCTCTGCCGG + Intergenic
1152021009 17:77780209-77780231 CCTTGGCGCCACGCCTCTGTGGG + Intergenic
1152205538 17:78972613-78972635 CTATGGGGCCAGGCAGCTGCAGG - Exonic
1152587408 17:81195215-81195237 CTCTGGGGCAAGGCCTCTGCAGG - Intronic
1154027855 18:10724887-10724909 CCAGGGTGCCACGCCCCCGCCGG - Intronic
1154212389 18:12390774-12390796 CCATGGTGCCTGGCCTTTAAAGG + Intergenic
1154367663 18:13726303-13726325 GCATGGGCCCAGGCCTCTGTGGG - Intronic
1154400603 18:14033350-14033372 CCCTGGAGCCTGGCCTGTGCTGG + Intergenic
1155219425 18:23671074-23671096 CCATAGTGGCAGGTCTTTGCGGG - Intergenic
1156491637 18:37499828-37499850 ACTTGGTGCCAGGACTGTGCTGG - Intronic
1157001188 18:43527662-43527684 CCAGGGTGCTATGCCACTGCAGG + Intergenic
1157496485 18:48161076-48161098 ACAAGCTGCCAGGCCTCTGCTGG - Intronic
1157512415 18:48286762-48286784 CCACCGTGCCTGGCCTCTTCTGG - Intronic
1158247895 18:55452500-55452522 CCAGGGTGCCAGGCCTGCTCTGG + Intronic
1159568401 18:70083135-70083157 CCTTGATACCAGGCCCCTGCTGG - Intronic
1161259868 19:3331867-3331889 CCATCGTGCCTGGCCTCTAATGG + Intergenic
1161671875 19:5616935-5616957 CCATGGTGCCCGGCCTCAATTGG + Intronic
1161708602 19:5834411-5834433 CCCTGGGGCCAGTCCGCTGCTGG - Intronic
1162331867 19:10034818-10034840 CCATCGTGCCTGGCCTCCACTGG - Intergenic
1162445678 19:10721077-10721099 CCATGGTGTCTGGCAGCTGCCGG + Intronic
1163095498 19:15054288-15054310 CCATGGTGCCTGGCTTCAGCTGG - Intronic
1163323802 19:16590179-16590201 GCATGGTGCCAGCACCCTGCAGG + Intronic
1163475082 19:17521122-17521144 CCATGGGGCTGGGCCCCTGCTGG + Exonic
1163801546 19:19368700-19368722 CCACCGTGCCCGGCCTGTGCTGG - Intergenic
1164080391 19:21857288-21857310 CCATGATCACAGCCCTCTGCTGG - Intergenic
1164426807 19:28148895-28148917 GCATGGTGCCAGGCCTTTACTGG + Intergenic
1164715931 19:30390411-30390433 CCAGGGTGGCAGGCAGCTGCAGG + Intronic
1164921092 19:32089227-32089249 TCAGGGTGTCAGGCCTCTGTGGG - Intergenic
1165247503 19:34505643-34505665 CCATGGTGACAGGACTGTGTGGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166579470 19:43881667-43881689 CCATCGCACCTGGCCTCTGCTGG - Intronic
1166763838 19:45240943-45240965 CCATGGGCCCAGCCCTGTGCAGG + Intronic
1166916633 19:46199748-46199770 CCATGGTTCCAGGCATTTCCTGG - Intergenic
1166947473 19:46405813-46405835 GGATGGTGCCAGGCCTCCGCTGG - Intergenic
1167220377 19:48195275-48195297 CCCTGGTGCGAGGCCACCGCCGG + Exonic
1167661491 19:50798368-50798390 CCATGGTGCCAGGGCCCGCCAGG - Exonic
925148897 2:1601177-1601199 CCATGGTGCCAGCTCCCTTCAGG + Intergenic
925390411 2:3490364-3490386 CCAGGGCTCCCGGCCTCTGCAGG + Intergenic
926104418 2:10141508-10141530 CCATGTGCCCAGACCTCTGCTGG - Exonic
926258354 2:11231493-11231515 CCATCGTGCCTGGCCTCTTCAGG + Intronic
926607921 2:14915845-14915867 CCACTGTGCCTGGCCTCTGATGG + Intergenic
927133409 2:20079811-20079833 CCATGGAGCCAGGCCAGGGCAGG - Intergenic
927901849 2:26825722-26825744 CCATGGTGCCCAGCCTCTGTGGG + Intergenic
928214466 2:29349865-29349887 CCATGGTGACAGGACCCAGCAGG - Intronic
928527648 2:32158985-32159007 GCACGGTGCCTGGCCTCTGTTGG - Intergenic
929777922 2:44939884-44939906 CCGCAGTGCCAGGCCTCTGAGGG - Intergenic
929990299 2:46780999-46781021 CAAGGGTGACAGCCCTCTGCTGG + Intergenic
930069835 2:47357273-47357295 CCACTGTGCCTGGCCTCTTCAGG + Intronic
930597330 2:53404495-53404517 CCATGGTTCCAGGCATCCACTGG + Intergenic
931771592 2:65502391-65502413 CCACCGTGCCCGGCCTCTCCTGG - Intergenic
932574030 2:72953041-72953063 CCCGGGTGGCAGGCCTCGGCGGG - Intronic
932849898 2:75174313-75174335 CCATGGTTTCAGGCATCTGCTGG - Intronic
932878854 2:75480743-75480765 CCACCGTGCCTGGCCTCTACTGG + Intronic
933053524 2:77631971-77631993 CCATTGCGCCTGGCCTCTTCTGG + Intergenic
933082516 2:78009924-78009946 CCATGGTCTCAGGCATCTACTGG + Intergenic
934233201 2:90205550-90205572 CCATGTTGCCAGGCCTATGTGGG + Intergenic
934883286 2:98002271-98002293 CCATTTTGCATGGCCTCTGCAGG + Intergenic
935542209 2:104361915-104361937 TCATGGTGCCATCCCTTTGCAGG + Intergenic
935966267 2:108479694-108479716 CCACTGAGCCCGGCCTCTGCTGG - Intronic
936056790 2:109267831-109267853 CAATGGGGCCAGGCTCCTGCTGG + Intronic
936056948 2:109268509-109268531 CAATGGGGCCAGGCTCCTGCTGG - Intronic
937346798 2:121131084-121131106 CCACTGTGCCCGGCCTGTGCAGG - Intergenic
938422701 2:131156973-131156995 ACATGAGGCCAGCCCTCTGCTGG + Intronic
941621523 2:167784266-167784288 GCATGGTCACAGGACTCTGCAGG - Intergenic
942469248 2:176242652-176242674 AAATGGTGCCAGGCATGTGCAGG - Intergenic
946327613 2:218992901-218992923 CCATGTTGGCAGGTCTCTCCAGG + Intronic
948461207 2:238130795-238130817 CCCTGAAGCCAGGCCACTGCGGG - Exonic
948542369 2:238699717-238699739 CCCAGGAGCCTGGCCTCTGCTGG + Intergenic
948726950 2:239939933-239939955 ACTTGTTGCCAGGCCTCTCCTGG - Intronic
948869570 2:240791479-240791501 GGATGGGGCCAGGCCTGTGCGGG - Intronic
1169213070 20:3778360-3778382 CCCTCCTGCCCGGCCTCTGCTGG + Intronic
1171273510 20:23835049-23835071 TCCTGGGGCCAGGCCTCTCCTGG - Intergenic
1172271507 20:33658008-33658030 CCTTGCTGCCAGGCGACTGCTGG + Exonic
1172329281 20:34063775-34063797 CCCTCCTGCCAGGCCTCTTCTGG + Intronic
1173020819 20:39266670-39266692 CCTTGGGACCAGGCCTCTGCTGG + Intergenic
1173800001 20:45889162-45889184 TCTTTGTGCCAGGCCTGTGCTGG - Intronic
1173862753 20:46294888-46294910 GCCGGGTGCCAGGCCTGTGCTGG - Intronic
1175404406 20:58717209-58717231 CCCTGTTGCCAGGGCTCTGGTGG - Intronic
1175448233 20:59041423-59041445 CCACTGTGCCCGGCCTCTGAAGG - Intronic
1176082802 20:63282377-63282399 CCAAGGTGCCTGGACTGTGCTGG + Intronic
1176201672 20:63863646-63863668 CCCTGGAGCCAGGCCTGGGCTGG + Intergenic
1176268551 20:64223449-64223471 CCAAGGTGCCAAGCCTCAGCTGG + Intronic
1176376874 21:6091198-6091220 CCAGCGTGCCAGGCACCTGCGGG - Intergenic
1178451508 21:32705696-32705718 CCACTGTGCCAGGCCCCTGTTGG - Intronic
1178666373 21:34550555-34550577 CCAAGGAGCAAGGCCTCTGAGGG + Intronic
1179189081 21:39108052-39108074 CCTTGGTGCCAGGATTCTGAAGG - Intergenic
1179492237 21:41748145-41748167 GCGTCCTGCCAGGCCTCTGCTGG - Intronic
1179746601 21:43447046-43447068 CCAGCGTGCCAGGCACCTGCGGG + Intergenic
1180154017 21:45969018-45969040 ACATGGTGGCAGGCACCTGCAGG + Intergenic
1180845193 22:18976939-18976961 CCACCGTGCCTGGCCTCTGAAGG + Intergenic
1181001476 22:19989713-19989735 CCAGGGAGACAGGACTCTGCAGG + Intronic
1182125085 22:27810452-27810474 ACATGGAGCCAGGCCCCTGCAGG + Intergenic
1182315755 22:29445826-29445848 CCATGGTTTCAGGCCTCCTCTGG - Intergenic
1182458184 22:30465893-30465915 CCATGGACCCAGGCCTGTGAGGG + Intronic
1183256401 22:36765242-36765264 GCTTGATGCCAGGCCTCTCCAGG - Intronic
1183296286 22:37031416-37031438 ACATGCTGCCCAGCCTCTGCAGG + Intergenic
1183360610 22:37381252-37381274 CCATGGTCCCAGCCCTTTGGAGG - Intronic
1183397655 22:37581689-37581711 CCTCGGTGCCAGGAGTCTGCAGG + Intronic
1183492763 22:38125523-38125545 ACCTAGTGCCAGCCCTCTGCAGG - Intronic
1183953319 22:41364657-41364679 CCACCGTGCCTGGCCTCTGCAGG - Intergenic
1183974216 22:41501287-41501309 CCATGGTGCCTGGCCTAAGGTGG + Intronic
1184096466 22:42318884-42318906 TCATGGCCCCAGGCCTCAGCTGG - Intronic
1184236466 22:43185858-43185880 CTCTGGTCCCAGGCCTGTGCTGG - Intronic
1184464208 22:44659436-44659458 CCATGGTGACAGGACCCGGCAGG - Intergenic
1184563982 22:45280340-45280362 CCACCGTGCCTGGCCTCAGCAGG - Intergenic
1184693949 22:46129663-46129685 CCATGCTGCGAGGCCTCAGAGGG + Intergenic
1184850899 22:47119780-47119802 CCATCGTGCCAGGCCTAGACTGG + Intronic
1185066664 22:48635675-48635697 ACATATTCCCAGGCCTCTGCAGG + Intronic
1185261119 22:49864128-49864150 CGCTGGTTCTAGGCCTCTGCTGG + Intronic
950361808 3:12454723-12454745 CCCTGGTGACAGCCCCCTGCAGG + Intergenic
952269171 3:31815611-31815633 CCAAAGTGCCCTGCCTCTGCTGG + Intronic
952377278 3:32778303-32778325 CCACCGTGCCTGGCCTTTGCTGG + Intergenic
952506034 3:34007554-34007576 ACATGGTGGCAGGCCAATGCAGG - Intergenic
953519451 3:43627400-43627422 CCTTGGTGCCAGGCCTAGCCTGG - Intronic
953992532 3:47495355-47495377 CCCTGGTGCCAGGCCCTTGATGG + Intergenic
954269287 3:49495005-49495027 GCTTGGTGCCAGGCATCTACTGG + Intronic
954736757 3:52713945-52713967 CCATGGTACCTGGCCACTGAGGG - Intronic
955074334 3:55599178-55599200 CCAAGGTGTCAGGCTTCTTCTGG - Intronic
955705844 3:61726906-61726928 CCATGGTGGCGGGCGTCTGTAGG + Intronic
956197161 3:66664445-66664467 CCATCATGCCTGGCCTCTGGTGG + Intergenic
957507985 3:81150546-81150568 CCATGGTGCCAGGCTCCTAAAGG - Intergenic
958736065 3:98010810-98010832 CCATGGTGCCTGGCCTCAATAGG - Intronic
960910791 3:122647463-122647485 CCACGGTGCCTGGCCTCTGCTGG - Intergenic
960929372 3:122829463-122829485 CCACTGTGCCAGGCCTCTTGTGG - Intronic
961831111 3:129623466-129623488 CCTTGGTGCCAGGCCCAGGCAGG + Intergenic
964205692 3:154172405-154172427 CCATGGTGCCTGGCCATGGCAGG - Intronic
964381466 3:156102239-156102261 CCATGGTGCCTGGCCTGTTGTGG + Intronic
966626436 3:182021847-182021869 ACATGCTGCCAGGCTGCTGCTGG + Intergenic
968332612 3:197884530-197884552 CCACTGTGCCCGGCCTCTGAGGG + Intronic
968473684 4:793149-793171 CCAGGAGGCCAGGCCTCTGCTGG - Intronic
968800819 4:2742366-2742388 CCAGGATGCCCGCCCTCTGCAGG + Exonic
969467923 4:7368600-7368622 CCATGGGGGCAGGCCTCTCTAGG - Intronic
969654589 4:8489144-8489166 ACATGGGGCCAGGGCACTGCAGG - Intronic
970139641 4:12967809-12967831 CCACGATGCCCGGCCTCTGTAGG + Intergenic
972581319 4:40398020-40398042 CCATGGTGCCAGGCCTCTTTTGG + Intergenic
976437038 4:85030024-85030046 CCACTGTGCCTGGCCTCTGCTGG + Intergenic
978764355 4:112389329-112389351 CCACCGTGCCTGGCCTGTGCTGG + Intronic
980115104 4:128672132-128672154 CCATGGTGCCACTCTTCTGAGGG + Intergenic
982850495 4:160309357-160309379 CCATTGTTCCAGGCATCTACTGG + Intergenic
983586176 4:169357280-169357302 CCACTGTGCCTGGCCTCTGTTGG - Intergenic
984396206 4:179203015-179203037 CACTTGTGCCAGGCCTCTGATGG + Intergenic
985788582 5:1913048-1913070 CCATGGTGCAAGGCCCTTGCTGG + Intergenic
985996774 5:3601220-3601242 CCAGGTGGCCAGGCCTCTGCCGG + Exonic
986409327 5:7461040-7461062 GCAAGGAGCCAGGCCTCTGCTGG - Intronic
986813537 5:11384668-11384690 CCAGGCTGCCCGGCCTCTGGAGG + Exonic
987392457 5:17388600-17388622 CCACCGTGCCTGACCTCTGCAGG + Intergenic
987404593 5:17512097-17512119 CCAGGGTGCCAAGCCTGTGGCGG + Intergenic
987412202 5:17625818-17625840 CCAGGGTGCCAAGCCTGTGGCGG + Intergenic
987441062 5:17957107-17957129 CCTTTATGCCAGGCCTCTTCAGG - Intergenic
987494898 5:18630658-18630680 CTATGCTGCCAGGCCTGTGATGG + Intergenic
988780987 5:34521763-34521785 CCATGGCTCCAGGCCTCACCGGG - Intergenic
988983248 5:36592773-36592795 CCACCGTGCCCGGCCTCTACTGG - Intergenic
990567680 5:57046046-57046068 CCACCGTGCCCGGCCTCGGCAGG - Intergenic
991404047 5:66284420-66284442 CCCTAGTGCCAGTCCTCTGTGGG - Intergenic
992130959 5:73692682-73692704 CCTTGGTCCCAGCCTTCTGCAGG + Intronic
992636357 5:78729085-78729107 CCATTGTGCCTGGCCTCTAGAGG - Intronic
992671937 5:79069764-79069786 CCATGGTGCCGCGGCTCTGTGGG - Exonic
995370689 5:111415604-111415626 CCATGGTTTCAGGCATCTACTGG + Intronic
995813395 5:116135782-116135804 CCATGGTTTCAGGCCTCCACTGG + Intronic
997539642 5:134651060-134651082 CCACTGTGCCTGGCCTCTACAGG + Intronic
997996243 5:138589114-138589136 CCATGAGGCCAGGCCTCTCTAGG + Intergenic
998545445 5:143023639-143023661 AGAGGCTGCCAGGCCTCTGCTGG + Intronic
999287750 5:150404429-150404451 CTGTGGTGACAGGCCTCTGTGGG + Intronic
1000020110 5:157311174-157311196 CCATGTTGCCAGGGCACTGTTGG + Intronic
1001417379 5:171555568-171555590 CCATGGCACCAGGGCCCTGCAGG - Intergenic
1001480887 5:172088627-172088649 CCTGGGGGCCAGGCCTTTGCAGG - Intronic
1001815266 5:174663441-174663463 CCATTGTGCCAGGCCTGATCTGG + Intergenic
1002333621 5:178462981-178463003 ACATGGTGCCAGCCTTCAGCTGG - Intronic
1002643515 5:180641608-180641630 TCCTGGGGCCAGGCCTCTGCAGG + Intronic
1002773845 6:311938-311960 CGATAGTGCCAGGCCTATGTTGG + Exonic
1003463323 6:6352525-6352547 CCACCGCGCCCGGCCTCTGCAGG - Intergenic
1003549901 6:7093869-7093891 CCACGGTGCCCGGCCTGTTCTGG + Intergenic
1003572531 6:7265243-7265265 CCAAGGTCCAAGGCCTGTGCTGG + Intergenic
1005910634 6:30306553-30306575 GCCTGGTGCAAGGCCTCTGCTGG + Intergenic
1006366525 6:33619465-33619487 CTGTGATGTCAGGCCTCTGCTGG - Intergenic
1006959804 6:37917164-37917186 CCATGATTTCAGGCTTCTGCTGG + Intronic
1007323090 6:41041173-41041195 CCTTGGTGCCTGGCCTCTGGAGG - Intronic
1007335119 6:41150243-41150265 GCATGGTAAGAGGCCTCTGCAGG - Exonic
1009909860 6:69912798-69912820 CCACCGTGCCTGGCCTCTACTGG - Intronic
1010257029 6:73770455-73770477 CCACAGTGCCTGGCCCCTGCTGG - Intronic
1010781313 6:79948001-79948023 TCATGGTGACAGGCATGTGCTGG - Intergenic
1011239640 6:85257309-85257331 CCATGGTGCCAGGCCTAAGTTGG - Intergenic
1011970142 6:93212263-93212285 CCACCGTGCCCGGCTTCTGCAGG - Intergenic
1012003274 6:93681105-93681127 CCATGGTGCTGGGCTGCTGCTGG + Intergenic
1013341420 6:109219786-109219808 CCATGGTGCCCGGCCACCTCTGG + Intergenic
1013889266 6:115006471-115006493 TCATGGTACCTGGCCTCTGAAGG + Intergenic
1015792803 6:136980931-136980953 CCATGGAGCCAGCCCCATGCCGG + Intergenic
1016640956 6:146348787-146348809 CAATGGTGCCAGGGCACTGAAGG + Intronic
1016816329 6:148306398-148306420 CCAAGGTTCCAGGCCTCAGCTGG + Intronic
1018048330 6:159984995-159985017 TCCTGGTTCCAGGCCTCTACTGG + Intronic
1018379862 6:163248876-163248898 GCATGGTGGCAGGCGTCTGTTGG + Intronic
1020378484 7:7514999-7515021 TCATGGAGCCAGGAGTCTGCAGG - Intronic
1021481184 7:21119234-21119256 CCAGGGTTCCAGGCCTCATCAGG - Intergenic
1022637518 7:32150820-32150842 GCATGGAGCTAGGCCCCTGCTGG - Intronic
1023042924 7:36188081-36188103 CCACTGTGCCTGGCCTGTGCTGG + Intronic
1023822126 7:43986265-43986287 CCACGGTGCCCGGGCTCTGGGGG + Intergenic
1023889290 7:44381155-44381177 CCAATGTGCCAGACCTGTGCTGG + Exonic
1025243848 7:57300962-57300984 TCATGGTGTCAGGTCTGTGCAGG + Intergenic
1025244782 7:57308843-57308865 CCAGGGTGCCTGGCCCCAGCCGG - Intergenic
1026169416 7:67940830-67940852 TCATGGTGCCAGGTCTGTGCAGG + Intergenic
1026643709 7:72149824-72149846 CCACGGTGCCTGGCCTGTCCTGG - Intronic
1026989359 7:74574746-74574768 CCACCGTGCCCGGCCTATGCTGG + Intronic
1027021910 7:74821208-74821230 CCATGGGTCCAGGCATCTACTGG + Intronic
1027066111 7:75124709-75124731 CCATGGGTCCAGGCATCTACTGG - Intronic
1028625479 7:92872228-92872250 CCATCATGCCTGGCCTTTGCAGG + Intergenic
1029450148 7:100636976-100636998 CCATGGTGCCCAGCCTGTTCAGG - Intronic
1029609598 7:101619600-101619622 CCACCGTGCCCGGCCTCTGGTGG - Intronic
1029750392 7:102539679-102539701 CCACGGTGCCCGGGCTCTGGGGG + Intronic
1029768344 7:102638787-102638809 CCACGGTGCCCGGGCTCTGGGGG + Exonic
1034886340 7:154801809-154801831 GCATGGAGCCATGCCTCAGCGGG - Intronic
1036116083 8:5962071-5962093 CCACCGTGCCCGGCCACTGCAGG - Intergenic
1038884596 8:31649239-31649261 CCATGGTGCCCGGCCTCATATGG + Intronic
1041731785 8:61070078-61070100 CCACAGTGCCTGGCCTCTCCAGG + Intronic
1042223717 8:66498543-66498565 CCATGGTTTCAGGCATCCGCTGG - Intronic
1042714616 8:71759136-71759158 CCATGGTTTTAGGCCGCTGCTGG + Intergenic
1043798927 8:84581520-84581542 CCAATGTGCCAGCTCTCTGCAGG - Intronic
1045469361 8:102497425-102497447 CCTTGGTGCCTGGCTTCTGGTGG - Intergenic
1045583411 8:103501518-103501540 CCCTGGTCCCACGCCTCCGCGGG + Intronic
1046561033 8:115837635-115837657 CCACCGTGCCCGGCCTCTACAGG - Intergenic
1047048252 8:121079285-121079307 CCATGGGGCCAGGAGTCTTCAGG - Intergenic
1047164162 8:122418319-122418341 CCACTGTTCCAGGCCTGTGCTGG - Intergenic
1048456876 8:134586539-134586561 CCATGGTCTCCAGCCTCTGCTGG + Intronic
1048970703 8:139643586-139643608 CCATGATGCCGGCCCTCAGCAGG + Intronic
1049279606 8:141737573-141737595 CCATGGTGCCTGACCCCTGTTGG + Intergenic
1049395384 8:142397857-142397879 GCATGGAGCCTGGCCCCTGCAGG + Intronic
1049562517 8:143318758-143318780 CCATGGTGCCAGGCTGATGAGGG - Intronic
1049581242 8:143412047-143412069 CCCTGGTGCCAGGGTCCTGCTGG - Intergenic
1051115048 9:13685079-13685101 CCATGGTTTCAGGCATCTGCTGG + Intergenic
1060795442 9:126509682-126509704 CCATTTTTCCAGGCCTGTGCTGG - Intergenic
1061391178 9:130318016-130318038 CCTGGGGGCCAGGGCTCTGCAGG + Intronic
1061395194 9:130339974-130339996 CCAAGGGTCCAGGCCCCTGCGGG - Intronic
1061422893 9:130481709-130481731 CCATGCTGCCATGCCTTTCCAGG - Intronic
1061635556 9:131906419-131906441 CTAGGATGCCAGGCCTTTGCAGG - Intronic
1062220762 9:135413849-135413871 CCATGGGGCAGGGCCTCAGCTGG - Intergenic
1062502443 9:136857295-136857317 CCCGGGTGCCAGGCCTCACCTGG - Exonic
1187190747 X:17032585-17032607 GCATGGTGCTAGGCCTAGGCTGG + Intronic
1187213695 X:17254219-17254241 CCAGGCTGCCAGGCAGCTGCTGG - Intergenic
1188378439 X:29462462-29462484 CCATAGTGCCAGGTCTCAGGAGG - Intronic
1189376979 X:40474158-40474180 CCATGCAGCCAGGCTCCTGCTGG + Intergenic
1189418021 X:40831953-40831975 CCAGGATGCCCGCCCTCTGCAGG + Intergenic
1190291977 X:48999356-48999378 CCTTCCTGCCAGGCCTCTGAGGG + Intronic
1193457973 X:81754764-81754786 CCATGGTTCCATGCCGCTCCAGG - Intergenic
1195169413 X:102251249-102251271 CCATGGTGCCTGGCCTGTATGGG + Intergenic
1195189444 X:102435839-102435861 CCATGGTGCCTGGCCTGTATGGG - Intronic
1195944017 X:110190114-110190136 GCAAGGTGCCATGCCTCTGGAGG + Intergenic
1198149502 X:133894550-133894572 CCACCGTGCCCGGCCTCTTCAGG - Intronic